ID: 1160570709

View in Genome Browser
Species Human (GRCh38)
Location 18:79815848-79815870
Sequence GCAGCTCAGCTCCAGGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570709_1160570717 -8 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570717 18:79815863-79815885 TGAGCTGCACTGCCACAGGGGGG No data
1160570709_1160570715 -10 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570709_1160570721 28 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570709_1160570718 -5 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570718 18:79815866-79815888 GCTGCACTGCCACAGGGGGGTGG No data
1160570709_1160570716 -9 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570716 18:79815862-79815884 CTGAGCTGCACTGCCACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570709 Original CRISPR GCAGCTCAGCTCCAGGGCGG TGG (reversed) Intergenic
No off target data available for this crispr