ID: 1160570710

View in Genome Browser
Species Human (GRCh38)
Location 18:79815851-79815873
Sequence AGTGCAGCTCAGCTCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570710_1160570721 25 Left 1160570710 18:79815851-79815873 CCGCCCTGGAGCTGAGCTGCACT No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570710_1160570718 -8 Left 1160570710 18:79815851-79815873 CCGCCCTGGAGCTGAGCTGCACT No data
Right 1160570718 18:79815866-79815888 GCTGCACTGCCACAGGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570710 Original CRISPR AGTGCAGCTCAGCTCCAGGG CGG (reversed) Intergenic
No off target data available for this crispr