ID: 1160570713

View in Genome Browser
Species Human (GRCh38)
Location 18:79815859-79815881
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570707_1160570713 -2 Left 1160570707 18:79815838-79815860 CCGATGGCACCCACCGCCCTGGA No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570705_1160570713 -1 Left 1160570705 18:79815837-79815859 CCCGATGGCACCCACCGCCCTGG No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570699_1160570713 17 Left 1160570699 18:79815819-79815841 CCCCGCTGGCCTGTGTGCCCCGA No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570701_1160570713 15 Left 1160570701 18:79815821-79815843 CCGCTGGCCTGTGTGCCCCGATG No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570700_1160570713 16 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570704_1160570713 0 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data
1160570703_1160570713 8 Left 1160570703 18:79815828-79815850 CCTGTGTGCCCCGATGGCACCCA No data
Right 1160570713 18:79815859-79815881 GAGCTGAGCTGCACTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570713 Original CRISPR GAGCTGAGCTGCACTGCCAC AGG Intergenic