ID: 1160570715

View in Genome Browser
Species Human (GRCh38)
Location 18:79815861-79815883
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570709_1160570715 -10 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570699_1160570715 19 Left 1160570699 18:79815819-79815841 CCCCGCTGGCCTGTGTGCCCCGA No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570707_1160570715 0 Left 1160570707 18:79815838-79815860 CCGATGGCACCCACCGCCCTGGA No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570703_1160570715 10 Left 1160570703 18:79815828-79815850 CCTGTGTGCCCCGATGGCACCCA No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570708_1160570715 -9 Left 1160570708 18:79815847-79815869 CCCACCGCCCTGGAGCTGAGCTG No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570704_1160570715 2 Left 1160570704 18:79815836-79815858 CCCCGATGGCACCCACCGCCCTG No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570705_1160570715 1 Left 1160570705 18:79815837-79815859 CCCGATGGCACCCACCGCCCTGG No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570700_1160570715 18 Left 1160570700 18:79815820-79815842 CCCGCTGGCCTGTGTGCCCCGAT No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data
1160570701_1160570715 17 Left 1160570701 18:79815821-79815843 CCGCTGGCCTGTGTGCCCCGATG No data
Right 1160570715 18:79815861-79815883 GCTGAGCTGCACTGCCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570715 Original CRISPR GCTGAGCTGCACTGCCACAG GGG Intergenic