ID: 1160570721

View in Genome Browser
Species Human (GRCh38)
Location 18:79815899-79815921
Sequence TGCTGAGCAAACACTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160570719_1160570721 1 Left 1160570719 18:79815875-79815897 CCACAGGGGGGTGGCAGCCAACA No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570711_1160570721 22 Left 1160570711 18:79815854-79815876 CCCTGGAGCTGAGCTGCACTGCC No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570712_1160570721 21 Left 1160570712 18:79815855-79815877 CCTGGAGCTGAGCTGCACTGCCA No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570709_1160570721 28 Left 1160570709 18:79815848-79815870 CCACCGCCCTGGAGCTGAGCTGC No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570708_1160570721 29 Left 1160570708 18:79815847-79815869 CCCACCGCCCTGGAGCTGAGCTG No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data
1160570710_1160570721 25 Left 1160570710 18:79815851-79815873 CCGCCCTGGAGCTGAGCTGCACT No data
Right 1160570721 18:79815899-79815921 TGCTGAGCAAACACTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160570721 Original CRISPR TGCTGAGCAAACACTGAATT TGG Intergenic
No off target data available for this crispr