ID: 1160571006

View in Genome Browser
Species Human (GRCh38)
Location 18:79817848-79817870
Sequence GCTCAAACCAGGAATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571006_1160571012 -1 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571012 18:79817870-79817892 CCCGTGGAAGCCCAGGTCTCGGG No data
1160571006_1160571016 4 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571006_1160571014 0 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571014 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
1160571006_1160571022 17 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571006_1160571021 16 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571021 18:79817887-79817909 CTCGGGGTGGGGGTGCCCTGAGG No data
1160571006_1160571009 -8 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571009 18:79817863-79817885 GTTTGAGCCCGTGGAAGCCCAGG No data
1160571006_1160571017 5 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571017 18:79817876-79817898 GAAGCCCAGGTCTCGGGGTGGGG No data
1160571006_1160571023 27 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571023 18:79817898-79817920 GGTGCCCTGAGGGTGCTGTGAGG No data
1160571006_1160571024 30 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571024 18:79817901-79817923 GCCCTGAGGGTGCTGTGAGGTGG No data
1160571006_1160571015 3 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571015 18:79817874-79817896 TGGAAGCCCAGGTCTCGGGGTGG No data
1160571006_1160571018 6 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571018 18:79817877-79817899 AAGCCCAGGTCTCGGGGTGGGGG No data
1160571006_1160571010 -2 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571010 18:79817869-79817891 GCCCGTGGAAGCCCAGGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571006 Original CRISPR GCTCAAACCAGGAATGAGAG AGG (reversed) Intergenic