ID: 1160571008

View in Genome Browser
Species Human (GRCh38)
Location 18:79817859-79817881
Sequence GGCTTCCACGGGCTCAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571008_1160571016 -7 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571008_1160571022 6 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571008_1160571015 -8 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571015 18:79817874-79817896 TGGAAGCCCAGGTCTCGGGGTGG No data
1160571008_1160571021 5 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571021 18:79817887-79817909 CTCGGGGTGGGGGTGCCCTGAGG No data
1160571008_1160571017 -6 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571017 18:79817876-79817898 GAAGCCCAGGTCTCGGGGTGGGG No data
1160571008_1160571027 27 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571008_1160571023 16 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571023 18:79817898-79817920 GGTGCCCTGAGGGTGCTGTGAGG No data
1160571008_1160571028 28 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571028 18:79817910-79817932 GTGCTGTGAGGTGGTGAATTGGG No data
1160571008_1160571024 19 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571024 18:79817901-79817923 GCCCTGAGGGTGCTGTGAGGTGG No data
1160571008_1160571018 -5 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571018 18:79817877-79817899 AAGCCCAGGTCTCGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571008 Original CRISPR GGCTTCCACGGGCTCAAACC AGG (reversed) Intergenic