ID: 1160571013

View in Genome Browser
Species Human (GRCh38)
Location 18:79817871-79817893
Sequence CCCCGAGACCTGGGCTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571013_1160571021 -7 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571021 18:79817887-79817909 CTCGGGGTGGGGGTGCCCTGAGG No data
1160571013_1160571027 15 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571013_1160571022 -6 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571013_1160571023 4 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571023 18:79817898-79817920 GGTGCCCTGAGGGTGCTGTGAGG No data
1160571013_1160571029 29 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571013_1160571028 16 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571028 18:79817910-79817932 GTGCTGTGAGGTGGTGAATTGGG No data
1160571013_1160571024 7 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571024 18:79817901-79817923 GCCCTGAGGGTGCTGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571013 Original CRISPR CCCCGAGACCTGGGCTTCCA CGG (reversed) Intergenic