ID: 1160571016

View in Genome Browser
Species Human (GRCh38)
Location 18:79817875-79817897
Sequence GGAAGCCCAGGTCTCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571008_1160571016 -7 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571002_1160571016 20 Left 1160571002 18:79817832-79817854 CCTGACTGTGAGGACCCCTCTCT No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571004_1160571016 6 Left 1160571004 18:79817846-79817868 CCCCTCTCTCATTCCTGGTTTGA No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571005_1160571016 5 Left 1160571005 18:79817847-79817869 CCCTCTCTCATTCCTGGTTTGAG No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571006_1160571016 4 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571000_1160571016 28 Left 1160571000 18:79817824-79817846 CCCTCGGACCTGACTGTGAGGAC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data
1160571001_1160571016 27 Left 1160571001 18:79817825-79817847 CCTCGGACCTGACTGTGAGGACC No data
Right 1160571016 18:79817875-79817897 GGAAGCCCAGGTCTCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571016 Original CRISPR GGAAGCCCAGGTCTCGGGGT GGG Intergenic