ID: 1160571019

View in Genome Browser
Species Human (GRCh38)
Location 18:79817880-79817902
Sequence GCACCCCCACCCCGAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571019_1160571024 -2 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571024 18:79817901-79817923 GCCCTGAGGGTGCTGTGAGGTGG No data
1160571019_1160571029 20 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571019_1160571028 7 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571028 18:79817910-79817932 GTGCTGTGAGGTGGTGAATTGGG No data
1160571019_1160571023 -5 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571023 18:79817898-79817920 GGTGCCCTGAGGGTGCTGTGAGG No data
1160571019_1160571030 27 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571030 18:79817930-79817952 GGGCTCTTTCCTGAGGTGCATGG No data
1160571019_1160571031 28 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571031 18:79817931-79817953 GGCTCTTTCCTGAGGTGCATGGG No data
1160571019_1160571027 6 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571019 Original CRISPR GCACCCCCACCCCGAGACCT GGG (reversed) Intergenic