ID: 1160571020

View in Genome Browser
Species Human (GRCh38)
Location 18:79817881-79817903
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571020_1160571024 -3 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571024 18:79817901-79817923 GCCCTGAGGGTGCTGTGAGGTGG No data
1160571020_1160571023 -6 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571023 18:79817898-79817920 GGTGCCCTGAGGGTGCTGTGAGG No data
1160571020_1160571029 19 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571020_1160571027 5 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571020_1160571031 27 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571031 18:79817931-79817953 GGCTCTTTCCTGAGGTGCATGGG No data
1160571020_1160571030 26 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571030 18:79817930-79817952 GGGCTCTTTCCTGAGGTGCATGG No data
1160571020_1160571028 6 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571028 18:79817910-79817932 GTGCTGTGAGGTGGTGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571020 Original CRISPR GGCACCCCCACCCCGAGACC TGG (reversed) Intergenic