ID: 1160571022

View in Genome Browser
Species Human (GRCh38)
Location 18:79817888-79817910
Sequence TCGGGGTGGGGGTGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571006_1160571022 17 Left 1160571006 18:79817848-79817870 CCTCTCTCATTCCTGGTTTGAGC No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571004_1160571022 19 Left 1160571004 18:79817846-79817868 CCCCTCTCTCATTCCTGGTTTGA No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571008_1160571022 6 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571005_1160571022 18 Left 1160571005 18:79817847-79817869 CCCTCTCTCATTCCTGGTTTGAG No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571013_1160571022 -6 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data
1160571011_1160571022 -5 Left 1160571011 18:79817870-79817892 CCCGTGGAAGCCCAGGTCTCGGG No data
Right 1160571022 18:79817888-79817910 TCGGGGTGGGGGTGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571022 Original CRISPR TCGGGGTGGGGGTGCCCTGA GGG Intergenic
No off target data available for this crispr