ID: 1160571027

View in Genome Browser
Species Human (GRCh38)
Location 18:79817909-79817931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571019_1160571027 6 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571013_1160571027 15 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571011_1160571027 16 Left 1160571011 18:79817870-79817892 CCCGTGGAAGCCCAGGTCTCGGG No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571020_1160571027 5 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data
1160571008_1160571027 27 Left 1160571008 18:79817859-79817881 CCTGGTTTGAGCCCGTGGAAGCC No data
Right 1160571027 18:79817909-79817931 GGTGCTGTGAGGTGGTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571027 Original CRISPR GGTGCTGTGAGGTGGTGAAT TGG Intergenic
No off target data available for this crispr