ID: 1160571029

View in Genome Browser
Species Human (GRCh38)
Location 18:79817923-79817945
Sequence GTGAATTGGGCTCTTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160571011_1160571029 30 Left 1160571011 18:79817870-79817892 CCCGTGGAAGCCCAGGTCTCGGG No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571025_1160571029 -2 Left 1160571025 18:79817902-79817924 CCCTGAGGGTGCTGTGAGGTGGT No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571013_1160571029 29 Left 1160571013 18:79817871-79817893 CCGTGGAAGCCCAGGTCTCGGGG No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571020_1160571029 19 Left 1160571020 18:79817881-79817903 CCAGGTCTCGGGGTGGGGGTGCC No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571026_1160571029 -3 Left 1160571026 18:79817903-79817925 CCTGAGGGTGCTGTGAGGTGGTG No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data
1160571019_1160571029 20 Left 1160571019 18:79817880-79817902 CCCAGGTCTCGGGGTGGGGGTGC No data
Right 1160571029 18:79817923-79817945 GTGAATTGGGCTCTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160571029 Original CRISPR GTGAATTGGGCTCTTTCCTG AGG Intergenic
No off target data available for this crispr