ID: 1160575694

View in Genome Browser
Species Human (GRCh38)
Location 18:79852656-79852678
Sequence CCAGCGCCTGCACCTGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160575685_1160575694 15 Left 1160575685 18:79852618-79852640 CCTCGAAGATCACCGTTGTCCAT No data
Right 1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG No data
1160575689_1160575694 3 Left 1160575689 18:79852630-79852652 CCGTTGTCCATGCGGATGGCGGC No data
Right 1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG No data
1160575690_1160575694 -4 Left 1160575690 18:79852637-79852659 CCATGCGGATGGCGGCTCACCAG No data
Right 1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160575694 Original CRISPR CCAGCGCCTGCACCTGGGCG TGG Intergenic
No off target data available for this crispr