ID: 1160577322

View in Genome Browser
Species Human (GRCh38)
Location 18:79864068-79864090
Sequence GCGCGGGGCCGACGGAGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160577311_1160577322 6 Left 1160577311 18:79864039-79864061 CCGCCGCGAGGAGGAGGCGGCCG 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 231
1160577306_1160577322 15 Left 1160577306 18:79864030-79864052 CCGCCTGCGCCGCCGCGAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 231
1160577312_1160577322 3 Left 1160577312 18:79864042-79864064 CCGCGAGGAGGAGGCGGCCGAGG 0: 1
1: 0
2: 5
3: 46
4: 395
Right 1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 231
1160577304_1160577322 21 Left 1160577304 18:79864024-79864046 CCTGCGCCGCCTGCGCCGCCGCG 0: 1
1: 0
2: 15
3: 304
4: 2389
Right 1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 231
1160577308_1160577322 12 Left 1160577308 18:79864033-79864055 CCTGCGCCGCCGCGAGGAGGAGG 0: 1
1: 0
2: 3
3: 24
4: 203
Right 1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160577322 Original CRISPR GCGCGGGGCCGACGGAGCGC GGG Exonic