ID: 1160579348

View in Genome Browser
Species Human (GRCh38)
Location 18:79874845-79874867
Sequence CCTGAAGTCCCGGCCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160579348_1160579359 20 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579359 18:79874888-79874910 ATTCCTTCCTGTGGTAGGAGTGG 0: 1
1: 0
2: 0
3: 22
4: 207
1160579348_1160579360 21 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579360 18:79874889-79874911 TTCCTTCCTGTGGTAGGAGTGGG 0: 1
1: 0
2: 3
3: 22
4: 220
1160579348_1160579365 30 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579365 18:79874898-79874920 GTGGTAGGAGTGGGGGTTCCTGG 0: 1
1: 0
2: 1
3: 40
4: 354
1160579348_1160579357 15 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579357 18:79874883-79874905 TCGCCATTCCTTCCTGTGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 109
1160579348_1160579355 11 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579355 18:79874879-79874901 CCCATCGCCATTCCTTCCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 181
1160579348_1160579361 22 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579361 18:79874890-79874912 TCCTTCCTGTGGTAGGAGTGGGG 0: 1
1: 0
2: 3
3: 35
4: 272
1160579348_1160579363 23 Left 1160579348 18:79874845-79874867 CCAGCGCAGGCCGGGACTTCAGG 0: 1
1: 1
2: 0
3: 17
4: 131
Right 1160579363 18:79874891-79874913 CCTTCCTGTGGTAGGAGTGGGGG 0: 1
1: 0
2: 2
3: 24
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160579348 Original CRISPR CCTGAAGTCCCGGCCTGCGC TGG (reversed) Intronic
900168464 1:1254489-1254511 CCAGGAGGCCCGGCCTGCGGAGG + Intronic
901829923 1:11886138-11886160 CCTAATGTCCTGGCCTGGGCAGG + Intergenic
902839562 1:19066420-19066442 CCTGAGGTCAGGGCCTGAGCTGG + Intergenic
902872705 1:19324172-19324194 CCTGGAGACCCGGCGTGCCCAGG + Intronic
903936164 1:26896574-26896596 CCTGAAGTCCCAGCTTACTCGGG + Intronic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
904477481 1:30774591-30774613 CCTCAAGTCCATGCCTGCTCAGG - Intergenic
906140633 1:43531632-43531654 CGTGCGGTCCCGGGCTGCGCCGG + Intronic
906846385 1:49197539-49197561 GCTGAGGTGCCGGCCTGGGCGGG + Intronic
907530019 1:55085731-55085753 CCTGAATTCCTGGCCTACCCTGG + Intronic
913004194 1:114612475-114612497 CCTGTAGTCCCAGCCTACTCTGG - Intronic
919464620 1:197913593-197913615 CCTGGATGCCCGGGCTGCGCTGG - Intronic
921692273 1:218164943-218164965 CCTCCAGTCCCGGGCGGCGCCGG + Intergenic
1064088114 10:12360876-12360898 TCTGCAGTCCCGGCCTGGCCCGG - Intronic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1075894309 10:125981382-125981404 CCTGTAGTCCCGGGCTGAGGTGG + Intronic
1083393871 11:62375005-62375027 CCTGAGGTCCCAGCCTTTGCAGG + Intronic
1083432578 11:62621967-62621989 CCTGCAGACCCCGCCTGCTCGGG - Exonic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1085258167 11:75188879-75188901 CCTGAAGGTCAGGCCTGTGCTGG + Intronic
1085347771 11:75779295-75779317 CCTGAAGTCCAGGTGTGGGCTGG + Intronic
1085351807 11:75802565-75802587 CCAGAAGCCCCAGCCTGCCCGGG + Intergenic
1086001232 11:81987956-81987978 GCTGCAGTCCAGGCCTGCTCAGG - Intergenic
1095283579 12:40384704-40384726 CCTGAACTCCCGGCATTGGCCGG + Intergenic
1096173332 12:49492342-49492364 CCTGTAGTCCCGCCCTACGTAGG - Intronic
1097771934 12:63597095-63597117 CCTGTAGTCCCAGCCTGAGTAGG - Intronic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1104774610 12:131384049-131384071 CCAGAAGACCCCGCCTGCACTGG + Intergenic
1104775744 12:131389267-131389289 CCTGAGGCCCCGGGCTGAGCTGG + Intergenic
1105403881 13:20118454-20118476 CCTGAGCACCCGGCCTGCCCAGG + Intergenic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1106231703 13:27825840-27825862 CCTGGAGTCCCCGCCAGCCCAGG - Intergenic
1106480439 13:30133415-30133437 CCTGAAGGCCCAGCCTCTGCTGG + Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1108340675 13:49496052-49496074 CCCGGAGGCCCGGCCCGCGCAGG + Exonic
1108386475 13:49903908-49903930 CCTGTAGTCCCAGCCTGCTCTGG - Intergenic
1112618830 13:101034450-101034472 CCTGAAGTCCCTGCCACCACAGG + Intergenic
1113707215 13:112442685-112442707 CCTGCAGTCCCTCCCTGCACGGG + Intergenic
1117072460 14:52069097-52069119 CCTGGAGTCCCGCCCCGCCCAGG - Intronic
1119753517 14:77098081-77098103 CCGGAAGACCAGGCCGGCGCGGG - Exonic
1122640223 14:103155476-103155498 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640236 14:103155512-103155534 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640250 14:103155548-103155570 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1123715607 15:23028164-23028186 CCTGCAATCCCAGCCTGGGCTGG + Intronic
1128450934 15:67805532-67805554 CCTGAAAGCCCAGCCTGTGCAGG + Intronic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1131686014 15:94768416-94768438 CCTGAACTCCCCCCCTGCACGGG - Intergenic
1135238299 16:20779297-20779319 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1138095359 16:54207072-54207094 CCTGAAATCCAGGCATGCCCAGG - Intergenic
1138844416 16:60547939-60547961 CCTGTAGTCCCAGCCTACTCAGG + Intergenic
1141469631 16:84229609-84229631 CCTGCAGGCCGGGCCTGTGCTGG - Intronic
1141927041 16:87176899-87176921 CCTGAAGCCCAGGCCTGCCTCGG - Intronic
1142074383 16:88108880-88108902 TCTGAAGTCCCGACCGGGGCTGG - Intronic
1142187117 16:88699786-88699808 CCTGAGGTCTCGGCCTCCCCAGG - Intronic
1142231965 16:88904180-88904202 CATGAAGTCCCCGACTGCTCAGG - Intronic
1143007847 17:3848396-3848418 CCTGATGTCCCGGCTTGTCCTGG - Intergenic
1143450888 17:7036168-7036190 ACTGAAGACCTGGCCCGCGCTGG - Exonic
1144943955 17:18960363-18960385 CCTGGAATCCCGGGCTGCTCCGG - Intronic
1145355420 17:22142162-22142184 GCTGTAGTTCAGGCCTGCGCAGG - Intergenic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1148554545 17:48570476-48570498 CCTGGATTCCCTGCCTGCCCCGG - Intronic
1150610250 17:66727768-66727790 CCTGAAGACCCAGCCTTCCCTGG - Intronic
1151892554 17:76959173-76959195 CAGGAAGCCTCGGCCTGCGCTGG + Intergenic
1152095588 17:78269906-78269928 CCAGAAGTCGCTGCCTGCTCAGG + Intergenic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154255781 18:12779796-12779818 CCTTCAGTCCCGGCCTAAGCAGG + Intergenic
1160439584 18:78879225-78879247 CTAGAACTCCCTGCCTGCGCTGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161300368 19:3539543-3539565 TCTGAAATCCAGGCCTGTGCGGG + Intronic
1161550697 19:4910451-4910473 TCTGAAGTTCCGGCCCGCGCTGG + Intronic
1162731164 19:12719857-12719879 CCTGAAGACCCAGCCAGAGCAGG + Intronic
1162781371 19:13008633-13008655 CCTGAGCTCCAGGCCTGGGCAGG - Intronic
1163552596 19:17973996-17974018 CCTGGAGGCCCGGGCTGTGCGGG - Exonic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
928623908 2:33119679-33119701 CCTGTAGTCCCAGCCTACTCGGG - Intronic
933175614 2:79169516-79169538 CCTGAACTCCCGGCATTAGCAGG - Intergenic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
935268946 2:101417091-101417113 CCGGAAGGCCCAGCCTGCTCAGG - Intronic
935474431 2:103501259-103501281 ACTCAACTCCCGGCCTGCACTGG + Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
1168956821 20:1840339-1840361 CTTCAAGTCCCTGCCTGCTCCGG - Intergenic
1169001726 20:2172833-2172855 TCTGAAGACCCTGCCTGGGCAGG - Intronic
1172095426 20:32457823-32457845 CTCGGAGTCCCGGCCCGCGCTGG + Intronic
1175161817 20:57013882-57013904 TCTGTAGCCCCGGACTGCGCGGG - Intergenic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1176068786 20:63215607-63215629 CCCCACGTCCCGGCCTGCGGCGG - Intronic
1177435678 21:21049141-21049163 CCTGTAGTCCCAGCCTACTCGGG - Intronic
1179580894 21:42343440-42343462 CATGAGGTCCCTGCCTGCACTGG + Intergenic
1181039765 22:20186464-20186486 CCTCAAGTCCCTCCCTGCACAGG - Intergenic
1184020700 22:41819428-41819450 CCTGAAGGCCCTGCCTCAGCTGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953109669 3:39921755-39921777 CCTGTAGTCCCAGCCTACTCAGG + Intronic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
954003908 3:47577980-47578002 CCTGGAGCCCCGGCCCGCCCCGG + Intronic
954096853 3:48335417-48335439 CCTGAACTCCCGGCATTGGCTGG - Intergenic
964901571 3:161665345-161665367 CCTGTAGTCCCAGCCTACTCAGG - Intergenic
966406549 3:179604527-179604549 CCTCAGGTCCCTGCCTGCACAGG - Exonic
966912875 3:184569163-184569185 GCTGGAGCCCCGGCCTGCTCCGG + Intronic
967704518 3:192633950-192633972 CCTGAAATCCCTGTCTGCTCAGG + Intronic
967968434 3:194982250-194982272 TTTGAAGTCCCAGCCTGCTCTGG - Intergenic
976629158 4:87219931-87219953 CCTGGAGCCGCGGCCTGCGGGGG - Intronic
977956861 4:103037983-103038005 CCTGTAGTCCCAGCCTACTCAGG - Intronic
978446609 4:108786564-108786586 CCTGAGGTCCCAGCCTTTGCAGG - Intergenic
979201845 4:117987927-117987949 CCTGAAGCCCCGGCCAGGGGAGG - Intergenic
981171959 4:141636240-141636262 CCTGGAGACCCGGGCTGGGCTGG - Intergenic
990450478 5:55928173-55928195 CCTGAAATCCCACCCTGCCCTGG - Intergenic
994372452 5:98982751-98982773 CCTGCAGTCCCAGCCTACTCAGG - Intergenic
994606358 5:101972227-101972249 CCTGTAGTCCCAGCTTGCTCGGG - Intergenic
995041492 5:107593291-107593313 ACTGAAGTCCGGTCCTGTGCTGG - Intronic
1002344975 5:178542476-178542498 CCTGAAGGAAGGGCCTGCGCTGG + Intronic
1002523622 5:179804359-179804381 GCTGAAGTCCAGGCCTGGGGAGG + Intronic
1007013773 6:38442360-38442382 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG + Intergenic
1008582655 6:52920839-52920861 CCTGAACTCCCGGCTTTAGCTGG - Intergenic
1009940217 6:70281532-70281554 CCTGAAGCCCCCGCCTCCGTGGG + Intronic
1015945036 6:138490755-138490777 CCTGTAGTCCCAGCCTTCTCAGG - Intronic
1017676474 6:156819768-156819790 CCTGAACTCCAGGCCCGGGCAGG - Intronic
1018923289 6:168190304-168190326 CCTGACGTCCCTGCCTGCAAGGG + Intergenic
1018923297 6:168190357-168190379 CCTGACGTCCCTGCCTGCAAGGG + Intergenic
1019301211 7:304408-304430 GTTGAAGTCCCGTCCTGCACAGG + Intergenic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1022366248 7:29721245-29721267 CCTGTAGTCCCAGCCTGAGTAGG + Intergenic
1022415554 7:30173792-30173814 CCTGAAGACCCAGCCTCCCCTGG + Intergenic
1022931498 7:35120795-35120817 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1029827388 7:103213286-103213308 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1033127827 7:138720461-138720483 CCTCAAGTCCTGGCCTGTCCAGG - Intronic
1040630858 8:49208441-49208463 CCTGAAGTCCATGCCTGCAGAGG + Intergenic
1046803018 8:118449673-118449695 CCTGTAGTCCCAGCCTGCCTCGG + Intronic
1049285640 8:141773715-141773737 CCTTCAGGCCCAGCCTGCGCAGG + Intergenic
1049605522 8:143527420-143527442 GCTGAAGACCTGGGCTGCGCAGG - Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1057218033 9:93240232-93240254 CCTGAATTCCCGCACTGCACTGG - Intronic
1058456589 9:105143439-105143461 CCTGAAGGCCAGGGCTGCTCAGG - Intergenic
1059457741 9:114410437-114410459 CCTCAACTCCCTGCCTGCTCTGG - Intronic
1060356613 9:122914250-122914272 CCTGAAGTCCCAGCTTACTCGGG - Intergenic
1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG + Intronic
1203773020 EBV:58984-59006 CCTGACCTCCCGCCCTGAGCTGG - Intergenic
1189310582 X:40014730-40014752 CCTCAATTCCCGGCGTGGGCCGG + Intergenic
1191167377 X:57404883-57404905 CCTGAACTCCCGGCATTAGCCGG - Intronic