ID: 1160580456

View in Genome Browser
Species Human (GRCh38)
Location 18:79881679-79881701
Sequence CTGAATCTGGAGATGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160580456 Original CRISPR CTGAATCTGGAGATGGACTA TGG (reversed) Intronic
900513697 1:3071646-3071668 CTGACTCGGGTAATGGACTATGG - Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
902710418 1:18235702-18235724 CTGAATCTGGAGTTATTCTAAGG + Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
904030706 1:27531984-27532006 CAGACTCGGGAGATGGACCAGGG - Intergenic
904957005 1:34293029-34293051 TTGAGTGTGGATATGGACTAAGG + Intergenic
905757678 1:40524925-40524947 CTGAATCTGTAGATTGCCTTAGG - Intergenic
906407367 1:45552765-45552787 TTGGATCTGGTGATGGACTGCGG + Intronic
910140644 1:84023857-84023879 CTGAACCTGGAGTTGGATGAAGG + Intergenic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915146716 1:153799942-153799964 CTGGATCTGGAGAGGGTCCAGGG + Intergenic
915610243 1:156986168-156986190 CTTAACCTGGAGAAGGAGTAAGG + Exonic
918680758 1:187350134-187350156 CTGAACCTGTAAATGGCCTAGGG + Intergenic
919294686 1:195681321-195681343 CTGGATTTGGATATGGACCAAGG - Intergenic
919843139 1:201623549-201623571 CTGACTCTGCTGATGGACTGAGG - Intronic
919925370 1:202189214-202189236 CTGCTTCTGGAGATGGACATAGG - Intergenic
920380068 1:205530080-205530102 CTGAGTCTTGAGATGGCCTGAGG + Intronic
920525656 1:206664055-206664077 CTGAAACAGGAGCCGGACTAGGG - Intronic
920601769 1:207332907-207332929 CTGATTCTGAACCTGGACTAAGG + Intronic
924919764 1:248616108-248616130 CTGAATCTGGAAATTGCCTTGGG - Intergenic
1064375527 10:14792272-14792294 CTGAATCTGTAGATAGATTTGGG + Intergenic
1064495600 10:15906633-15906655 GTGAATCTGGAGAAGCACAAAGG + Intergenic
1068297389 10:55090629-55090651 CTGAATGTGGTGATAGAATAAGG - Intronic
1070011256 10:72476675-72476697 CTGTATCTGGAGAAGCACCATGG + Intronic
1071225465 10:83523675-83523697 CTGCTTCTGGAGAGGGACTCAGG + Intergenic
1073404684 10:103286873-103286895 GTGAATCTGGATCTGGACTCAGG + Intronic
1074145530 10:110714083-110714105 CTGATTCTGAAGATGGGCTATGG + Intronic
1074772774 10:116744129-116744151 CTGTAGCTGGAGCTGGAGTAGGG - Intergenic
1074937480 10:118197025-118197047 TTGAATTTGTAGATGAACTAAGG + Intergenic
1076925705 10:133484054-133484076 CTGAATCTGTAGATTGCCTTGGG + Intergenic
1077795947 11:5492169-5492191 CTGGTTCTGGAGATGTGCTATGG - Intronic
1080462916 11:32471364-32471386 CAAAATCTGGAGCTGGCCTACGG + Intergenic
1081397629 11:42605646-42605668 GTGAATCTGGATATGGGGTATGG - Intergenic
1081513421 11:43800232-43800254 TTCAAACTAGAGATGGACTAGGG + Intronic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1086327891 11:85723229-85723251 ATGAATGTGGAGATCGACTCAGG + Intronic
1087380075 11:97394257-97394279 CTGAATCTCTAGATGGCCTCAGG + Intergenic
1087949444 11:104202665-104202687 CTAAACCTGAAGATGGACTGAGG - Intergenic
1089295991 11:117468629-117468651 CTGAATCTGGAGAGGAACCCTGG + Intronic
1094336321 12:29359200-29359222 CTGAATCTGAAGATGGGATCTGG - Intronic
1095701333 12:45193983-45194005 GAGAATTTGGAGATGGACCAGGG + Intergenic
1098453954 12:70651334-70651356 TTGAATCTGGAGATGGGAGATGG - Intronic
1099561600 12:84183528-84183550 CTGAATCTGGAAACTGAATATGG - Intergenic
1100071421 12:90724188-90724210 CTGTATCTGGAGATGAATGAAGG - Intergenic
1101875767 12:108596181-108596203 CTGAACCTGGAGTTCGGCTAGGG - Intronic
1102088863 12:110169414-110169436 CTGAATCTAGAGATGGTCTTGGG + Intronic
1103140841 12:118546807-118546829 CTGAATCTGGTGTTAGACTCCGG - Intergenic
1104001758 12:124864400-124864422 GTGAGGCTGGAGATGGACTGCGG - Intronic
1104366967 12:128186874-128186896 CTGAAACTGGAGACTGACCAGGG + Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107432441 13:40352130-40352152 CTGAGACTGGAGATGGCCAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1110301893 13:73938368-73938390 CTGAACCTGGAAATGTGCTATGG - Intronic
1113049549 13:106194908-106194930 CTGAATCTGTAGATTGCCTTGGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1114509421 14:23245244-23245266 CTCACTCTAGAGATGGAGTAAGG + Intronic
1114717487 14:24843053-24843075 CAGATTCTGGAGATAGACTTGGG + Intronic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1116487457 14:45467650-45467672 CCAAATCTGGGGATGGACTTGGG + Intergenic
1116856518 14:49957251-49957273 ATGAGTCTGGAGAGGAACTAGGG - Intergenic
1118355282 14:65008599-65008621 CTGAATCTGTAGGTGGAATAGGG + Intronic
1118640592 14:67788679-67788701 CTGAACCTGGGGGTGGACTTGGG + Intronic
1119587907 14:75855247-75855269 TTGAATCTGTAGATTGATTAGGG + Intronic
1121473967 14:94176973-94176995 CTGAAACTGGCGCTGAACTAAGG - Intronic
1122207642 14:100156046-100156068 CAGGAGCTGGAGATGGACTTTGG + Intronic
1122456759 14:101859518-101859540 CTGGATCTGGAGGTAGAATAGGG + Intronic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124339998 15:28884850-28884872 CCGAATCCTGAGATGGACTAGGG - Intronic
1125545755 15:40503410-40503432 CTGAATCTGGTGATTGGCTAAGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1132220361 15:100100695-100100717 CTTAATCAGGACATGAACTATGG + Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1137894791 16:52199620-52199642 CTTAATAGGGAGATGGGCTATGG - Intergenic
1137898153 16:52236537-52236559 CTGTATCTGGACATGGAATATGG + Intergenic
1138146802 16:54620015-54620037 CTGAATCTGCAGTTTGACTATGG + Intergenic
1138671075 16:58615070-58615092 CTGAACCTGCAGGTGGACTTGGG + Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141634218 16:85305130-85305152 GGGAATCTGGAGATGGCCCAGGG - Intergenic
1142488716 17:263672-263694 CTGAATCTGGATGTGGCTTAAGG + Intronic
1143267941 17:5654410-5654432 GAGAGTCTGGAGATGGACAAAGG - Intergenic
1144268092 17:13590986-13591008 CTGAATCTGGAATTGGAGCAAGG - Intronic
1144634550 17:16896841-16896863 CTGACTGTGGACATGGATTAGGG - Intergenic
1145045213 17:19608879-19608901 CTGAATCTGTAGATCAACTTAGG - Intergenic
1145168630 17:20636272-20636294 CTGACTGTGGACATGGATTAGGG - Intergenic
1147868801 17:43572542-43572564 CTGAATGTGGTAATGGACTGGGG + Intronic
1149005098 17:51797114-51797136 CTGATGCTGGAGATGCACTCTGG - Intronic
1149300001 17:55296369-55296391 TTAAATCTGGAAATGGAATATGG - Intronic
1151344693 17:73494430-73494452 AGGAAGCTGGAGATGGACGATGG - Intronic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1154137133 18:11789714-11789736 CAGAATCTGGAGATGCTCTTAGG + Intronic
1154151668 18:11910945-11910967 CTGACTCCGGAGATGGAGGAAGG + Intergenic
1154211880 18:12386240-12386262 CTGAATCTGTAGATGGCTTTGGG - Intergenic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1162308866 19:9892919-9892941 TTGAATCCTGAGATGGACCAGGG - Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
926358553 2:12063868-12063890 CTGACTCTGAAGATAGACAAAGG + Intergenic
926926345 2:17992122-17992144 CTGAATCTAGAGATTGATTTTGG + Intronic
927740426 2:25564283-25564305 CTGAATCTGTAGATGAATTGGGG + Intronic
927930452 2:27040334-27040356 CTGGATCTGTAGCTGGACCATGG - Exonic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
930614524 2:53579486-53579508 CTGAAGCTGGGGATGGGGTAGGG - Intronic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
932992440 2:76804169-76804191 CTAAACCTGGAGATGGTCTTGGG + Intronic
933053945 2:77637872-77637894 CTGAATCTGTAGATTTATTAAGG + Intergenic
935261770 2:101362003-101362025 CGGGACCTGGGGATGGACTAGGG - Intronic
935519630 2:104088458-104088480 CTGAATCTGTAGATTAACTTGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
940801866 2:158141949-158141971 CTGAATCTGGAAATGTAGTTTGG + Intergenic
941067686 2:160921581-160921603 CTGAATCTGAAGATGGGATGGGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942246245 2:174012010-174012032 CCAACTCTGGAGATGGACTTTGG - Intergenic
944086591 2:195854619-195854641 CTGAATCAGGTCTTGGACTATGG + Intronic
944160006 2:196649200-196649222 CTGAATCTGTAGATGGCTTTGGG + Intronic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
947028969 2:225770915-225770937 CTGACCCTGAAGATGGACTCTGG - Intergenic
1169113674 20:3048842-3048864 CTGCATCTGAACAGGGACTATGG - Intergenic
1169338047 20:4773639-4773661 CTGATTCAGCAGATGGAGTAGGG - Intergenic
1170918900 20:20656916-20656938 CACAATCTGGAGATGGCCTGGGG + Intronic
1173075335 20:39813175-39813197 ATGAATCTGCAGTTTGACTAGGG - Intergenic
1173555062 20:43960235-43960257 CTGGATCTGAGGAGGGACTAGGG - Intronic
1173631740 20:44521615-44521637 CTGGAGCTGGAGAGGGACCAAGG - Intronic
1173850456 20:46214581-46214603 CTGAAGCTAGAGATGGAGTGGGG - Intronic
1173925639 20:46779353-46779375 CAGAATCTGGAGCCAGACTATGG - Intergenic
1178150776 21:29791119-29791141 CTGAAGCTGGATCTGGAGTATGG + Intronic
1178184875 21:30207939-30207961 CTGAGTATGGAGATGGATTGGGG + Intergenic
1183323087 22:37176971-37176993 CTGAACCAGGAGCTGGTCTAAGG + Intergenic
951796082 3:26539986-26540008 CTGATTTTGGAGATGGACTACGG + Intergenic
952902153 3:38117528-38117550 CTAAGTGTGGAGCTGGACTACGG + Exonic
953674544 3:44990549-44990571 CTGAATGTGGAGGTGGTCTTGGG - Intronic
955230681 3:57096584-57096606 CTGGATCTGGGTTTGGACTATGG + Intronic
955498829 3:59563993-59564015 CTGATTCTGGAGATGGAGTTTGG + Intergenic
956096502 3:65721876-65721898 CTAATTCTGGAGGTCGACTAAGG + Intronic
956742738 3:72287832-72287854 AGGAATCTGGAGATGGTTTAAGG + Intergenic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
958545165 3:95538675-95538697 CTGAAACCAGAGATGCACTAGGG + Intergenic
959124550 3:102274664-102274686 CTGAATCTGTAGATTGATTTGGG + Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
962161076 3:133001084-133001106 TTGAATCTGTAAATGCACTATGG + Intergenic
962367151 3:134794237-134794259 CTGTTTCTGGAGATGGTCAAGGG - Intronic
963563924 3:146903598-146903620 GTGAATCTGGAGGAGGATTATGG + Intergenic
964036625 3:152206829-152206851 GTGAATCTGGACATGGATAAGGG + Intergenic
970104466 4:12565395-12565417 GTGAATCTGGAGAGGGGCTCAGG + Intergenic
970471545 4:16384414-16384436 CTGATTCTGCAGAGGGACTCCGG - Intergenic
970750038 4:19347995-19348017 CTAAATCTGGACATGGCCTATGG + Intergenic
970983604 4:22129674-22129696 CTGAGACTGGAGATAGAATAAGG - Intergenic
972621930 4:40755683-40755705 TTGAATCTGGAGGTGGTCTTAGG - Intronic
972729967 4:41784700-41784722 CTGATACTGGGGATGGACGAAGG + Intergenic
973666988 4:53170600-53170622 CTGAATCTGTAGATTGCCTTGGG + Intronic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
976725083 4:88208180-88208202 CTGAACATGGAGGTGGTCTAGGG - Intronic
976821879 4:89215985-89216007 TTGAATCTGGAGAAGGCCTGCGG + Intergenic
977741337 4:100487162-100487184 CTGAATCTAGAAAGGAACTATGG + Intronic
978810101 4:112840202-112840224 CAGAATCTTGGGATGGACTTAGG + Intronic
979041885 4:115808694-115808716 TTGAATCTGTAGATGGCCTTGGG - Intergenic
979305337 4:119135908-119135930 AAGACTCTGGAGATGGACTATGG - Exonic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
981059560 4:140407758-140407780 CTGAATCTGTAGATGGCTTTGGG - Intronic
981214060 4:142142504-142142526 CTGAACCTGGAGCTGGGGTAGGG + Intronic
981656642 4:147119354-147119376 CCAAATCTGGAGATACACTAAGG + Intergenic
985554285 5:548779-548801 CAGAATGTGAAGATGGATTAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987130456 5:14855196-14855218 CTGATTCTGGGGATGGGCTAAGG + Intronic
987557345 5:19471208-19471230 CTGAATCTGAAGAGGCACTGAGG - Intergenic
988406505 5:30830412-30830434 CTGAAACTAGAAATGTACTATGG - Intergenic
988933470 5:36059996-36060018 CTGAATGTGAAGATGGAATGAGG + Intronic
988958979 5:36350157-36350179 CCAAATCTGGAGATTGATTAAGG - Intergenic
992315834 5:75554017-75554039 CTTAACCAGGAGATGGAATATGG - Intronic
993151633 5:84170392-84170414 CTGAAACTGCACATGGTCTAAGG - Intronic
995372187 5:111430876-111430898 CTGAATCTGTAGATTGCCTTGGG - Intronic
996676899 5:126186644-126186666 CTGCATCTGGTGATGGCCTCCGG + Intergenic
999346654 5:150828375-150828397 CTGAATCTGTAGATTGCCTTGGG - Intergenic
999679877 5:154046934-154046956 GTGAAACTGGAGATAGACTCCGG - Intronic
1002570063 5:180135110-180135132 CACAATCTCGAGATGGATTAGGG + Intronic
1002611648 5:180422907-180422929 CTGAATCTGTAGATTAACTTTGG + Intergenic
1003869223 6:10388815-10388837 CTGAATCTGAAAGTGGACCAAGG + Intergenic
1003881991 6:10487684-10487706 CTGAGTCTGGTGTGGGACTATGG - Intergenic
1003999948 6:11588412-11588434 ATGAATCTGGACGTAGACTAAGG - Intergenic
1004490382 6:16109662-16109684 CTGAACCTGGAGGTGGTCTTGGG + Intergenic
1008274013 6:49522335-49522357 TTGCATCTGGAGTTGGACTTGGG - Intronic
1008305289 6:49892218-49892240 CTGCACCTGGAAATGGACTCAGG + Intergenic
1008820054 6:55621190-55621212 CTGAATCTGTAGATGGCCTTGGG + Intergenic
1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG + Intergenic
1012070745 6:94612301-94612323 CTGAATCTGTAGATGGCTTTGGG - Intergenic
1012475863 6:99614112-99614134 CTGAAGTAGGAGATGGACTCCGG - Exonic
1013876940 6:114843265-114843287 CTGAATCTGTAGATTGCTTAGGG - Intergenic
1014666846 6:124248797-124248819 CTAAATCTGGTGGTAGACTAAGG + Intronic
1015274173 6:131367313-131367335 CTGAACCTGGAGTAGGGCTAAGG - Intergenic
1016106904 6:140174250-140174272 CTCAGTGTGAAGATGGACTAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1021772128 7:24015129-24015151 CTGAATCTGTAGATGGCTTTGGG - Intergenic
1022517227 7:30983835-30983857 CTGACGCTGGAGATGGACGCAGG + Intronic
1022623484 7:32009286-32009308 CTGAGTCAGGAGATGGAGTTGGG + Intronic
1022787371 7:33652022-33652044 CTGGATCTGTGGATGGACTCTGG + Intergenic
1024178598 7:46864949-46864971 CTGCATCTGGTGATGGTCTCAGG + Intergenic
1024533507 7:50411470-50411492 CTGAATCTAGAGAAGGGCTGTGG + Intergenic
1027831915 7:83187653-83187675 ATGAAGCTGGAGAAGGAATAAGG + Intergenic
1029539735 7:101175562-101175584 CTGGATCTGGGGCTGGTCTATGG - Intronic
1032668726 7:134064331-134064353 CTGAACCTGGTGGTGGACCAGGG + Exonic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1032939605 7:136773864-136773886 CTGAATCTGAAGATTGCCTTGGG - Intergenic
1033385577 7:140871634-140871656 TTGAATGAGGAGATGAACTAAGG + Intronic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1035608104 8:942475-942497 CTGGACCTGGAGATGGATTTTGG - Intergenic
1035787486 8:2273131-2273153 ATAAAACTGGAGACGGACTAGGG - Intergenic
1035805321 8:2448585-2448607 ATAAAACTGGAGACGGACTAGGG + Intergenic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1039309000 8:36295707-36295729 CTGATTCTGGTGAGGGACTCAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040491613 8:47928501-47928523 CTAAATCTGGAGCGGGACTAAGG - Intronic
1042012361 8:64261491-64261513 CTAAATCTGGAGATGTAAAAAGG + Intergenic
1043798034 8:84570153-84570175 CTGAATCTGTAGGTGGCCTTGGG + Intronic
1043991554 8:86762080-86762102 CTGAACCTGGAGGTGGTCTTGGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044251196 8:90005801-90005823 CTGCATCTGGTGACGGCCTAAGG + Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044696598 8:94929174-94929196 CTGAATCTGGTGATGGGGTGGGG - Exonic
1047035706 8:120936622-120936644 CTGAAGCTGGAGATGGGTAATGG + Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1055834452 9:80421725-80421747 CAGTAGCTGGAGATGCACTAGGG - Intergenic
1055867210 9:80829475-80829497 CTGAATCTGTAGATCAACTAGGG + Intergenic
1056115341 9:83435788-83435810 CAGAATCTGGGGATGGGTTAGGG - Intronic
1057041411 9:91850518-91850540 CTGGCTCTGAAGATGGACAAGGG + Intronic
1057075995 9:92138395-92138417 CTGCTTCTGGAGATGGACATAGG - Intergenic
1057353227 9:94317227-94317249 CTGCATCAGGAGAGGGACTGAGG - Intergenic
1057654523 9:96940364-96940386 CTGCATCAGGAGAGGGACTGAGG + Intronic
1057973388 9:99578628-99578650 CAGTATCTGGAGATGTACTTGGG - Intergenic
1060246748 9:121952810-121952832 CTGAATCCGGAGCTTGACTCAGG - Intronic
1060252358 9:121996375-121996397 CTCAATATGGAGAAGGACTTTGG - Intronic
1186919850 X:14266591-14266613 ATGAATCTGTGGATTGACTAGGG + Intergenic
1189201285 X:39197710-39197732 CTGAAACTGGAGGTGGGCCAAGG + Intergenic
1189455447 X:41184062-41184084 GTGAGTCAAGAGATGGACTAAGG - Exonic
1192552629 X:72066341-72066363 CTGAATGTGGAGATAGACGGGGG + Intergenic
1193192500 X:78588165-78588187 CTGAATCTGTAGATTGCCTTGGG + Intergenic
1193417312 X:81240615-81240637 CTGAATCTGGAGATTGCTTTGGG - Intronic
1194236677 X:91392856-91392878 CTGAATCTGATGATGGAAGAAGG + Intergenic
1194379036 X:93171833-93171855 CTGAATCTGTAGATTGATTCGGG - Intergenic
1194881007 X:99252354-99252376 CTGAATCTGTAGATTGCCTTAGG + Intergenic
1195235340 X:102891355-102891377 TGGGATCTGGAGACGGACTAGGG - Intergenic
1196883252 X:120219678-120219700 CTGAAACTGGATAGGGAGTATGG - Intergenic
1199294007 X:146137102-146137124 CTGAATCTGGAGGTGGTCTCAGG - Intergenic
1199995340 X:153021171-153021193 CTGAATCTGGAAATCGAGAAGGG + Intergenic