ID: 1160580690

View in Genome Browser
Species Human (GRCh38)
Location 18:79883215-79883237
Sequence CTGGGAAAGCCAGGGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 580}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160580674_1160580690 18 Left 1160580674 18:79883174-79883196 CCAGGCCAGGAAGCCACGCTGCG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG 0: 1
1: 0
2: 8
3: 70
4: 580
1160580682_1160580690 -8 Left 1160580682 18:79883200-79883222 CCGTCTATGGGATACCTGGGAAA 0: 1
1: 0
2: 2
3: 15
4: 127
Right 1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG 0: 1
1: 0
2: 8
3: 70
4: 580
1160580676_1160580690 5 Left 1160580676 18:79883187-79883209 CCACGCTGCGATCCCGTCTATGG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG 0: 1
1: 0
2: 8
3: 70
4: 580
1160580675_1160580690 13 Left 1160580675 18:79883179-79883201 CCAGGAAGCCACGCTGCGATCCC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG 0: 1
1: 0
2: 8
3: 70
4: 580
1160580681_1160580690 -7 Left 1160580681 18:79883199-79883221 CCCGTCTATGGGATACCTGGGAA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG 0: 1
1: 0
2: 8
3: 70
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160580690 Original CRISPR CTGGGAAAGCCAGGGGTTGG GGG Intronic
900466606 1:2828688-2828710 CTGGGAAGACCAGGGACTGGAGG + Intergenic
900581328 1:3411284-3411306 CTGGGAAAGCCAGCCGCTGGAGG - Intronic
900634148 1:3653363-3653385 CCGGGAAAGGCAGGGGCTGCAGG - Intronic
900829132 1:4951587-4951609 CTGGGAAGGCCTGGTGCTGGGGG + Intergenic
901052529 1:6432455-6432477 CTGGGAAAGGAAGGGCCTGGTGG + Intronic
901206865 1:7502571-7502593 TTGGGAAAGCCGGGGGCTGAAGG - Intronic
901257523 1:7843309-7843331 CTGGGATAACCAGGTTTTGGGGG + Exonic
901506932 1:9690693-9690715 CTGGAAAAGGCATGGGTTGCAGG - Intronic
902105494 1:14032493-14032515 TTGGGACAGACAGAGGTTGGTGG - Intergenic
902257502 1:15199480-15199502 GTGGGCTAGCCACGGGTTGGGGG + Intronic
902377223 1:16035459-16035481 CTGGAAAAGCAAGGGGGTGATGG + Intergenic
902382403 1:16058718-16058740 CTGGAAAAGCAAGGGGGTGATGG + Intronic
902481714 1:16715581-16715603 CTGGGAAAGGAAGGGCCTGGTGG - Intergenic
902542058 1:17162716-17162738 CTGGGAAGGCCACTGGTTTGAGG + Intergenic
902609125 1:17586966-17586988 CTGGGAATGCCTGGACTTGGAGG - Intronic
902676172 1:18009860-18009882 GTGGGAAAGCCTGAGGTTGGGGG + Intergenic
902682003 1:18050253-18050275 CTGGGAATGGGAGGGGATGGTGG - Intergenic
902898320 1:19495146-19495168 CTGGGAAAGGGAGGAGGTGGCGG - Intergenic
903341014 1:22654315-22654337 CTGGGGAAGCCAGGGGCAGGGGG - Intronic
903615992 1:24657162-24657184 CTTGTAATCCCAGGGGTTGGAGG - Intronic
903864680 1:26389573-26389595 CAGGGAACGCCAGGGGTAGAGGG - Intergenic
904160924 1:28521533-28521555 CAGGGAAGGGCAGGGGATGGAGG - Intronic
904180706 1:28664714-28664736 CTGTGAAATCCATGTGTTGGAGG + Intergenic
904199470 1:28810633-28810655 GTGGGAAAGCCCTGGGGTGGGGG + Intergenic
905460852 1:38121886-38121908 TTGGAGAAGACAGGGGTTGGGGG + Intergenic
906250875 1:44309941-44309963 ATGGAATAGCCAAGGGTTGGAGG - Intronic
906668040 1:47635477-47635499 CTGGAAAAGCCAGGGTTCAGGGG - Intergenic
907136161 1:52141850-52141872 CGGGGAACGCCAGGGGTTGGTGG + Intergenic
907424257 1:54369244-54369266 CTGGGAAAGGCGAGGGTTTGAGG + Intronic
908437408 1:64120220-64120242 CATGGAAAGCCTGGAGTTGGGGG + Intronic
908784385 1:67720770-67720792 CTGGGAAAGCCAGGAGTACCAGG - Intronic
909662067 1:78095129-78095151 TTTGGTAAGTCAGGGGTTGGTGG + Exonic
910484758 1:87700937-87700959 TTGAGCAACCCAGGGGTTGGGGG + Intergenic
911014850 1:93321242-93321264 GTGGGAAAGGCAGGGCGTGGTGG + Intergenic
911159763 1:94672492-94672514 TAAGGAAAGCCAGGGGTTGGGGG - Intergenic
912274348 1:108240772-108240794 ATGGGAAACCCATGGGGTGGAGG - Intronic
912286919 1:108379090-108379112 ATGGGAAACCCATGGGGTGGAGG + Intronic
912293871 1:108453551-108453573 ATGGGAAACCCATGGGGTGGAGG + Intronic
912332870 1:108835173-108835195 CTGGGGGAGACAGGGGTGGGGGG - Intronic
912716553 1:111987837-111987859 GTGGGAAAGATAGGGGGTGGGGG + Intronic
913531780 1:119738763-119738785 CTGGCAGAGCGAGGGGGTGGGGG + Intronic
913602992 1:120439847-120439869 ATGGGAAACCCATGGTTTGGAGG + Intergenic
913603740 1:120446199-120446221 ATGGGAAACCCATGGTTTGGAGG + Intergenic
913632653 1:120724429-120724451 CGGGGAACCCCAGCGGTTGGCGG - Intergenic
914704363 1:150159173-150159195 TTGGGGAGGGCAGGGGTTGGGGG - Exonic
915075675 1:153306657-153306679 GCGGGAAAGCCATGGTTTGGGGG - Intronic
915124525 1:153654372-153654394 CTGGAAAAGCCAAGGCCTGGAGG + Intergenic
915490838 1:156249294-156249316 CTGGGAAATCCTGGGGTGAGTGG - Exonic
915722463 1:157994551-157994573 CTGGGCAGGGCTGGGGTTGGGGG + Intronic
915758514 1:158286999-158287021 CTGTGAGAGCCAGGGCCTGGAGG - Intergenic
915959145 1:160249964-160249986 CAGGGATTGCCAGGGCTTGGAGG + Intronic
915976155 1:160390834-160390856 CTGGGAGTGCAAGGGGTTTGGGG - Intergenic
916510686 1:165470028-165470050 CTGGGAAGGCAAGGGCTGGGTGG + Intergenic
916583043 1:166125378-166125400 CTGGGAAAGCTAGTGGTAAGAGG + Intronic
918236807 1:182589071-182589093 CTGGAGAGGCCAGGGGCTGGAGG - Intronic
918565077 1:185919528-185919550 CTGGGGAGGCAAGGGGGTGGTGG - Intronic
919342828 1:196335626-196335648 CTTGGAAGGCCAGAGGTTTGAGG - Intronic
919512140 1:198478405-198478427 CTGGGAAGGGTAGTGGTTGGGGG + Intergenic
919730152 1:200908688-200908710 CTGGTAAGGCCAGAGGCTGGGGG - Intronic
922844090 1:228669194-228669216 CAGGAACAGCCAGGGGTTGGGGG - Intergenic
922963906 1:229671522-229671544 TTGAGAAAGTCAGGGGGTGGAGG + Intergenic
924673304 1:246150706-246150728 CGTGGAAGTCCAGGGGTTGGGGG + Intronic
1063490553 10:6459756-6459778 CTGGTAAATCGAGGGCTTGGTGG + Intronic
1064450264 10:15435691-15435713 CTGGGAGAGGCTGGGGCTGGGGG + Intergenic
1064860237 10:19817604-19817626 TTGTGAAAGCCAGGGATTGCAGG + Intronic
1066136740 10:32454816-32454838 GTGGGAAAGACAGGAGGTGGTGG - Intronic
1066227981 10:33403208-33403230 CTAGGAAAGCAAGTGGATGGTGG - Intergenic
1067103761 10:43351419-43351441 CGGGGAAAGCCGGGTGTGGGAGG - Intergenic
1067751955 10:48977574-48977596 CTGGGATGGCCTGGGCTTGGTGG + Intronic
1068649675 10:59508277-59508299 CTGTGAAAGCATGAGGTTGGTGG + Intergenic
1069680911 10:70284293-70284315 CTGGGAGAGCCGGGAGCTGGTGG - Intergenic
1069707373 10:70467306-70467328 CTGGAGAAGCCTGGGGGTGGGGG + Intergenic
1069962999 10:72089290-72089312 CTGGGGAAGCCGGGGAGTGGGGG + Intergenic
1071680272 10:87697745-87697767 CTGAAAAAGCCAGGGCTGGGTGG + Intronic
1072618619 10:97065845-97065867 CTGGAATAGTCTGGGGTTGGAGG - Intronic
1072690724 10:97570906-97570928 AGGGGAGAGCCAGGGGATGGGGG - Exonic
1072865870 10:99060941-99060963 CTGGGAATGGCAGTTGTTGGGGG + Intronic
1073284164 10:102377204-102377226 CAGGGAAAGCCAGGGCTGAGGGG + Intronic
1073353842 10:102838017-102838039 CTAGGAATGCCAGAGGTGGGAGG + Intergenic
1073669672 10:105573808-105573830 GTGGGAAAGCCAGAGCATGGAGG + Intergenic
1075590574 10:123688251-123688273 CTGGGCATGCCAGGGACTGGTGG - Exonic
1075707658 10:124511385-124511407 CTGGGAAGCACAGGGGTGGGTGG + Intronic
1076209227 10:128627168-128627190 CGGGGAGAGCCAGGGGTGGGCGG + Intergenic
1076364814 10:129914896-129914918 CTGGGAAAGCCAGTGGCCAGAGG + Intronic
1077044440 11:538169-538191 CTGGGGGTGCAAGGGGTTGGAGG - Intronic
1077155819 11:1090358-1090380 CTGGGAGTGGCAGGGGTGGGAGG + Intergenic
1077330286 11:1981198-1981220 CAGTGAAGGCCACGGGTTGGGGG - Intronic
1077643608 11:3903909-3903931 CTGGGAAAGGCTGGGCTTGGTGG + Intronic
1078065978 11:8080045-8080067 CTGGGAGAGCCCTGGGGTGGGGG + Intronic
1078487940 11:11741165-11741187 CTGTGATTGCCAGGGGCTGGGGG + Intergenic
1078797926 11:14611900-14611922 CTGGGAAAGGAAGGGGATAGAGG - Intronic
1078878467 11:15423003-15423025 CTGGGAAAGGAATGGGTCGGGGG + Intergenic
1079122019 11:17692737-17692759 CGGGAAAAGCCAGGGGTAGGGGG + Intergenic
1079129965 11:17741559-17741581 CTGGAGCAGCCAGGGGCTGGAGG - Intronic
1080838069 11:35958961-35958983 CTGGGAGGGGCAGGGGATGGAGG - Intronic
1080944741 11:36958507-36958529 CTGGGACAGCCTGGTGTTGGAGG - Intergenic
1081599926 11:44485876-44485898 TTAGGAAGGCCAGGGGTGGGAGG - Intergenic
1081612990 11:44574393-44574415 ATGGGGAAGCCAAGGGTGGGTGG - Intronic
1081632537 11:44699628-44699650 CTGTGAGAGGCAGGGGGTGGTGG + Intergenic
1081725191 11:45322979-45323001 CTGGGGAAGGTAGGGGCTGGAGG - Intergenic
1081991668 11:47341281-47341303 CTGGCAAGGCCAGGGGTGTGTGG - Intronic
1083436797 11:62648414-62648436 TTCGGAAAGCCAGGGGCAGGAGG + Exonic
1083493441 11:63030102-63030124 CCGGGAGAGCCTGGGGGTGGAGG + Intergenic
1083594605 11:63912948-63912970 CTGGGAAGGCCAGGAAGTGGAGG + Intronic
1083777539 11:64901688-64901710 CTGGGAAATTCAAGGGATGGAGG - Intronic
1083987699 11:66227320-66227342 CTGTGAAAACCAGGTTTTGGAGG - Intronic
1084484363 11:69439246-69439268 CTGGGAGGGCCAGGTGTGGGAGG - Intergenic
1084695757 11:70754641-70754663 CTGGCAAAGGCAGCGGTAGGAGG + Intronic
1084792485 11:71483372-71483394 CTGGGAATGCCAGGAGTGAGGGG - Intronic
1084905374 11:72342020-72342042 CTAAGAAAGACAGGGCTTGGTGG + Intronic
1085403209 11:76246699-76246721 ATGGGAAAGCCAGTGGGGGGTGG + Intergenic
1085455404 11:76662633-76662655 CTGGGAAAGGCTGGGGTTCCTGG - Intronic
1085740493 11:79074473-79074495 ATGGGGAACCCAGAGGTTGGTGG - Intronic
1086252468 11:84833208-84833230 TTGGGAAAGTGAAGGGTTGGGGG - Intronic
1086450058 11:86906606-86906628 CTGGGAAATGCAGGGTATGGAGG - Intronic
1086898741 11:92342303-92342325 AGGGGAAAGCCAGTGGATGGTGG - Intergenic
1087840357 11:102914513-102914535 AGGGAAAAGCCAGGAGTTGGTGG - Intergenic
1088833922 11:113561173-113561195 CTGGCAAAGCTATGGGTGGGAGG + Intergenic
1089063167 11:115642738-115642760 CTGGGGAAGCGAGGGCTGGGAGG + Intergenic
1089178814 11:116566864-116566886 TGGGGAAAGACAGGGGTTGTGGG - Intergenic
1089256889 11:117198948-117198970 CCGGGAATCCCAGGGGTTTGTGG - Intergenic
1089461965 11:118658862-118658884 CTGGGACAGCCTGGGGGTGCAGG + Intronic
1089504703 11:118955776-118955798 CTGGGAGAGGCAGGGGCTGTGGG - Intronic
1089512831 11:119011322-119011344 CTGGGAATGCCAGGGATCAGTGG - Intronic
1089556435 11:119318029-119318051 CTGGGGAAGACATGGGGTGGGGG - Intronic
1089581285 11:119483308-119483330 CTGTGAAGGCGAAGGGTTGGAGG - Intergenic
1089618651 11:119709642-119709664 CTGGGAAAGACTGGGGCTGGGGG + Intronic
1090430778 11:126644554-126644576 CTGGTGAAGACATGGGTTGGGGG + Intronic
1090665287 11:128911171-128911193 CTGGGAGAGCCCCGGGGTGGGGG + Intronic
1202813265 11_KI270721v1_random:36377-36399 CAGTGAAGGCCACGGGTTGGGGG - Intergenic
1091566812 12:1654901-1654923 CTGGGAAAGCCAGTGGAGAGAGG - Intergenic
1091575204 12:1727586-1727608 CTGGGAGAGGCAGGGGCTGTGGG - Intronic
1091637068 12:2205232-2205254 CTGGGAAAGCCAGTGTGTGGAGG + Intronic
1091698462 12:2643783-2643805 CTGGGAATGGCAGGGGTCAGGGG - Intronic
1092361708 12:7842054-7842076 CAGTGATTGCCAGGGGTTGGAGG - Intronic
1092376286 12:7958175-7958197 CAGTGATTGCCAGGGGTTGGAGG - Intergenic
1094578589 12:31711853-31711875 CTGGGAAGGGCAGGGGATGGCGG - Intronic
1095942761 12:47737506-47737528 CCGGGAAAGCCAGGGTGTGCCGG - Exonic
1096596836 12:52701248-52701270 CAGGCAAAGGCAGGGGTTAGAGG - Intronic
1096917249 12:55046593-55046615 CTTGGAGAGCTAGGGGTTGGTGG + Intergenic
1096981434 12:55729809-55729831 CTGTGATAGCGAGGGCTTGGGGG + Intergenic
1097395182 12:59064639-59064661 CTATGAAAGGCAGGGGTTGTTGG - Intergenic
1097505173 12:60458424-60458446 CGGGGAAACACAGGGCTTGGAGG - Intergenic
1098522745 12:71451906-71451928 CTGGGAAAGGGAGTGGTTGTGGG - Intronic
1098596077 12:72273655-72273677 CCCGGGAAGCCAGGGGTGGGGGG + Intronic
1098898947 12:76093028-76093050 CAGTGATTGCCAGGGGTTGGAGG + Intergenic
1101232724 12:102757593-102757615 CTGGGAAAGACAAGGGTGTGTGG + Intergenic
1102042198 12:109808247-109808269 GTGGGACAGCCAGGGGTGTGGGG - Intronic
1102236318 12:111296677-111296699 CTGGGATGGCCAGAGGGTGGAGG - Intronic
1102236326 12:111296705-111296727 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236343 12:111296761-111296783 CTGGGATGGCCAGAGGGTGGAGG - Intronic
1102236351 12:111296789-111296811 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236368 12:111296845-111296867 CTGGGATGGCCAGAGGGTGGAGG - Intronic
1102236376 12:111296873-111296895 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102236392 12:111296929-111296951 CTGGGACGGCCAGAGGGTGGAGG - Intronic
1102236443 12:111297121-111297143 CTGGGAGGGCCAGAGGGTGGAGG - Intronic
1102589991 12:113949787-113949809 CTGGGGAGGGCAGGGATTGGAGG - Intronic
1102658475 12:114503818-114503840 CTGGGAGGGACAGGGGTTAGGGG + Intergenic
1103897012 12:124279631-124279653 CTGGGAAACCCAGGAGTGTGAGG - Intronic
1104058289 12:125246893-125246915 CCGGGAGAGCCTGGGGTTTGTGG + Intronic
1104368685 12:128202697-128202719 CAGGGAAAGCCAGGGCTGGAGGG - Intergenic
1104659686 12:130601775-130601797 CTGGGAAAGACACTGCTTGGAGG + Intronic
1104887008 12:132116816-132116838 CGGGCAAAGGCAGGGGGTGGCGG - Intronic
1105355033 13:19652311-19652333 CTGGGAAATGCAGGGGGTCGGGG + Intronic
1106138259 13:26990612-26990634 CTGGCAGAGGCAGGGGCTGGAGG - Intergenic
1107448449 13:40488216-40488238 GTGGGAGAGCCAGGGGGTGGTGG - Intergenic
1107456528 13:40560583-40560605 CTGTGAGAGCCAGGGCTTGCAGG + Exonic
1107694401 13:42986321-42986343 CTGGGAATCCCAAGGGTTTGGGG - Intronic
1111358315 13:87140563-87140585 CTGAGAAAGTGTGGGGTTGGGGG - Intergenic
1111915593 13:94357039-94357061 CTGGGAAAGCCAGGTGGGGTGGG - Intronic
1113475495 13:110577817-110577839 CAGGGGTTGCCAGGGGTTGGGGG - Intergenic
1113576663 13:111399855-111399877 CTGGGAATGCCAGGGGTGCTTGG + Intergenic
1113873485 13:113579416-113579438 GTGGGAAAGCTAGGGGCTGGAGG + Intergenic
1116046860 14:39754075-39754097 TTGGGAAAGAAAGGGGTTGGGGG - Intergenic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1119781942 14:77281781-77281803 CTGGGAAACTGAGGGGTTGAGGG - Intronic
1120803079 14:88714376-88714398 CTGGGAGAGGTAGAGGTTGGTGG + Intronic
1121109581 14:91303388-91303410 GTGGGAAAGGCAGGGACTGGGGG - Intronic
1121244351 14:92451395-92451417 CTGGGGAGGCCAGGGCTTTGGGG + Intronic
1121253678 14:92516661-92516683 CTGGGAGTGCAAGGGGCTGGGGG + Intronic
1121377927 14:93430907-93430929 GGGGGAAAGCGAGGGGGTGGGGG + Intronic
1121635636 14:95452220-95452242 CTGGGAAGGCCAAGGGTGGTGGG - Intronic
1121811375 14:96894124-96894146 CTGGGGAAGACAGAGGATGGAGG + Intronic
1121818118 14:96943815-96943837 CTGGGGCAGCCAGGGCTAGGCGG - Intergenic
1122211198 14:100175228-100175250 CTGGGAGAACCAGGTGTCGGGGG + Intergenic
1122580952 14:102771288-102771310 CCAGCAAAGCCAGTGGTTGGTGG - Intergenic
1122637674 14:103138071-103138093 CTGGGACAGCCCGGAGCTGGGGG + Intergenic
1122971347 14:105153528-105153550 CTGGGGAAACCAGGAGGTGGGGG - Intronic
1123024467 14:105418257-105418279 CTGGCCATGCCAGGAGTTGGTGG + Intronic
1124109728 15:26773821-26773843 GCGGGAAAGCCTGGGGGTGGGGG - Intronic
1124197007 15:27639847-27639869 CTGGGTGAGCCAGGGGTTTCCGG + Intergenic
1124407944 15:29408381-29408403 CTGGGAAATCCTGGGCTTGTAGG + Intronic
1124434067 15:29633304-29633326 CAGGGAGAGGGAGGGGTTGGAGG + Intergenic
1124606373 15:31172792-31172814 GTGGGAAAGCCAGGGCTCAGCGG + Intergenic
1125074671 15:35599552-35599574 CTGGGAAGGGTAGGGGTTGGAGG + Intergenic
1126032665 15:44515096-44515118 TTGGGGAAGACGGGGGTTGGGGG + Intronic
1126130502 15:45336822-45336844 CAGAGAAAGGCAGGGCTTGGTGG + Intergenic
1126979182 15:54222240-54222262 CTGGGAAGGGTAGGGGTGGGTGG - Intronic
1127836553 15:62795283-62795305 TTGGGAAAGTCAGGAGCTGGCGG + Intronic
1127982930 15:64047271-64047293 ATGGAAATTCCAGGGGTTGGAGG - Intronic
1128051845 15:64671659-64671681 TTGGGAAATCCAGGCGTTGAGGG + Intronic
1128108242 15:65059775-65059797 GTGGGAAAGCCTGGGGTTCTGGG - Intronic
1128611571 15:69078032-69078054 CTGGGAAAGCTAGTCGTTGAGGG - Intergenic
1128740703 15:70082038-70082060 CAGGGAAAGGCTGGGGTGGGAGG + Intronic
1129091352 15:73154482-73154504 CTGGGAAAGGTAGTGGGTGGGGG - Intronic
1129110857 15:73336211-73336233 CTTGACAAGCCAGGGGTGGGAGG - Intronic
1129188667 15:73925411-73925433 CTGGGAATGGCAGGGATAGGAGG - Intergenic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1129658406 15:77539785-77539807 CTGGGAAAGGAAGGGAATGGGGG + Intergenic
1129797236 15:78387171-78387193 AGGGGAAAGACAGGGGGTGGCGG - Intergenic
1129933681 15:79432146-79432168 CTGAGACCGCCAGGGGTTGAGGG + Intergenic
1130089887 15:80811880-80811902 CAGAGAAAGCCAGGTGTTTGTGG - Intronic
1130905266 15:88235635-88235657 CTGTGGAAGCCAGGGCCTGGTGG - Intronic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131059094 15:89393453-89393475 CTCAGAAAGCCTGGGGCTGGGGG - Intergenic
1133454135 16:5928324-5928346 CTTGGGAAGGCAGGGGCTGGAGG - Intergenic
1133903511 16:9999579-9999601 CTGGGCCTGTCAGGGGTTGGGGG + Intronic
1134811877 16:17174596-17174618 CGGGGGTTGCCAGGGGTTGGGGG + Intronic
1135125602 16:19806934-19806956 ATGGGAATCCCAGGGGGTGGGGG - Intronic
1135413940 16:22254822-22254844 TTTGGAAAGCCCGGGGTGGGGGG + Intronic
1135539871 16:23321510-23321532 CTGGGAAAGGCAGGGGTATTAGG + Intronic
1135988179 16:27199830-27199852 CTGGGAATGACAGGAGGTGGAGG + Intergenic
1136111310 16:28065028-28065050 CTCGGCAAGCCGGGGGTTGTCGG - Intergenic
1136395746 16:29991594-29991616 CTGGGCAGGGCAGGGGTGGGTGG + Intronic
1137056117 16:35747378-35747400 CTGGGGAGACCAGGGGCTGGAGG + Intergenic
1137709651 16:50557519-50557541 CTCAGAAAGCCAGGAGTTGAAGG - Intronic
1138336668 16:56258792-56258814 CTGGGAGAGACAGGGGATTGGGG + Intronic
1138883277 16:61042863-61042885 CTGTGAAAGCCAGCTGCTGGAGG - Intergenic
1139346693 16:66308294-66308316 CTGGAACAGCCTGGGGATGGAGG - Intergenic
1139353543 16:66353110-66353132 CTGGGAGGGCCTGGGTTTGGTGG + Intergenic
1139510345 16:67424702-67424724 CTGGGAAGGCCAGAAGCTGGAGG - Intergenic
1139775360 16:69313399-69313421 CTGGGAGAGAGAGGGGTTGTGGG - Intronic
1140147394 16:72324566-72324588 CTGGGAATGCAAGGGGTCAGGGG + Intergenic
1140267482 16:73433257-73433279 CTGGGAGAACAAGGGGGTGGAGG - Intergenic
1141157116 16:81605090-81605112 CCGGAGAAGCCAGGGCTTGGTGG - Intronic
1141456410 16:84145220-84145242 CTGGGGACGCCGGGGGGTGGGGG - Intergenic
1141699594 16:85636301-85636323 CTGGGAATGCCAAGGTTTGTGGG + Intronic
1141720836 16:85754390-85754412 CGGGGAAAGGCAGGTGCTGGAGG + Intergenic
1141803003 16:86323716-86323738 CTGGGAAAGCCAGGGAGGAGAGG + Intergenic
1141829297 16:86500709-86500731 CAGGAAAAGCACGGGGTTGGCGG - Intergenic
1141899660 16:86982912-86982934 CTGAGGAAGCCAGGAGGTGGGGG - Intergenic
1142125974 16:88410912-88410934 CTGGGACCTCCAGGGGCTGGAGG - Intergenic
1142212187 16:88813456-88813478 CTGGGAAGGCGTGGGGTGGGGGG + Intergenic
1142269100 16:89079874-89079896 CTGAGAAACCCAGAGGCTGGAGG - Intergenic
1142692770 17:1616861-1616883 CTGGGAATGCCAGGGCTGGCTGG + Intronic
1142755034 17:2011438-2011460 CTGGGAAAGCCAGGAATTGGAGG + Intronic
1142858803 17:2749062-2749084 CCAGGGAAGGCAGGGGTTGGGGG + Intergenic
1143381141 17:6497233-6497255 CTGGGGAGGCCAGGGGCTGAGGG + Intronic
1143479808 17:7221694-7221716 CTAGGAGAGCCAGGGATTGGGGG + Intronic
1143728532 17:8866599-8866621 GTGGGAAAGTCAGGTGTTGGGGG - Intronic
1144193403 17:12867365-12867387 CTAGAAATGCCAGGGGTGGGAGG + Intronic
1144745638 17:17612351-17612373 GTGGGAAGGCCAGGGGTTTAGGG - Intergenic
1144956941 17:19023450-19023472 CTGGCAAGGCCTGGGGCTGGAGG - Intronic
1145249130 17:21287916-21287938 TTCCGACAGCCAGGGGTTGGGGG - Intronic
1145785431 17:27590816-27590838 CTGCGACAGCCAGGACTTGGTGG - Exonic
1146122995 17:30211214-30211236 CTGGGATGGCCAGGGATGGGAGG + Intronic
1147015612 17:37489599-37489621 CTGGGGAAGCGAGGGGTCGCCGG + Intergenic
1147041605 17:37723477-37723499 CTGGGAAGACCATGGATTGGTGG - Intronic
1147544752 17:41392761-41392783 CTGGGAAAGCCTGGTGTGGTGGG + Intronic
1147584400 17:41645444-41645466 CTGGGAAGTCCAGGGTTAGGGGG - Intergenic
1147627034 17:41906987-41907009 CTGGGGAGGCCTGGGGTTGGGGG - Intronic
1147949450 17:44098834-44098856 CAGGGAGAGCCAAGCGTTGGTGG + Intronic
1148149813 17:45389869-45389891 CTGGGAGGGCCAGGGGTTGGAGG + Intergenic
1148155873 17:45425129-45425151 CTGGGACAGCCTGGGGCTGCAGG + Intronic
1148581916 17:48750057-48750079 GTAGGAAAGCCAGGGGTCGAAGG + Intergenic
1148896341 17:50841311-50841333 CTGGGAGAGCCAGGGGTGTGGGG - Exonic
1149038048 17:52157365-52157387 CTTTGAAAGCCAGGGGATGGGGG + Intronic
1149428360 17:56577033-56577055 CTGCGAGAGCCAGGGGTTGGGGG - Intergenic
1149428525 17:56578191-56578213 CTGGGAGAGCCAGGGGGTGGGGG - Intergenic
1149498551 17:57134488-57134510 AGGGGAAAGGCAGGGGGTGGAGG - Intergenic
1149537649 17:57444783-57444805 AGAGGAAAGCCCGGGGTTGGCGG + Intronic
1149581247 17:57751879-57751901 CTGGTAGAGCAAGGGGTCGGGGG + Intergenic
1150352540 17:64457158-64457180 CTGAGAAAGCCAGAGAGTGGAGG - Intronic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1150596810 17:66613612-66613634 CTGGGGAACACAGGGGTTGCTGG - Intronic
1151349437 17:73522939-73522961 CAGGGAAAGCCCTGGGCTGGAGG + Intronic
1151516765 17:74601513-74601535 CAGTGAGAGCCAGGGATTGGTGG + Intergenic
1151598294 17:75091097-75091119 CTGGGAGTGCCAGGGCTAGGTGG + Intronic
1152252710 17:79220069-79220091 CTGGGAAGGCACGGGGTGGGGGG + Intronic
1152378239 17:79929565-79929587 CAGGGACAGACAGGGGCTGGCGG + Intergenic
1152725008 17:81940901-81940923 CTGGGACAGCCAGCTGGTGGTGG - Exonic
1152737378 17:82004186-82004208 CTGGGAAACCGAGGGGAGGGAGG - Intronic
1154015479 18:10612674-10612696 CAGCCAAAGCCAGGGGGTGGAGG + Intergenic
1154190031 18:12222957-12222979 CAGCCAAAGCCAGGGGGTGGAGG - Intergenic
1154252081 18:12753044-12753066 GTGGGAAACACAGGGGATGGAGG + Intergenic
1155096267 18:22559377-22559399 CTGGAAGAGACAGGGGTTGGTGG + Intergenic
1155305421 18:24473476-24473498 CAAGGAATGCCAGGGGTTGCTGG - Intronic
1155935919 18:31754000-31754022 CTGGGAAGGCCAGGGTTCAGGGG + Intergenic
1156810642 18:41245926-41245948 CTGGGAAAGGAAGGAGGTGGGGG - Intergenic
1157005606 18:43580127-43580149 TTGTGAAAGCCAGGGCTTGTTGG + Intergenic
1157071673 18:44416101-44416123 CTGGGAAGGGCAAGGGTTTGGGG + Intergenic
1157767107 18:50307652-50307674 CTGGTAAACGCAGGAGTTGGGGG - Intergenic
1158556576 18:58480034-58480056 CAGTGATTGCCAGGGGTTGGGGG + Intergenic
1158933947 18:62347564-62347586 CGGGGAAAGCAAGGTGTTGTAGG - Intronic
1159937816 18:74382720-74382742 CTGGGACAGCCAGGAGGAGGGGG - Intergenic
1159959826 18:74546715-74546737 CTGCCGAAGCCAGGGGATGGAGG - Intronic
1160225581 18:77008660-77008682 CAGAGGAAGCCAGGGCTTGGGGG - Intronic
1160452487 18:78974695-78974717 CCGGGAGGCCCAGGGGTTGGGGG - Intergenic
1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG + Intronic
1161112387 19:2477505-2477527 CTGGAAGAGCCACGGCTTGGTGG + Exonic
1161324698 19:3657976-3657998 CTGGAAGAGCCAGGGGCTTGAGG + Intronic
1161592113 19:5133572-5133594 CAGGGAGAACCAGGTGTTGGGGG + Intronic
1161814236 19:6489548-6489570 CTGGGAAATGTAGGGGTTGGAGG - Intergenic
1161853991 19:6753372-6753394 CTGGGACAGGCTGGGTTTGGGGG + Intronic
1161973705 19:7597161-7597183 CTGGGAAGGCCAGGGAGAGGGGG - Intronic
1162050312 19:8028784-8028806 CAGGGCAGGCCTGGGGTTGGGGG + Intronic
1162378420 19:10318174-10318196 CTGGGACAGCTAGGATTTGGGGG - Intronic
1162379309 19:10322489-10322511 GTGGGAAAGGCAGGGGTTTGGGG + Intronic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162813890 19:13181588-13181610 CTGGGAAGGCCTGGGGAAGGGGG + Intergenic
1162831693 19:13288624-13288646 CTTGGAGAGGCAGGGGTTGATGG - Intronic
1163425050 19:17236386-17236408 CTGGGAAAGGCTGGGCCTGGAGG - Intronic
1163454126 19:17396026-17396048 ATGGGAAAGGCGGGGGTGGGGGG - Intergenic
1163623165 19:18372796-18372818 CTGGGACAGCCACGGGGTGAGGG - Intergenic
1164895130 19:31870123-31870145 CTGGGAACCCCTGGGGTTTGAGG - Intergenic
1165244873 19:34493123-34493145 CTGGCAGTGCCAGGGGTGGGAGG + Intronic
1166700045 19:44877252-44877274 CTGGGACAGACGGGGGTGGGGGG - Intronic
1166760920 19:45224154-45224176 GTGGGAGAGCCAGGAGTGGGGGG + Intronic
1166812944 19:45525090-45525112 ATGGAAAAGCCAGGGGTAGTAGG - Intronic
1167311964 19:48741973-48741995 CTGAGGAATTCAGGGGTTGGGGG + Intronic
1167491995 19:49798413-49798435 TTGGGAAGGCCTGGGTTTGGGGG + Intronic
1168348802 19:55664007-55664029 CTGGGGAAGCGAGGGGCTTGTGG + Intronic
1202715753 1_KI270714v1_random:41493-41515 CTGGGAAAGGAAGGGCCTGGTGG - Intergenic
925160457 2:1680310-1680332 CTGTGAAATCCTGTGGTTGGCGG - Exonic
925190407 2:1877671-1877693 CTGGGACAGGCAGGGGTTCCGGG + Intronic
925388321 2:3478957-3478979 CTGTGAAAGGCAGAGGATGGAGG - Intronic
925422869 2:3726113-3726135 CAGGGGAAACCAGGGGTGGGAGG + Intronic
925449350 2:3954708-3954730 CTGGGAAGGAAAGAGGTTGGAGG - Intergenic
925528945 2:4838144-4838166 GTGGGAAAGCCAGGAGGTGTTGG + Intergenic
926320253 2:11744444-11744466 CGGGGAAGGCCAAGGGTTGGGGG - Intronic
926355675 2:12038804-12038826 CTGGGAGAACCAGAGGTGGGTGG + Intergenic
926508524 2:13745054-13745076 CTGGGAAAGGCAGGCGTTCGGGG + Intergenic
927095580 2:19745570-19745592 CTGGGATGGCCAGTGGCTGGGGG + Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
927356959 2:22185787-22185809 CGGGGCATGTCAGGGGTTGGGGG - Intergenic
928031872 2:27786878-27786900 CAGGGAAACACAGGGCTTGGTGG + Intronic
928089152 2:28363591-28363613 CTGGGAAAGGGAGGGGGTGAGGG - Intergenic
928092879 2:28386803-28386825 CTGGGAAAGCAAGGGGGAAGGGG - Intergenic
928142173 2:28739333-28739355 CTGGGATTGCCAGAAGTTGGTGG - Intergenic
929104464 2:38350424-38350446 CTGTGATTGCCAGGGGTTAGGGG + Intronic
929625076 2:43398226-43398248 CTGGAACATCCAGGGGTTAGGGG + Intronic
930269001 2:49233598-49233620 CCGGGAAGCACAGGGGTTGGGGG - Intergenic
930363259 2:50408449-50408471 CTGAGATAGCCAGGGCTTGGTGG + Intronic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
930719863 2:54628552-54628574 CTGTGAAAGCCAGGAGCTGCTGG - Intronic
931071139 2:58651824-58651846 CAGGGAAAGCCAGTGTCTGGTGG + Intergenic
931614823 2:64144771-64144793 CTGGTAAGGCTAGGAGTTGGAGG - Intergenic
931700306 2:64903679-64903701 GTGGGAAAAGGAGGGGTTGGGGG + Intergenic
932285494 2:70528468-70528490 ATGGAAAAGGCAGGGGTTGGGGG + Intronic
932604140 2:73153031-73153053 ATGGGAAATACAGGGGCTGGAGG + Intronic
932820472 2:74895488-74895510 ATGGGGAATCCAGGGCTTGGAGG - Intergenic
932865535 2:75337485-75337507 CTGGGAAAGGTAGAGGTAGGTGG + Intergenic
934604609 2:95684586-95684608 CTGGGAAATCCAAGGTTGGGGGG + Intergenic
934654223 2:96108902-96108924 CTGGGCAAGGCAGGGGTCAGGGG + Intergenic
934809520 2:97267836-97267858 CTGAGAACACCAGGGGTGGGTGG - Intergenic
935130898 2:100260168-100260190 CTGGGAAAGGCAGGTGCAGGTGG - Intergenic
935195141 2:100809310-100809332 CTGGAGAAGCCAGGGGTTCCAGG + Intergenic
936710150 2:115122263-115122285 CAGGGAAAAACAGGGGTGGGAGG - Intronic
936816054 2:116462267-116462289 CTTGGAAAGGCAGGGGGAGGAGG + Intergenic
938359032 2:130673899-130673921 CAGGGAAAGGCAGAGGTGGGGGG + Intergenic
938488644 2:131743553-131743575 TTGGGAAAGCCAGTGTTTGTAGG + Intronic
939580050 2:143937093-143937115 GTGGGAGCGCCAGGGGCTGGCGG + Intergenic
940007937 2:149026165-149026187 CTGGGAAAGGCAGAGGGTGGAGG + Exonic
940109797 2:150138940-150138962 CTGGGAAAGCCTAGGGGAGGAGG + Intergenic
940135401 2:150430040-150430062 CTGGGAAGGGCATGGGCTGGGGG - Intergenic
942045756 2:172098451-172098473 CTACAAAGGCCAGGGGTTGGTGG - Intergenic
942065832 2:172270667-172270689 CCGGGAAGCACAGGGGTTGGGGG - Intergenic
942268291 2:174248893-174248915 CTGGGAAAGCTTGGGGCTGTAGG - Intergenic
942318159 2:174713173-174713195 TTGTGAGAACCAGGGGTTGGGGG + Intergenic
942874809 2:180782563-180782585 CAGGGCATGTCAGGGGTTGGGGG - Intergenic
942917603 2:181330387-181330409 CTGAGAAAGACTGGGTTTGGAGG + Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
944589323 2:201202469-201202491 CAAGGAAAGCCAGGGCCTGGAGG + Intronic
944822041 2:203441016-203441038 ATGGCAGAGCCTGGGGTTGGGGG + Exonic
944952268 2:204765278-204765300 ATCAGAAAGCCTGGGGTTGGAGG + Intronic
945426419 2:209710030-209710052 CTGGGATAGCTAGGGGTTCCAGG - Exonic
946001435 2:216485710-216485732 CTGTGAAAGGAAGGGGCTGGAGG - Intergenic
946155807 2:217806028-217806050 CTGGGAAAGGGAGGTGCTGGGGG - Intronic
946209159 2:218133623-218133645 CTGGGGAAGCCTGGGTGTGGAGG - Intronic
948237576 2:236402081-236402103 CTGGGAAAGCCAGGGCTTCCTGG + Intronic
948653445 2:239463050-239463072 CTGGGTCAGCCAGGGGAGGGTGG + Intergenic
948977737 2:241473763-241473785 CTGGGAGAGCCAGGGGATGGGGG + Intronic
1169119338 20:3085626-3085648 GTGGGAGAGCCGGGGGTGGGGGG + Intergenic
1169250954 20:4060867-4060889 CTGGGAAGGATAGGGGGTGGAGG + Intergenic
1169486899 20:6041697-6041719 CTCGGAAAGACTCGGGTTGGGGG + Exonic
1169922438 20:10749649-10749671 CTGTGAAAGCAAGGTGCTGGAGG - Intergenic
1170600350 20:17836799-17836821 GTGGGAAAGCCAGAGTCTGGTGG + Intergenic
1170984418 20:21244732-21244754 CGGGGGAAGCCAGGGTTTGGAGG - Intronic
1171133398 20:22675668-22675690 CTGAGAAAGCCAGGGATGGGTGG - Intergenic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1171817779 20:29803650-29803672 CTGTGAGAGCCAGGGGTTAAGGG + Intergenic
1171900458 20:30851621-30851643 CTGTGAAGGCCAGGGGTTAAGGG - Intergenic
1172679428 20:36701059-36701081 CTGGGAGAGCCGGGGAATGGTGG - Intronic
1173200378 20:40950350-40950372 CTGGGAAACTCACGGGCTGGGGG + Intergenic
1174068384 20:47882455-47882477 CTGGGAAGGGTAGGGGGTGGGGG + Intergenic
1175120874 20:56715389-56715411 CTGTGAAAGCCTGGGGAGGGAGG - Intergenic
1175250273 20:57605013-57605035 CTGGGAGAGCCCTGGGATGGGGG - Intronic
1175257866 20:57657804-57657826 CTGGGGACGCCTGGGGTTGGTGG - Intronic
1175464891 20:59184039-59184061 CAGGGGTTGCCAGGGGTTGGGGG - Intergenic
1175674708 20:60936709-60936731 CAGGCAAAGCCAGGGGCGGGGGG - Intergenic
1175692504 20:61075725-61075747 CTGAGAGAGCCAGGAGATGGAGG + Intergenic
1175910828 20:62404774-62404796 CTGGGCAAGGCAAGGGGTGGTGG + Intronic
1176036861 20:63043871-63043893 CCGGGAATGCCAGGGGATCGTGG + Intergenic
1176097041 20:63349064-63349086 GTGGGAGAGCCAGGGGCTGGGGG - Intronic
1176286628 21:5022279-5022301 CTGGGAAGCGCAGGGGTGGGGGG - Intergenic
1176843639 21:13859931-13859953 TTGGAAAAGCCAGCTGTTGGTGG + Intergenic
1176846312 21:13879251-13879273 TTGGAAAAGCCAGCTGTTGGTGG + Intergenic
1176849049 21:13898793-13898815 TTGGAAAAGCCAGCTGTTGGTGG + Intergenic
1179000851 21:37456693-37456715 GTGGGAAGGCCAGAGGTAGGTGG - Intronic
1179334835 21:40441020-40441042 CTGAGTAAGCTTGGGGTTGGGGG - Intronic
1179870553 21:44241196-44241218 CTGGGAAGCGCAGGGGTGGGGGG + Intergenic
1180159672 21:45993416-45993438 CAGGGAGAGCCAGGGCCTGGCGG + Intronic
1180212242 21:46301945-46301967 CTGAGGAAGCCTGGGGGTGGAGG + Exonic
1181051184 22:20239022-20239044 CTGGACCAGGCAGGGGTTGGGGG - Intergenic
1181459677 22:23078667-23078689 CTGGGTGGGCCAGGGTTTGGGGG + Intronic
1182011287 22:27002839-27002861 CTGGAAAAGGCAGGGAGTGGGGG + Intergenic
1182031794 22:27164896-27164918 CTGCTCAAGCCAGGGCTTGGAGG + Intergenic
1182443513 22:30377385-30377407 ATGGGAAAGCCAGGGCTGGCAGG - Intronic
1183019387 22:35015008-35015030 CTGGGAAGTCCTGAGGTTGGAGG - Intergenic
1183046739 22:35226554-35226576 CTGGAAAATCCAGCAGTTGGTGG + Intergenic
1183193458 22:36336615-36336637 ATGGGAAAGCCAGGGGCAGGAGG + Intronic
1183312409 22:37117788-37117810 CTGGGCATGCCAGGGCCTGGTGG - Intergenic
1183350211 22:37330732-37330754 CTAGGACTGCCAGGGGTTGGGGG + Intergenic
1183420728 22:37709878-37709900 ATGGGAAAGCAAGGTCTTGGAGG - Intronic
1183520899 22:38295508-38295530 CTGGGAGAGACATGGGTTGCAGG - Intronic
1184233160 22:43169243-43169265 CTGGGACAGCCAGAGGGTGGCGG - Intronic
1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG + Intronic
950335592 3:12190365-12190387 CTGGGAAACCAAGGTGATGGAGG - Intronic
952730315 3:36631513-36631535 ATGAGAAACCCATGGGTTGGAGG - Intergenic
952941075 3:38444800-38444822 TTGGGCAGGCCAGGGGTGGGGGG - Intergenic
953554512 3:43933035-43933057 ATGGGAATGCAAGGGGTGGGGGG - Intergenic
953916545 3:46924237-46924259 CACTGAATGCCAGGGGTTGGAGG - Intronic
954055824 3:48023846-48023868 CTGGGGATGGCAGGGGTTGGGGG + Intronic
954285217 3:49614441-49614463 CTGGAAAAGCCATGGGATAGAGG + Intronic
954640584 3:52095527-52095549 GTGTTAAAGCCAGGGGGTGGGGG - Intronic
954663926 3:52240469-52240491 ATGAGAAACTCAGGGGTTGGGGG - Intergenic
954744669 3:52780387-52780409 ATGGGATAGCAAGGGGGTGGTGG + Intronic
955380651 3:58435228-58435250 CTGGGAATGGGAGGGGGTGGAGG + Intergenic
956605106 3:71065519-71065541 CTGGGAAAGAAAGGGGTGTGGGG - Intronic
956774059 3:72550356-72550378 CTGGGGGAGGCAGGGGATGGAGG - Intergenic
957925954 3:86811583-86811605 CTGGGAAAGGTAGGGGTGGGGGG + Intergenic
958892135 3:99794757-99794779 CTGGGAAAGCCAGGGGCTCCAGG + Exonic
958957853 3:100480506-100480528 CAGGAAAAGCAAGAGGTTGGGGG - Intergenic
960458175 3:117899556-117899578 CTGGGAAAGCCATAGGATGGAGG - Intergenic
961052374 3:123757722-123757744 CTGGGAAAGGCTGGGCCTGGAGG + Intronic
961356604 3:126343558-126343580 CCGAGAAAGGCAGCGGTTGGCGG + Exonic
961488077 3:127231581-127231603 CTGTGCAAGCCAGAAGTTGGGGG - Intergenic
961619301 3:128210983-128211005 GTGGGAAAGCCAGAGCTTGGTGG + Intronic
961650238 3:128413511-128413533 CTGGGTGGGCCAGGGGTTCGGGG - Intergenic
961665805 3:128492635-128492657 CTGGGAATGCCAGGGTCTCGTGG + Intronic
961830500 3:129620706-129620728 AGGGGAAAGCGATGGGTTGGGGG + Intergenic
962255760 3:133869093-133869115 CTGGGAAAGGCTGTGGGTGGGGG + Intronic
962291104 3:134136956-134136978 CGGGGAAAGACTGGGGTTAGAGG + Intronic
962390269 3:134965893-134965915 CTGCGCATCCCAGGGGTTGGTGG + Intronic
962676891 3:137764350-137764372 CCGGGAAAGCCACGGGAAGGGGG + Exonic
962754135 3:138455465-138455487 CTGGGAAATGCAGGTGGTGGCGG - Intronic
962813085 3:138975319-138975341 CTGGGGAAGCCAGGGATTAGGGG + Intergenic
962919889 3:139941183-139941205 CTGGGAAAGACAGGTTTTGAGGG + Intronic
964276312 3:155012232-155012254 CAGGGACAGTTAGGGGTTGGTGG + Intergenic
965010578 3:163082888-163082910 CAGGGCATGTCAGGGGTTGGGGG + Intergenic
965677540 3:171213512-171213534 GTGGGAAAGACAGGGGAGGGGGG + Intronic
965757353 3:172040106-172040128 CTGGGAAGGCTGGGGGTGGGGGG - Intronic
966925109 3:184639617-184639639 CTGGGAAAGGCAGGGTGAGGGGG + Intronic
966933670 3:184691801-184691823 GGGGGAAAGGCAGGGGTTGGGGG - Intergenic
967792852 3:193567785-193567807 TTGGGAGAGACAGGGGCTGGTGG - Intronic
967892928 3:194375779-194375801 CAGGGAAAGACAGGAGTGGGAGG - Intergenic
967970429 3:194995081-194995103 CTAGGAAGGCAGGGGGTTGGGGG - Intergenic
968505218 4:968252-968274 CTGGGAAGTCGAGGGGGTGGGGG - Intronic
968515761 4:1015041-1015063 CTGGGCAAGCCAGGGGCTGGAGG - Intronic
968577460 4:1374527-1374549 CTGCGGAGGCCAGGGGCTGGTGG + Intronic
968661288 4:1799863-1799885 CTGTGAAGGGCAGGGCTTGGCGG - Intronic
969044011 4:4323374-4323396 GTGGGAAATCAAGGGGTTGGGGG - Intergenic
969093933 4:4718237-4718259 CAGTGAAAGACAGGAGTTGGTGG + Intergenic
969179073 4:5423676-5423698 CTGGGTTGGCCAGGGGATGGTGG + Intronic
969716376 4:8870234-8870256 CTGGCTAAGCCAGGGCTTGGGGG + Intronic
970238457 4:13982719-13982741 ATGGGAAAGCCAGGAGGTGGAGG - Intergenic
971072142 4:23106121-23106143 CTGAGAAAGCCAGAGGCTGCTGG - Intergenic
971125301 4:23747433-23747455 GTGGGAAAGCAAGGGAATGGAGG - Intergenic
971319299 4:25592373-25592395 CAGGGAATTCCAGGGCTTGGAGG - Intergenic
972390778 4:38610901-38610923 GTGGGAATGACGGGGGTTGGGGG - Intergenic
973966876 4:56171944-56171966 CTGGGGAAGGCAGGAGATGGAGG + Intronic
974944095 4:68505298-68505320 CTGGAAGTGCAAGGGGTTGGGGG - Intergenic
975478865 4:74855588-74855610 CTATACAAGCCAGGGGTTGGGGG + Intergenic
975708725 4:77137336-77137358 CTGGGGAGGCCGGGGGCTGGGGG + Intergenic
976255431 4:83095565-83095587 ATGGGAAAGAAAGGGGTAGGGGG + Intronic
976438219 4:85043525-85043547 CAGGAAATGCAAGGGGTTGGGGG + Intergenic
976478344 4:85510615-85510637 CTGGGAAGGACAGGGGAGGGAGG - Intronic
978205340 4:106074050-106074072 CTGGGAAACGCAGGGGGTTGGGG - Intronic
978815050 4:112894729-112894751 CTGAAATAGCCAGGGGATGGTGG - Intronic
979499041 4:121418269-121418291 CAGGGAAAGCCTGGGGCTGAAGG + Intergenic
979744580 4:124195797-124195819 ATGGGGAAGACAGGAGTTGGTGG - Intergenic
980775494 4:137431120-137431142 GAGGGAAAGTAAGGGGTTGGAGG + Intergenic
981970990 4:150661384-150661406 CTGGGAAAGCCAGGAGGCGGAGG + Intronic
982140813 4:152316050-152316072 CTGGGAGAGCTAGGGGTTGCTGG + Intergenic
982215102 4:153075972-153075994 CAGGGAAGGCAAGGGGGTGGGGG - Intergenic
984910629 4:184671286-184671308 CTGTGAGAGCCAGGGTTTGCAGG + Intronic
985658908 5:1146024-1146046 CGGGGACTGCCAGGGGCTGGGGG - Intergenic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
986448488 5:7844179-7844201 CTGGAAAACTCAGGGCTTGGGGG - Intronic
986632231 5:9784743-9784765 CAGGGAAACCCAAGGATTGGTGG - Intergenic
990208035 5:53451137-53451159 CTGGGAAAACAAGGGTTTCGTGG + Intergenic
990516753 5:56537342-56537364 CTTGGAATGCCAGAAGTTGGAGG + Intronic
992373157 5:76166046-76166068 CTGGGTAAGCCAGGGACAGGCGG - Intronic
993228757 5:85204532-85204554 CTGGGAAAGCAGTGGGTTGGTGG + Intergenic
993313871 5:86374615-86374637 CTGTGAAATCTAGGGGTTGAGGG + Intergenic
994520481 5:100828156-100828178 CTGGGAGAGCCTGGGGTTCTGGG + Intronic
995279683 5:110319047-110319069 CTTGGAAAGGCAGGGAATGGGGG + Intronic
996161192 5:120167778-120167800 CTGTGGTTGCCAGGGGTTGGGGG - Intergenic
996388803 5:122937983-122938005 CTGGGCAAGGCAGGGGGTGCTGG - Intronic
996574106 5:124963286-124963308 CTGGGAGCGACAGGGTTTGGGGG - Intergenic
996960379 5:129240658-129240680 CTTGGAAGGCCAGTGGTTGGTGG + Intergenic
997406780 5:133655295-133655317 CTGGGATAGCTAGAGGCTGGTGG - Intergenic
997588382 5:135057991-135058013 CAAGGAAAGCCAAGGGTTGCCGG - Intronic
997671003 5:135671950-135671972 TTGGCCAAGCCAGGGATTGGGGG - Intergenic
998724101 5:144989114-144989136 CTGGGCCTGTCAGGGGTTGGGGG + Intergenic
999409342 5:151336719-151336741 CTTGTAAAGTCAGGGGTAGGTGG + Intronic
999638493 5:153647164-153647186 CGGGGTAAGCCAAGGGTTAGGGG + Exonic
1001335200 5:170790986-170791008 CTGGGAAAACCAGGGGATATTGG - Intronic
1002005055 5:176225729-176225751 CTGGGAGAGCCAGGTGTGAGTGG - Intergenic
1002089205 5:176794561-176794583 AGTGGGAAGCCAGGGGTTGGGGG - Intergenic
1002221320 5:177684896-177684918 CTGGGAGAGCCAGGTGTGAGTGG + Intergenic
1002697405 5:181100192-181100214 CTGTGAGAGCCAGGGCTTGCAGG + Intergenic
1002706126 5:181161666-181161688 CTGGGGAAACCAGGAGTTGAAGG - Intergenic
1002969108 6:1995971-1995993 CTGCAAAAGCCTGGGGGTGGAGG + Intronic
1003389806 6:5703884-5703906 CCGGGAAGGCAAGAGGTTGGAGG - Intronic
1003647475 6:7925878-7925900 CTGGAAGTGCAAGGGGTTGGGGG + Intronic
1004467943 6:15903229-15903251 CAGGGAATGCCAGGGATTGCTGG + Intergenic
1004762732 6:18688202-18688224 CTGGGAATGAGGGGGGTTGGAGG - Intergenic
1005873357 6:29994034-29994056 AGAGGAAAGCCAGGGGGTGGTGG - Intergenic
1006030123 6:31171905-31171927 TGGGGAAAACCAGGGGGTGGGGG + Intronic
1006098875 6:31673341-31673363 CTAGGACAGGCGGGGGTTGGTGG - Exonic
1006270544 6:32962955-32962977 CTGGGAAAGGGAGGGGGTGGAGG + Intronic
1006361502 6:33589663-33589685 CTGGGTAAGCCAGGGGTCCCTGG + Intergenic
1006556554 6:34871983-34872005 CTGGTAAAACCCGGGGTTGGGGG + Intronic
1006640109 6:35485484-35485506 CTGGGGAGGCCTTGGGTTGGAGG - Intronic
1007306443 6:40910056-40910078 CTGGGGAGGTCAAGGGTTGGAGG + Intergenic
1007512365 6:42383434-42383456 CTAGGAAAGCCAGGGTTGGGAGG - Intronic
1007578325 6:42940102-42940124 CTGTCAGTGCCAGGGGTTGGGGG - Intergenic
1007631886 6:43277263-43277285 CTGTGAGAACCTGGGGTTGGGGG + Intronic
1007636625 6:43303602-43303624 CTTGAAAGGCCCGGGGTTGGGGG + Intronic
1008538888 6:52529262-52529284 CTGGGAAAGCTGGGGGGAGGTGG - Intronic
1010755711 6:79664102-79664124 CTGGGAAGGACAGGGGTTGGGGG - Intronic
1010973595 6:82288931-82288953 CAGGGACAGTCAGGGGGTGGGGG + Intergenic
1013032046 6:106343108-106343130 CTGGGAAAGCCAGCTGTCAGTGG + Intergenic
1013143269 6:107361880-107361902 CTGATAAAGCAAGGGGATGGAGG - Intronic
1013225813 6:108118724-108118746 ATGGGGAGGCCAGGGGTGGGTGG - Intronic
1014339589 6:120187532-120187554 GTGGGACAGCCAGGGATTTGGGG + Intergenic
1015423829 6:133041270-133041292 CAGGGTAGGCCAGGGGGTGGGGG - Intergenic
1015642957 6:135356497-135356519 GTTGGAAAGCCAGGGGCTGTTGG + Intronic
1016328278 6:142927200-142927222 GTGGGAAATCCAGGCGGTGGAGG - Intronic
1016934534 6:149439926-149439948 GGGGAAAAGCAAGGGGTTGGTGG - Intergenic
1017164913 6:151398924-151398946 CGGTGACAGCCAGGGGTTAGGGG - Intergenic
1017931429 6:158958991-158959013 CCAGCAAAGCCAGGGGGTGGGGG - Intergenic
1018431346 6:163725286-163725308 CTCAGAATGGCAGGGGTTGGGGG + Intergenic
1018766387 6:166936574-166936596 GAGAGGAAGCCAGGGGTTGGGGG + Intronic
1018769348 6:166957428-166957450 CTGGGAAGGCCAGGGTGTTGGGG - Intergenic
1018879336 6:167861029-167861051 CTGGGCAAGCTAGGTGTTGGTGG + Intronic
1018890172 6:167977243-167977265 CAGGGAAGTCCAGGGGTGGGAGG - Intergenic
1019321397 7:417036-417058 CTGAGCAAGCCAGGAGCTGGGGG - Intergenic
1019405343 7:880610-880632 CTCGGAAAGCCTGGGCTTTGGGG + Intronic
1019493181 7:1324486-1324508 CTGGGAGGGGCAGGGGGTGGAGG + Intergenic
1019622305 7:1998589-1998611 CTGGAACAGCCTGGGGTGGGTGG - Intronic
1019716469 7:2541623-2541645 CTGGGGCAGCAAGGGGTGGGGGG + Intronic
1020023265 7:4881948-4881970 GTGGGAAAAGCAGGGGTGGGGGG - Intronic
1021585867 7:22207452-22207474 TGGGGACAGCCAGGGGGTGGGGG + Intronic
1021620793 7:22549779-22549801 CTGGGATAGCGAGGGGTTTCCGG + Intronic
1023883488 7:44334901-44334923 CTGGCAAAGCCAGTGGATGGAGG + Intergenic
1024505462 7:50158372-50158394 CTGGAGAAGACATGGGTTGGGGG - Intronic
1024615678 7:51109518-51109540 CAGGGGTAGCCAGGGGTGGGGGG - Intronic
1024888829 7:54178528-54178550 ATGGGTGAGCCAGGGATTGGAGG + Intergenic
1026316525 7:69232336-69232358 CTGGGATAGGCAGGGGTAGGGGG + Intergenic
1026910515 7:74089216-74089238 GTAGGAAAGGCAGGGGCTGGCGG + Intronic
1027061211 7:75087928-75087950 CTGTGAAACCCAGGAGGTGGAGG - Intergenic
1027170281 7:75866870-75866892 CTGGGACCACCCGGGGTTGGGGG + Intronic
1029537524 7:101165062-101165084 CTGGGTAAGCGAGGGCTTCGGGG - Intronic
1029575329 7:101399889-101399911 CTGGGAAGGCCAGGGGCAGCGGG - Intronic
1030891156 7:115001217-115001239 CTGAGAAATCCAGGAGTTTGGGG + Intronic
1031273774 7:119690564-119690586 CTGTGAATGGCAGGGGTTGTGGG - Intergenic
1031669946 7:124530074-124530096 CTGTGACAGGCAGGGTTTGGAGG - Intergenic
1032087838 7:128893062-128893084 CTGGGAAGGACAGGGATGGGTGG - Intronic
1032401366 7:131626580-131626602 ATGAGAAAGCCAGGGCTTGGAGG - Intergenic
1033149936 7:138905388-138905410 CTGGGAAAGCCAGGGCTCTGAGG - Intronic
1034091784 7:148370635-148370657 CAGGGAAGGGCAGGGGTAGGGGG - Intronic
1034347086 7:150393150-150393172 CAGTGGTAGCCAGGGGTTGGGGG - Intronic
1034442339 7:151092279-151092301 CTGGGAGAGCCAAGGCTGGGGGG + Intronic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1034928829 7:155144325-155144347 TTGAGAAAGCCAGGGGTGGGGGG - Intergenic
1034980526 7:155473125-155473147 CAGGGACAGTCAGGGGTGGGTGG - Intergenic
1035023886 7:155814426-155814448 CGGGGAAAGACAGGGGGAGGAGG - Intergenic
1035160325 7:156945158-156945180 CTGGAAAAGGCGGGGGATGGGGG - Intergenic
1035277706 7:157758008-157758030 GTGGTGAAGCCAGGGGTTTGCGG + Intronic
1036679718 8:10862908-10862930 CTGGGTAATGCAGGGGTGGGGGG + Intergenic
1036958705 8:13220013-13220035 CTGGGAAGAGGAGGGGTTGGCGG + Intronic
1037816738 8:22116523-22116545 CTCTGAGAGCCAGGGGTCGGGGG - Intronic
1037932479 8:22890173-22890195 CTAGGAAATCCAGGGGCTGAAGG + Intronic
1038190729 8:25317972-25317994 CTGGGAAACACAGGAGTTAGTGG + Intronic
1038348817 8:26757606-26757628 ATGTGAAAGCCAGGCTTTGGGGG + Intronic
1038900928 8:31842912-31842934 CTATGAAATCCAGGGTTTGGTGG - Intronic
1039793171 8:40891530-40891552 CAGGGAACGCCAGGGGCTGGTGG - Intronic
1040068734 8:43171548-43171570 ATAGGAAAGCCAGGGTTTGATGG + Intronic
1041089880 8:54292062-54292084 ATGGGAAAGCCAGGAGTTTTTGG - Intergenic
1041820329 8:62024733-62024755 CTGGCAAGGCCAGGGAATGGAGG + Intergenic
1041826144 8:62098248-62098270 CTGAGGAAGCCAGAGCTTGGAGG - Intergenic
1043395548 8:79832199-79832221 CAGGAAAGGCCAGGGGTGGGGGG + Intergenic
1043920987 8:85983203-85983225 CTGGAAGAGCCAGGCTTTGGTGG - Intergenic
1045918046 8:107497084-107497106 CTGGGTAAGCCAAGGTTTGGGGG - Intronic
1047191639 8:122683630-122683652 CTGGAGAAGCCAAGGGGTGGGGG + Intergenic
1047267207 8:123316761-123316783 TAGGGAATGCCTGGGGTTGGGGG + Intergenic
1047569647 8:126084102-126084124 CTGGGGAAATCAGGTGTTGGTGG - Intergenic
1048888589 8:138928659-138928681 CTGGGCAAGGCAGGGGTAGAAGG + Intergenic
1049385409 8:142340657-142340679 CTGGGAAAGGCAGGGCCTGGTGG + Intronic
1049431987 8:142569483-142569505 CCGGGACAGCCAGGGGTCAGAGG + Intergenic
1049603922 8:143520391-143520413 CCAGGAAAGCCTGGGGGTGGTGG + Intronic
1049831601 8:144704624-144704646 CTGGGAATGGCAGGGGGTGAGGG - Intergenic
1050395888 9:5195372-5195394 GTGGGATGGCCAGGGATTGGGGG + Intergenic
1051865161 9:21672169-21672191 CTGGAAAAGCCACAGGTTTGGGG + Intergenic
1051941648 9:22513302-22513324 CTGGCAAAGTCAGGGCTTTGGGG - Intergenic
1053136046 9:35650726-35650748 CTGGGCAGGGCAGGGGCTGGTGG - Intronic
1053149413 9:35733072-35733094 GTGGACAAGGCAGGGGTTGGAGG - Exonic
1053283880 9:36838369-36838391 CAGGGAACACCATGGGTTGGGGG + Exonic
1054143290 9:61544951-61544973 GTGGGAAAGACAGAGGTGGGAGG + Intergenic
1054812211 9:69443989-69444011 GTGGGGAAGCCAGGGGGTGGGGG - Intronic
1057572747 9:96216778-96216800 CTGGCAGAGGCAGGGGTGGGGGG + Intergenic
1058725053 9:107795017-107795039 CTAGGTAAGCCAGGGGGTCGGGG - Intergenic
1059337770 9:113580000-113580022 CCGAGAAACCCAGGGGTGGGAGG - Intronic
1059930468 9:119255402-119255424 CTGGGGGAGCCAGAGGTGGGAGG + Intronic
1060510501 9:124228811-124228833 GTGGGAGATCCAAGGGTTGGGGG - Intergenic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061001675 9:127906130-127906152 CTGTGAAAGCCAAGGGCGGGAGG + Intergenic
1061730314 9:132609041-132609063 CTTCGAAAGGCAGGGGTGGGGGG + Intronic
1061754729 9:132804529-132804551 CTGTGGAAGCCAGGGGATGCGGG - Intronic
1061950857 9:133935109-133935131 CTGGGCAGGCCAAGGGTGGGAGG + Intronic
1062014113 9:134282721-134282743 CTGGAAGAGTCAGAGGTTGGAGG + Intergenic
1062164971 9:135103101-135103123 CTAGGAAGGCCTGGGCTTGGAGG - Intronic
1062173532 9:135148430-135148452 CTGGGAGAGCCAAGGGTTCTAGG - Intergenic
1062391022 9:136333899-136333921 CTGGGAGAGCTTGGGGGTGGGGG + Intronic
1062507838 9:136887002-136887024 CTGGCAAACTCAGGGGTCGGAGG - Intronic
1186176224 X:6928347-6928369 ATGGGAGAGACAGGGGTTTGGGG + Intergenic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1187291368 X:17956864-17956886 CAGTGATTGCCAGGGGTTGGGGG - Intergenic
1188821004 X:34775056-34775078 CTGGGCCTGTCAGGGGTTGGGGG + Intergenic
1190275929 X:48899221-48899243 TTTGGAAAGCCAAGGGTGGGGGG - Intronic
1190708404 X:53048913-53048935 CTGGGAGAGCCCCAGGTTGGGGG - Intergenic
1190983281 X:55477094-55477116 CTGGGAAAGGCGGGGGCTAGGGG + Intergenic
1190985418 X:55496089-55496111 CTGGGAAAGGCGGGGGCTAGGGG - Intergenic
1191810964 X:65187948-65187970 CTGAGAAAGATAGTGGTTGGAGG - Intergenic
1192136133 X:68602458-68602480 CCGGGAAGCCCAGGGGGTGGGGG + Intergenic
1192464444 X:71344120-71344142 CTGTGGTTGCCAGGGGTTGGGGG + Intergenic
1195414771 X:104608216-104608238 CTGGGCCAGTCAGGGGGTGGGGG + Intronic
1196434051 X:115659019-115659041 ATGGGAAAGCCTGGGAGTGGTGG + Intergenic
1196911444 X:120488317-120488339 CTGTGAAAGGAAGGGGTGGGAGG + Intergenic
1197717080 X:129717320-129717342 CTGGGACAGCCTGGGTTGGGGGG + Intergenic
1198085562 X:133278873-133278895 CTGGGAAGTGCAGGGGGTGGGGG + Intergenic
1198675689 X:139127839-139127861 CCTGGTATGCCAGGGGTTGGTGG - Intronic
1198686567 X:139233827-139233849 CTTGGAAATCCAAGTGTTGGTGG + Intergenic
1199892284 X:152097816-152097838 CTAGGAAAGATAGGGGTTTGGGG + Intergenic
1200737346 Y:6814037-6814059 GTGGGAAGCACAGGGGTTGGGGG + Intergenic
1201583144 Y:15532192-15532214 CAGGAAATGCAAGGGGTTGGGGG - Intergenic