ID: 1160582921

View in Genome Browser
Species Human (GRCh38)
Location 18:79897936-79897958
Sequence GCGATATGAGCAGGTTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160582921_1160582925 28 Left 1160582921 18:79897936-79897958 CCTTTACAACCTGCTCATATCGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1160582925 18:79897987-79898009 CCTGACATTGCTCTGACCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160582921 Original CRISPR GCGATATGAGCAGGTTGTAA AGG (reversed) Intronic
903535811 1:24065518-24065540 GCAACATGAGCGGGTTGGAAGGG - Intronic
908327420 1:63036860-63036882 GTGATAAGAGCAGGTTCCAAGGG - Intergenic
924798945 1:247313160-247313182 GGGAGATGATCAGGTTATAAGGG - Intronic
1069690935 10:70351631-70351653 GCGATATGACCAAGTTTTACGGG + Intronic
1070653145 10:78252407-78252429 GCGAGATGAGCAGGTAGGTAGGG - Intergenic
1084413028 11:69014919-69014941 GGGAGATGAGCAGGTTATGAGGG - Intergenic
1094066674 12:26369013-26369035 GAGAGATGTGCAGGATGTAAAGG + Intronic
1105539178 13:21299672-21299694 ACAATATGGGCAGGTTGTACTGG + Intergenic
1105799064 13:23887952-23887974 GCAATATGGGCAGGTTGTACTGG - Intronic
1107740324 13:43443756-43443778 GACATTTGAGCTGGTTGTAAAGG + Intronic
1118887811 14:69880819-69880841 GCAATCTGAACAGGTGGTAAAGG - Intronic
1120673712 14:87393926-87393948 CTGATCTGAGCAGGTTGTTATGG - Intergenic
1127463195 15:59218775-59218797 GAGATTTGAGCTGGGTGTAAAGG + Intronic
1128992024 15:72268934-72268956 GCTATATGTGGAGGTTTTAATGG - Intronic
1142395990 16:89831900-89831922 GCGAGATGAACAGGTTGGGAAGG - Intronic
1159417016 18:68165306-68165328 GAGATATGAGGAGGTTTGAAGGG + Intergenic
1160582921 18:79897936-79897958 GCGATATGAGCAGGTTGTAAAGG - Intronic
1161732111 19:5967522-5967544 GGGATATGAGGAGGATGTCATGG - Intronic
1162264321 19:9558699-9558721 GGGATAGGAACAGGTTGTAAAGG + Intergenic
1164238312 19:23358578-23358600 ACGATGTGAGCAGGTATTAATGG + Exonic
1173095324 20:40022345-40022367 GCAAAATGAGAAGGTTGTAGTGG + Intergenic
1177641932 21:23854907-23854929 GCCATTTGAGAAGGTTGTAAAGG - Intergenic
1182757336 22:32690636-32690658 GCGATATCAGGAGGTGGTAGTGG + Intronic
1184513790 22:44947869-44947891 GCGATGTGCGCAGGTCTTAAGGG + Intronic
950734311 3:14992968-14992990 GCAACTTGAGCAGGTTGAAAGGG + Intronic
960408051 3:117285992-117286014 GCCATATGAGTACTTTGTAATGG - Intergenic
966088577 3:176102157-176102179 GAGAAATAAGTAGGTTGTAAGGG + Intergenic
971734978 4:30436549-30436571 GGGATATGAGCAAGCTGTCATGG + Intergenic
973963413 4:56134830-56134852 GGGAGATGAGCAGGTTCTAGAGG + Intergenic
977844098 4:101746329-101746351 AGGATATAAGCAGGTTATAAAGG - Intronic
1021052836 7:16010656-16010678 GAGAGATGAGTAGGTCGTAAGGG + Intergenic
1031463670 7:122082252-122082274 GCTAGATGAGCATGTTGTGATGG - Intronic
1041974617 8:63783132-63783154 GCAATATGATCAGATTGAAAAGG + Intergenic
1044222584 8:89686649-89686671 GCAGAATGTGCAGGTTGTAAAGG + Intergenic
1044515323 8:93130977-93130999 GCGATTTGAGAAAGCTGTAAGGG + Intergenic
1047100429 8:121669650-121669672 GAGGTGTGAGCAGGTTGTCACGG + Intergenic
1048403044 8:134089770-134089792 GTCAGATGAGCAGGTTGCAAGGG - Intergenic
1050711803 9:8474050-8474072 GCCATATGAGAAGGCTGCAAAGG - Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1059396414 9:114036694-114036716 GCGAAATGTGCAGGTGGAAATGG + Intronic
1187573855 X:20533246-20533268 GCTATATGAGCAGGAAGGAATGG + Intergenic
1195909847 X:109878012-109878034 GGGTTAGTAGCAGGTTGTAATGG - Intergenic
1198832756 X:140768226-140768248 AAAATATGATCAGGTTGTAAAGG + Intergenic
1199105300 X:143859243-143859265 GTGATATGTGCAGATTGGAAAGG - Intergenic