ID: 1160583495

View in Genome Browser
Species Human (GRCh38)
Location 18:79900606-79900628
Sequence GCCGCAGCCCGAAGCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160583489_1160583495 -1 Left 1160583489 18:79900584-79900606 CCAGGAAACCTGAGACATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 181
Right 1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 205
1160583491_1160583495 -9 Left 1160583491 18:79900592-79900614 CCTGAGACATGGTGGCCGCAGCC 0: 1
1: 0
2: 1
3: 10
4: 188
Right 1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160583495 Original CRISPR GCCGCAGCCCGAAGCAGGAG GGG Intergenic
900558089 1:3289999-3290021 GGGGCAGCCCCAGGCAGGAGTGG - Intronic
900726210 1:4218007-4218029 GCCACAGGCGGAACCAGGAGAGG - Intergenic
901535837 1:9882644-9882666 GGAGCAGCAGGAAGCAGGAGAGG + Intronic
903522176 1:23959356-23959378 GCCGAGGCCCGAGGCGGGAGGGG + Intronic
904330688 1:29756088-29756110 GCAGAAGCCCAAACCAGGAGAGG + Intergenic
904415987 1:30361506-30361528 GCAGAAGCCCAAACCAGGAGAGG - Intergenic
907438191 1:54462712-54462734 GCCTGAGGCCGGAGCAGGAGAGG - Intergenic
914877333 1:151521927-151521949 GCCACAGCCAGAAGCTGGACTGG - Intronic
914950723 1:152111099-152111121 GCCGCATCCCGAAGTGGCAGTGG - Exonic
914962465 1:152218986-152219008 GCCGCGGCCCGAAGCGTGATGGG + Exonic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
919724452 1:200872969-200872991 GCAGCAGCTCTGAGCAGGAGGGG - Intergenic
1063058349 10:2525974-2525996 GCTGCAGCCCGCAGCAGGGCCGG - Intergenic
1063970782 10:11379970-11379992 GCTGCTGCCGGAAGCAGGAGAGG - Intergenic
1065804032 10:29378591-29378613 GCCGCAGGCAGAAGCAGGGCAGG + Intergenic
1067286799 10:44912874-44912896 GCCCCATCCTGTAGCAGGAGGGG - Intronic
1069962807 10:72088273-72088295 GCCGCGGCCAGGAGCAGCAGCGG + Exonic
1070609901 10:77926217-77926239 GCCGCAGCCCGCCGAAGGCGCGG - Exonic
1070833838 10:79435922-79435944 GCCCCAGCTCCGAGCAGGAGGGG - Intronic
1073468612 10:103708950-103708972 GCCCCCACCCCAAGCAGGAGAGG - Intronic
1076509680 10:131003901-131003923 GCTGCAGAGAGAAGCAGGAGAGG - Intergenic
1077085249 11:747032-747054 GCCGCTGCAGGAAGCAGGGGAGG - Intergenic
1077154131 11:1083961-1083983 GCCACAGCAGGAAGCAGCAGGGG - Intergenic
1077501185 11:2910453-2910475 GTCGAGGCCTGAAGCAGGAGAGG + Intronic
1078334177 11:10450890-10450912 GCCGCGCCCCGCAGCAGGCGCGG - Exonic
1078401228 11:11029100-11029122 GCTGCAGCCTGAAGCAGAAATGG + Intergenic
1083920939 11:65781130-65781152 GCCGCAGGCCGGGGCAGGAAAGG + Intergenic
1084053497 11:66616430-66616452 GCCACAGCCCGTGGCGGGAGAGG - Intergenic
1084371272 11:68745857-68745879 GCCACAGCCTGAAGCAGGGCTGG - Intronic
1087743359 11:101914904-101914926 CCCGCCGCTCGAAGCTGGAGGGG + Intronic
1088653497 11:111977745-111977767 GCTGAAGCCCGAGACAGGAGGGG + Intronic
1089533876 11:119149264-119149286 GCCGCAGCCCGAGGCAGGTAAGG + Exonic
1089615599 11:119693010-119693032 CCCGCAGAACGAAGGAGGAGTGG - Intronic
1091133058 11:133162743-133162765 GCTGAAGCCCGTAGCAGAAGGGG - Intronic
1092720510 12:11436027-11436049 ACCACACCCCGAAACAGGAGAGG + Intronic
1094208880 12:27869704-27869726 GCAGCAGCCCCAAGCAGGACAGG - Intergenic
1094498316 12:31002911-31002933 CCCACAGCCCGCAGCTGGAGCGG - Intergenic
1096094185 12:48923871-48923893 GTCACAGCCAGAGGCAGGAGAGG + Intronic
1099316858 12:81094918-81094940 GCAGCAGCACGATGCAGGGGAGG - Intronic
1101282956 12:103278540-103278562 GCCACAGCCCAGTGCAGGAGTGG - Intronic
1101957315 12:109222816-109222838 GCCGCAGCTCGTAGGAGGGGAGG - Exonic
1103196502 12:119048212-119048234 GCCCCAGACCGCAGCTGGAGAGG + Intronic
1103367593 12:120394535-120394557 GCTGCAGCTGGGAGCAGGAGAGG - Intergenic
1104352414 12:128056396-128056418 GCAGCAGAGTGAAGCAGGAGCGG + Intergenic
1105546499 13:21354678-21354700 GCTGGAACCCCAAGCAGGAGGGG - Intergenic
1105645347 13:22312116-22312138 GCCCCAGCCAGAAGCAGCTGGGG - Intergenic
1106460530 13:29964013-29964035 GCCACAGCCCCAGGCAGGTGAGG + Intergenic
1107119340 13:36779584-36779606 GCAGCAGCCCTATGCAAGAGTGG + Intergenic
1107722838 13:43267130-43267152 GCTGCAGCTCGAGGAAGGAGAGG - Intronic
1113756629 13:112816250-112816272 GGCACAGTCCGAAGCAGGACAGG - Intronic
1113931978 13:113973528-113973550 GGGACAGCCTGAAGCAGGAGGGG - Intergenic
1118332851 14:64827168-64827190 GCCGAAGCCCCGAGCAGAAGAGG + Intronic
1118478929 14:66144167-66144189 GCCTGAGCCCCTAGCAGGAGGGG + Intergenic
1122150997 14:99726226-99726248 ACTGCTGCCCGATGCAGGAGCGG - Exonic
1122208497 14:100160033-100160055 GCCCCTGCCCCAAGGAGGAGCGG + Exonic
1122864426 14:104597127-104597149 GCTGCAGCCAGAAACAGGAGGGG + Exonic
1122864447 14:104597193-104597215 GCTGCAGCCAGAAACAGGAGGGG + Intronic
1128969543 15:72095696-72095718 GCCTTAGCCCCTAGCAGGAGAGG - Intronic
1129299214 15:74615827-74615849 GTCGCAGCCGGAAGCGGAAGAGG + Exonic
1129995612 15:80002799-80002821 GCAGCGGCCAGAAGCATGAGCGG - Intergenic
1130002444 15:80059530-80059552 GCCGCAGGCCGGAGGAGGCGGGG - Intergenic
1132586201 16:706621-706643 GCTGCAGCCCGGGGCAGGGGTGG + Intronic
1132683326 16:1152686-1152708 GCGGCAGCGCGAAGGGGGAGGGG + Intergenic
1132806298 16:1776593-1776615 CCCTCAGCCAGAAGCAGTAGGGG + Intronic
1133103179 16:3491383-3491405 GCAGGAGCCCAAAGCAGGGGTGG + Intergenic
1134094593 16:11411182-11411204 TGCCCAGCCCGAGGCAGGAGGGG - Intronic
1135385438 16:22035373-22035395 TCCCCTGCCAGAAGCAGGAGGGG + Intronic
1136485591 16:30570026-30570048 GCCGCCCCCCGGAGCAGGAGCGG + Exonic
1136933459 16:34437686-34437708 GCCACAGCCCGCAGCAGCCGGGG - Intergenic
1136971113 16:34974128-34974150 GCCACAGCCCGCAGCAGCCGGGG + Intergenic
1137449680 16:48559790-48559812 GCAGCACCCTGAACCAGGAGAGG - Intronic
1137708792 16:50552425-50552447 GGGGCAGGCAGAAGCAGGAGTGG + Intronic
1138350217 16:56342351-56342373 GCCGCAGCTCTAAGCTGGAGTGG - Intronic
1139298054 16:65920043-65920065 GCAGAAGCCCCAAGCTGGAGTGG + Intergenic
1139431010 16:66911061-66911083 CCCCCAGCCCCAAGCAGGAGAGG - Intronic
1139631652 16:68235279-68235301 GCCGCAGCCGGAAGCGAAAGGGG - Intronic
1141549388 16:84795209-84795231 GCCGCAGCGAGATGAAGGAGAGG - Intergenic
1142003187 16:87675731-87675753 GCTGCAGCAGGAAGCAGGTGTGG + Intronic
1142911606 17:3098028-3098050 GCCTGAGCCCCTAGCAGGAGAGG + Intergenic
1144519695 17:15945488-15945510 GCACCAGCACGAAGCAGGCGAGG - Exonic
1144680186 17:17188112-17188134 GCCCCAGCCCCAGGCAGGTGTGG + Exonic
1144873249 17:18383118-18383140 GCCGCATCCTGCAGCAGGACTGG + Exonic
1144959810 17:19038745-19038767 GCCACAGGCTGCAGCAGGAGGGG + Intronic
1144975350 17:19135779-19135801 GCCACAGGCTGCAGCAGGAGGGG - Intronic
1146972883 17:37086877-37086899 GCCGCAGCCACAGGCAGCAGAGG - Exonic
1147000566 17:37359244-37359266 GCCGCAGCCCGGAGCGGGGTCGG - Intronic
1148616504 17:49004300-49004322 CCCGCAGCCCGCAGCCGGTGAGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149361606 17:55901402-55901424 GCCGGACCCAGATGCAGGAGTGG - Intergenic
1151217509 17:72587688-72587710 GCCACAGACAGAAGCAGCAGTGG + Intergenic
1151534328 17:74730153-74730175 GCCACAGCCCGAGAGAGGAGTGG - Intronic
1151727841 17:75894854-75894876 GCTGCCGCCAGGAGCAGGAGGGG - Intronic
1151747992 17:76021912-76021934 GCCGCATCCTGCAGCAGGACTGG - Exonic
1151850553 17:76687228-76687250 AGCACAGCCTGAAGCAGGAGGGG - Intronic
1152392341 17:80010314-80010336 GCCGCGGCCCGAGGCCGGGGAGG - Exonic
1153868185 18:9292477-9292499 GCCTTAGCCCCAACCAGGAGGGG + Intergenic
1154161032 18:11981212-11981234 GGCGCAGCCGGGAGCGGGAGGGG + Intronic
1154169231 18:12038671-12038693 CCCGCAGCCCGGAGCAGGATGGG + Intergenic
1156023367 18:32624453-32624475 GTCGCAGCCAGATTCAGGAGAGG + Intergenic
1160449205 18:78950607-78950629 GCCTCTGCCAGAAGCTGGAGAGG + Intergenic
1160462837 18:79052448-79052470 GCCTCAGCCAAAAGCAGCAGGGG - Intergenic
1160473864 18:79165763-79165785 GCTGCAGCCCCACCCAGGAGGGG + Intronic
1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG + Intergenic
1160768845 19:821572-821594 GCCGCAGGCCGTGGCTGGAGGGG + Exonic
1161076879 19:2290129-2290151 ACAGCAGCACGAAGCAGAAGAGG + Exonic
1161675018 19:5641404-5641426 GCCCCACCCCCAAGCAGAAGAGG - Intronic
1163105945 19:15123135-15123157 GCCCCACCCAGAAGCAGGATTGG + Exonic
1164835338 19:31351885-31351907 GCCGCGGCCCGCAGTGGGAGGGG - Intergenic
1165060786 19:33204322-33204344 CCCCCAGCCCGAAGCCGAAGTGG - Intronic
1165236786 19:34428363-34428385 GCCGCGGCCGGAAGCGGGTGGGG - Exonic
1165453574 19:35898724-35898746 GCAGCAGCCCGACGCTGGCGGGG - Exonic
1165955169 19:39497982-39498004 GCTGCGGCCCGAAGGGGGAGGGG + Intergenic
1166765946 19:45252063-45252085 GCCGGAGCCAGAGGCAGGACTGG - Intronic
1167078102 19:47261137-47261159 CACGCAGCACTAAGCAGGAGAGG - Intronic
927519544 2:23690587-23690609 GGCCCAGCCCGAGGCAGGACCGG + Intronic
930021126 2:47002850-47002872 TCCCCAGCCAGAAGCAGAAGTGG - Intronic
930818483 2:55622029-55622051 GCCTCAGCCCCTGGCAGGAGGGG - Intergenic
931706722 2:64952317-64952339 GCCGGAGCCCAAAGGAGGACTGG + Intergenic
932625612 2:73293496-73293518 GCCGCCGCCCGAGGCCGGTGCGG - Exonic
933278966 2:80311393-80311415 GCCCCAGCCAGATGAAGGAGAGG - Intronic
934479011 2:94618197-94618219 GCGGCAGCCCTAAGGAAGAGGGG - Intergenic
935704349 2:105842791-105842813 GACCCAGCCCGTGGCAGGAGAGG + Intronic
936520142 2:113206762-113206784 GCCAGAGCCCAAAGGAGGAGGGG - Intronic
936933260 2:117812206-117812228 GCAGCAGGCAGAAGCAGGAAGGG - Intergenic
937083353 2:119156020-119156042 GCTGCAGCCCTGAGCTGGAGAGG - Intergenic
937127197 2:119482295-119482317 GGCCCAGCCCCTAGCAGGAGAGG + Intronic
939809004 2:146808372-146808394 GCCTGAGCCCCTAGCAGGAGGGG + Intergenic
943436151 2:187867845-187867867 GCTGAAGCCCTAGGCAGGAGAGG - Intergenic
948195518 2:236092913-236092935 GCCGCAGACAGAAACAGGAGCGG + Intronic
1168815496 20:733994-734016 GCCTCAGGCCGGAGCAGGAGAGG - Intergenic
1169132525 20:3173514-3173536 GGCGCAGCCCGAAGCACGCCCGG + Exonic
1169979203 20:11364460-11364482 GCCTGAGCCCCTAGCAGGAGAGG - Intergenic
1172106796 20:32521922-32521944 GCCGCAGCCCGCAGCCGGGCTGG + Intronic
1172896288 20:38302639-38302661 GCTGCAGATGGAAGCAGGAGGGG + Intronic
1176005765 20:62861625-62861647 GCCGCCGCCGGAGGCAGGCGCGG - Exonic
1176244724 20:64091957-64091979 CCGGCAGCCCGAAGCTGGGGGGG - Exonic
1178453567 21:32727467-32727489 GCGGTAGCCCGGGGCAGGAGAGG - Intronic
1178627629 21:34231511-34231533 GCAGCAGCCCAGAGCTGGAGAGG - Intergenic
1179304456 21:40141764-40141786 GCTGCAGCCCCCAGCAGGAAAGG - Intronic
1179496108 21:41772323-41772345 GCTGCAGGCCGGAGCTGGAGGGG - Intergenic
1180206404 21:46264075-46264097 CCCGCAGCACGTAGCAGGAGGGG + Intronic
1183689269 22:39379130-39379152 GCCGGAGCCTGAAGAAGCAGGGG - Intronic
1183946097 22:41326626-41326648 GCTGCAGCTCTAAGGAGGAGAGG - Intronic
1184430364 22:44438679-44438701 GCGGCAGGACCAAGCAGGAGAGG - Intergenic
950665290 3:14491608-14491630 GCCTCAGCCCGAGGAGGGAGGGG + Exonic
950811229 3:15651630-15651652 GCCGCAGCAGGAGTCAGGAGCGG - Intergenic
953369539 3:42375809-42375831 GCAGCAGCAGAAAGCAGGAGCGG + Intergenic
954793690 3:53150536-53150558 GCCCAAGCCCGATGCAGGGGTGG - Intergenic
956678643 3:71757614-71757636 GCTGCTGCCCAAAGCTGGAGTGG - Intergenic
956762932 3:72459500-72459522 GCCGGACCCCGGAGCAGGAGTGG + Intergenic
958648375 3:96902705-96902727 GCCAGAGCCAGAAGCAGAAGAGG + Intronic
961205209 3:125076249-125076271 GCAGCAGCCTGAGGCAGGAGAGG - Intergenic
966863823 3:184245289-184245311 GCCGCAGCACAAAGATGGAGTGG + Exonic
966917051 3:184590851-184590873 GCGGGAGCAGGAAGCAGGAGGGG - Intronic
968067516 3:195766903-195766925 GCCCCAGCACTGAGCAGGAGAGG + Intronic
968647229 4:1746944-1746966 TCCTCAACCCCAAGCAGGAGAGG - Intergenic
968807599 4:2785857-2785879 GCAGCACCCCGAACCAGTAGAGG - Intergenic
968995033 4:3940060-3940082 CCCGCAGCCCCAAGCACAAGTGG - Intergenic
974082891 4:57231085-57231107 GCCCCACCCCCAAACAGGAGAGG + Intergenic
977400357 4:96523972-96523994 GCTGCAGCACAAAGCAGTAGAGG - Intergenic
983054642 4:163087223-163087245 GCCGCAGAGCACAGCAGGAGAGG + Intergenic
985512582 5:320982-321004 GGCGCAGCCCGAGGTCGGAGGGG + Intronic
985533644 5:448758-448780 GCTGCAGCCGCAAGCACGAGAGG - Intronic
985861786 5:2477230-2477252 GCAGCACCCGGAGGCAGGAGGGG - Intergenic
987083312 5:14445934-14445956 GCCCCAGCCCCACGCAGGGGCGG + Intronic
989092075 5:37743776-37743798 GCCTGAGCCCCTAGCAGGAGGGG + Intronic
990016063 5:51063891-51063913 GCCTGAGCCCGTAGCGGGAGGGG + Intergenic
993117228 5:83733616-83733638 GCCTAAGCCCCTAGCAGGAGGGG - Intergenic
996542127 5:124641327-124641349 GCCGCTGGCCGAAGGGGGAGTGG + Exonic
999439632 5:151591281-151591303 CGCGCAGCCCGCAGCCGGAGAGG + Intergenic
1002569507 5:180132175-180132197 GCTTCAGCCCGAGGCAGGAGGGG - Intronic
1005135914 6:22569893-22569915 GCCGGAGCCCGAGGCCGCAGAGG + Exonic
1006333789 6:33410469-33410491 GCCGCCGCCCGGTGAAGGAGGGG + Intronic
1013099530 6:106974991-106975013 CCCGCAGCCCGCAGCCGGCGCGG - Intronic
1015660142 6:135566212-135566234 GCCTAAGCCCCTAGCAGGAGGGG - Intergenic
1017496162 6:154985349-154985371 GCAGCAGCCCTGAGAAGGAGAGG - Intronic
1018091322 6:160348610-160348632 GCTGGAGCCCGGAGGAGGAGTGG + Exonic
1018181628 6:161228247-161228269 GACGCAGCCTGTAGCAGGGGAGG + Intronic
1019094383 6:169567076-169567098 GCAGCAGCCCGAGCCAGGTGGGG + Intronic
1019530291 7:1499730-1499752 GCTGCACCCAGAAGCTGGAGAGG - Intronic
1020257541 7:6510493-6510515 GCCCCAGCCTGAAGCAGCACAGG + Intronic
1021346969 7:19540608-19540630 GCCCCAGCCTGAGGCTGGAGAGG + Intergenic
1021717725 7:23474381-23474403 GCCCCCGCCCGCAGCAGGGGCGG - Intergenic
1022046123 7:26623932-26623954 GCCTCAGCCTGGACCAGGAGAGG + Intergenic
1023966031 7:44963476-44963498 GCCACAGCCCAAAGCCGGCGTGG - Intronic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1024563348 7:50662473-50662495 GCTTCAGCCCCAGGCAGGAGGGG + Intronic
1029616169 7:101659264-101659286 GGAGCAGGCTGAAGCAGGAGAGG + Intergenic
1033609931 7:142955112-142955134 GCAGCATCCTGAAGCAGTAGAGG - Intronic
1033911456 7:146268476-146268498 GACCCAGCCCTAAGTAGGAGAGG + Intronic
1034469766 7:151248945-151248967 GCTGCAGCCCGAAGCCGCCGAGG + Exonic
1034475130 7:151277155-151277177 GCTGCAGCCCGGAGCGGGGGAGG + Intronic
1037901414 8:22691522-22691544 GCCGCGGCCCGGAGCCGGATCGG - Intronic
1038039748 8:23714674-23714696 GCCGCCGCCCGCCGCGGGAGCGG + Intergenic
1041165795 8:55090996-55091018 GGAGCACCCAGAAGCAGGAGGGG + Intergenic
1042079944 8:65040635-65040657 GCCGGAGCCCGGAGCATGGGTGG - Intergenic
1043893243 8:85715968-85715990 GGAGCAGCCGGCAGCAGGAGAGG + Intergenic
1044724046 8:95178114-95178136 GCAGCAGTCTGAACCAGGAGGGG - Intergenic
1047499233 8:125429652-125429674 GCTGCAGCCGGAGGAAGGAGGGG - Intergenic
1049655760 8:143796278-143796300 GCAGCAGCCAGAAGCAGCGGAGG + Intronic
1050358502 9:4805084-4805106 TCAGGAGCCCGAAGCAGCAGGGG + Intronic
1053678817 9:40465368-40465390 GCGGCAGCCCTAAGGAAGAGGGG + Intergenic
1053928802 9:43093721-43093743 GCGGCAGCCCTAAGGAAGAGGGG + Intergenic
1054284907 9:63159574-63159596 GCGGCAGCCCTAAGGAAGAGGGG - Intergenic
1054291895 9:63300906-63300928 GCGGCAGCCCTAAGGAAGAGGGG + Intergenic
1054389913 9:64605449-64605471 GCGGCAGCCCTAAGGAAGAGGGG + Intergenic
1054505801 9:65910927-65910949 GCGGCAGCCCTAAGGAAGAGGGG - Intergenic
1054734405 9:68735918-68735940 GCAAAAGCCTGAAGCAGGAGTGG + Intronic
1055665359 9:78547432-78547454 GCTGCAGCCAGAAGAAGGAGAGG - Intergenic
1055751706 9:79513848-79513870 GCAGAAGCCAGAAGCAAGAGAGG + Intergenic
1056468218 9:86879620-86879642 GCAGCAGCAGGAAGCAGGGGTGG + Intergenic
1058020920 9:100087577-100087599 GCCCCAGAACTAAGCAGGAGAGG + Intronic
1058687160 9:107489196-107489218 TCGGCAGCCCGAAGCAGCTGGGG + Exonic
1060712191 9:125878417-125878439 GCCGGAGGCCTAATCAGGAGAGG - Intronic
1060743862 9:126117118-126117140 TCAGCCGCCAGAAGCAGGAGGGG + Intergenic
1061705407 9:132449336-132449358 GCTGCAGCCAGGAGTAGGAGAGG - Intronic
1062397596 9:136358685-136358707 GCCCCAGGACGAAGCTGGAGGGG - Exonic
1188451095 X:30308823-30308845 GCCTCTGCGCGAAGTAGGAGCGG + Exonic
1189289420 X:39874742-39874764 GCCACAGCTGGAAGCAGCAGAGG + Intergenic
1190688834 X:52897146-52897168 GCCGGAGCCGGAAGACGGAGCGG - Intronic
1190697149 X:52958646-52958668 GCCGGAGCCGGAAGACGGAGCGG + Intronic
1192082396 X:68060960-68060982 GAAGCAGCCAGAATCAGGAGGGG + Intronic