ID: 1160583745

View in Genome Browser
Species Human (GRCh38)
Location 18:79901545-79901567
Sequence CCCACGGAGGGGCCCTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160583735_1160583745 2 Left 1160583735 18:79901520-79901542 CCCAGGCTCTCACAACCCGCTCT No data
Right 1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG No data
1160583733_1160583745 30 Left 1160583733 18:79901492-79901514 CCTCATGGGGTGAGGGGAATGTG No data
Right 1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG No data
1160583736_1160583745 1 Left 1160583736 18:79901521-79901543 CCAGGCTCTCACAACCCGCTCTC No data
Right 1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160583745 Original CRISPR CCCACGGAGGGGCCCTCACT GGG Intergenic
No off target data available for this crispr