ID: 1160586537

View in Genome Browser
Species Human (GRCh38)
Location 18:79916396-79916418
Sequence GCAGGTGAACAGAGGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160586537_1160586545 10 Left 1160586537 18:79916396-79916418 CCTTTTGCCCTCTGTTCACCTGC 0: 1
1: 0
2: 4
3: 45
4: 391
Right 1160586545 18:79916429-79916451 CTCTAACCCTCATTCCAGAGAGG 0: 1
1: 0
2: 1
3: 35
4: 372
1160586537_1160586546 11 Left 1160586537 18:79916396-79916418 CCTTTTGCCCTCTGTTCACCTGC 0: 1
1: 0
2: 4
3: 45
4: 391
Right 1160586546 18:79916430-79916452 TCTAACCCTCATTCCAGAGAGGG 0: 1
1: 0
2: 3
3: 46
4: 287
1160586537_1160586550 28 Left 1160586537 18:79916396-79916418 CCTTTTGCCCTCTGTTCACCTGC 0: 1
1: 0
2: 4
3: 45
4: 391
Right 1160586550 18:79916447-79916469 AGAGGGTCCTGCCGACATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160586537 Original CRISPR GCAGGTGAACAGAGGGCAAA AGG (reversed) Intronic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
901817727 1:11804506-11804528 ACAGGCCAACAGAGGGCATAGGG + Intronic
901905302 1:12404253-12404275 GGAGCTAAACAGAGAGCAAATGG - Intronic
901921062 1:12538079-12538101 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
903328492 1:22585114-22585136 GTAGGTGGACAGAGGAGAAAAGG + Intronic
905224729 1:36471779-36471801 ACAAGGGAACAGAGGGAAAAGGG - Intronic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905856683 1:41319211-41319233 GCAGGTGAGAACAGGGCAAGTGG - Intergenic
905888108 1:41502567-41502589 GCAGGTGAAGAGGGTGCAGATGG - Intergenic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906305559 1:44716442-44716464 GGAGGTGTTCAGAAGGCAAATGG - Intronic
906381758 1:45336943-45336965 GCAGATCTTCAGAGGGCAAAGGG + Intronic
906505956 1:46379810-46379832 GCAGAAGAACAGAAGGGAAAAGG + Intergenic
908924233 1:69234163-69234185 GTAGGTGACCATAGGACAAATGG + Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909599493 1:77447058-77447080 GAAGAGGAACAGAGGTCAAAAGG + Intronic
910401012 1:86838224-86838246 GCAGCAAAACAAAGGGCAAAAGG - Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911169362 1:94755122-94755144 GAAAGTCAGCAGAGGGCAAATGG - Intergenic
911537486 1:99117917-99117939 GCCATTGAACAGAGGGCGAACGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
911834574 1:102600256-102600278 GAAGGAGAACAGAGGGACAATGG + Intergenic
912151677 1:106866726-106866748 GCAGAGAAACAGAGGGAAAATGG - Intergenic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
915289222 1:154871631-154871653 GGAGCTGGACAGAGGCCAAAGGG - Intergenic
917580979 1:176377550-176377572 ACAGGGTAACAGAGGGAAAAAGG - Intergenic
918341151 1:183568846-183568868 GCACGTGGACAGAGGGCCAATGG + Intronic
918960581 1:191271502-191271524 GCGAGTGAACTGATGGCAAAGGG + Intergenic
920107064 1:203561260-203561282 GCAGGTGAGCAGCTGGCAATAGG + Intergenic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920797805 1:209157626-209157648 GCAGCTGAACAGAGCGATAATGG - Intergenic
921129736 1:212209434-212209456 TTGGCTGAACAGAGGGCAAATGG + Intergenic
921221421 1:212976756-212976778 GCAGGAGGGCAGAGGGCAAGTGG - Intronic
921377403 1:214488726-214488748 TCAGGATCACAGAGGGCAAATGG + Intronic
922148022 1:222968303-222968325 GCAGGAGAATAGTGGGAAAATGG - Intronic
922663539 1:227450135-227450157 GCATGTGAACTGAGGCAAAATGG - Intergenic
922879548 1:228970350-228970372 GCAGAAGAGCAGAGGGGAAAAGG - Intergenic
924514779 1:244756734-244756756 GGAGGAGAACTCAGGGCAAAGGG - Intergenic
1062899192 10:1129259-1129281 ACAGGTGAACAGATTGCACACGG - Exonic
1063051685 10:2456407-2456429 GCAGGTGAACAGAGAGTAAAAGG + Intergenic
1063094096 10:2894021-2894043 AAAGGTGAAAAGAGGGGAAAAGG + Intergenic
1063769048 10:9176769-9176791 GCAGTTTAGCAGAGGGCTAATGG - Intergenic
1063956235 10:11270249-11270271 ACAGGTGGACAGAGGACAAAGGG - Intronic
1063987935 10:11527097-11527119 GCAGGTGTACAGAGTGCTGAGGG + Intronic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1065001021 10:21337621-21337643 GGAGGTGAAAAGAATGCAAAAGG - Intergenic
1065053720 10:21821197-21821219 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1065850370 10:29782603-29782625 GCAGGAGAACAGAGAGGAAGTGG + Intergenic
1066003233 10:31124165-31124187 GGAGGAGAGCAGATGGCAAATGG + Intergenic
1067904040 10:50272220-50272242 GCAGGAGCAGAGAAGGCAAAGGG + Intergenic
1068558257 10:58482263-58482285 GGGGGAGAACAGAGGGCAACAGG - Intergenic
1069001684 10:63273812-63273834 GAAGGTAAACAGAGGCTAAAAGG + Intronic
1069836453 10:71311498-71311520 CCTGGTGAAAATAGGGCAAAGGG + Intergenic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1071096369 10:81979955-81979977 ACAGGTAAACATAGGCCAAAGGG + Intronic
1073568528 10:104556358-104556380 GCAGGTGAACTGGGGGGACAAGG - Intergenic
1074222953 10:111456128-111456150 GCATGTAAACAGATGGTAAATGG - Intergenic
1076244038 10:128932391-128932413 GCAGGAGAGAAGATGGCAAAGGG + Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076599535 10:131647929-131647951 GCAGGGGGACAGAGAGCAACAGG - Intergenic
1076979898 11:198701-198723 GCAGGTGCCCAGAGGGTGAAGGG - Intronic
1078257665 11:9673824-9673846 GCAGGCGAAAAAAGGGCAGAAGG + Intronic
1078912294 11:15744307-15744329 GAAGGTGAAGAAAGAGCAAAGGG + Intergenic
1079398588 11:20087019-20087041 GAAGATGATCAGAGGGCAAGAGG + Intronic
1081850642 11:46272942-46272964 GCAGGCAGACAGAGGGCCAAGGG + Intergenic
1082212491 11:49522094-49522116 GCAAATGAAAAGAGGGGAAAGGG + Intergenic
1082686228 11:56242256-56242278 GAAGATGAACAGAAGGAAAAAGG + Intergenic
1083210710 11:61183678-61183700 GCAGGTGAAAAGAAGGCCGAAGG - Intergenic
1083741551 11:64713946-64713968 GCGGGAGAACAGAGAGGAAAGGG + Intronic
1083849191 11:65355303-65355325 ACAGGTGTACAGACGACAAAGGG - Intronic
1084276818 11:68056317-68056339 GCAGGTGAAAGGACGGCAGAAGG - Intronic
1084491188 11:69479526-69479548 GCAGGTGAGGAGAAGACAAAGGG + Intergenic
1085882490 11:80484420-80484442 GAAGGTGAACAGAGGGCACCAGG - Intergenic
1086637103 11:89102403-89102425 GCAAATGAAAAGAGGGGAAAGGG - Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087052056 11:93896233-93896255 GGAGGGAAACAGAGGACAAATGG - Intergenic
1087236415 11:95723779-95723801 GAAGGTCAAGAGAGGGCAAGAGG + Intergenic
1087883570 11:103449044-103449066 GCATGTGAACAGAGACCTAAAGG + Intronic
1088738670 11:112749140-112749162 GCAGGGGAACTGGGGGCCAAGGG - Intergenic
1088822880 11:113471468-113471490 GGAGGTGAGAAGAGGGAAAATGG + Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089256056 11:117194703-117194725 GCAGGAGGACAGAGGACTAACGG + Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092290490 12:7157226-7157248 GCAGGTGTACAGAGAGGCAAGGG - Intronic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1093072905 12:14724965-14724987 GCAGGTGGACTGAGTGAAAAAGG + Intergenic
1094742233 12:33303172-33303194 GCAGGTGAAAGGAGGGCAGAAGG - Intergenic
1097477938 12:60082552-60082574 TCAGGAGAACAGAGGGAGAAAGG - Intergenic
1097819229 12:64110928-64110950 CCAGGTGAACATATGACAAATGG - Intronic
1098578276 12:72069638-72069660 GAAGGTGAAGAAAGAGCAAAGGG + Intronic
1099384009 12:81992085-81992107 GCAGGTGAACAGGGCCAAAATGG - Intergenic
1101248721 12:102910762-102910784 GAAGGTAAGGAGAGGGCAAATGG - Intronic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1103422873 12:120802872-120802894 GAAGGTGCACAGTGGGCAACAGG - Intronic
1103862947 12:124028728-124028750 TCAGATGAACAGAGGGAAAGAGG + Intronic
1103884261 12:124189036-124189058 GCAGGTGGACACAGGGAAATTGG + Intronic
1105000865 12:132688513-132688535 GCGGGTGAAGACAGGGCCAAGGG + Intronic
1105001048 12:132689098-132689120 GCGGGTGAAGACAGGGCCAAGGG + Intronic
1105284979 13:18996204-18996226 GCAGAGGGCCAGAGGGCAAAAGG + Intergenic
1106017010 13:25879070-25879092 GCAGGAGAGCAGAGGGCATTTGG + Intronic
1106076393 13:26464786-26464808 GCAGGGGAACAGAGCGGAGAAGG + Intergenic
1106174737 13:27320573-27320595 GCTGGTAAGCAGAGGGAAAAGGG + Intergenic
1107655608 13:42589728-42589750 GCAAGTGCAGAGAGGGCAAAGGG + Intronic
1108686608 13:52825697-52825719 GCAGGTGAATGGATGACAAATGG - Intergenic
1112640998 13:101275073-101275095 GCAGGTCAGGAGAGTGCAAATGG - Intronic
1113308728 13:109108669-109108691 CCAGGTGCAAAGAGAGCAAATGG + Intronic
1113472866 13:110559188-110559210 GCAGGTGTGCAGAGGGCGACAGG - Intronic
1114143582 14:19946798-19946820 GCAGGAGATTAGAGGGAAAAAGG - Intergenic
1114837205 14:26216777-26216799 GCAGGACAATAGAGGGAAAAGGG + Intergenic
1116458028 14:45141487-45141509 GGAGGAGAACAGAGGAGAAAGGG - Intronic
1116713312 14:48397108-48397130 GCAGGTACACAGAGGGCAAGAGG + Intergenic
1117289739 14:54320861-54320883 GCAGGAGACCAGAGGGCAAGAGG + Intergenic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1119386601 14:74261224-74261246 GCAAGAGAACAGAGAGCAAGGGG - Exonic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120821932 14:88919640-88919662 GCCGGAGAACAGAGGTCACAGGG - Intergenic
1120974768 14:90238856-90238878 GAAGGTAAACAAAGGGGAAAAGG - Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1123999028 15:25739461-25739483 GCAAGTGAAGAGAGGGCATTTGG + Intronic
1124468457 15:29961716-29961738 TCAGGTGAAGAGAAGGGAAATGG - Intronic
1126313417 15:47341874-47341896 GCAGGTGAAAGGAGGGAAAGGGG - Intronic
1126405471 15:48318302-48318324 GCAGGAGACCAGAGGGAGAAGGG - Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128372492 15:67050533-67050555 GCAGGTACACAGAGGGGAAGGGG + Intergenic
1128690455 15:69720886-69720908 GAATTTGAACAGAGGGGAAAAGG - Intergenic
1129105707 15:73305807-73305829 GCAGATGAACAGTGGGGCAAAGG - Intergenic
1129775359 15:78233144-78233166 TCAGGTGCACAGAGGGTCAAGGG - Intronic
1130313136 15:82771918-82771940 GCAGGTGAACAGGGCAGAAAGGG - Intronic
1130876475 15:88018921-88018943 GGTGGTGAAGAGAGGGGAAAAGG - Intronic
1131020402 15:89093102-89093124 TCTGGAGAACAGAGAGCAAACGG - Intronic
1131092652 15:89633961-89633983 GCAGGCAGATAGAGGGCAAATGG + Intronic
1131382180 15:91973151-91973173 GCAGGGGAACTGAGGCAAAAGGG + Intronic
1132301048 15:100775763-100775785 GGAGGGGGACAGTGGGCAAAGGG - Intergenic
1133921359 16:10156104-10156126 GCAGGTGCAGAGTGGGCAGATGG - Intronic
1134285963 16:12862435-12862457 GGAGGTGAGCAGTGGGCAAGTGG - Intergenic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1135573017 16:23563743-23563765 ACAGGGGACCACAGGGCAAACGG - Intronic
1136081313 16:27854239-27854261 GAGGGTGAATAGAAGGCAAAAGG + Intronic
1136169921 16:28482675-28482697 GCAGGGGAACAGAGAGAGAAGGG + Intronic
1136534734 16:30893051-30893073 GGAGCAGAAAAGAGGGCAAAAGG + Intronic
1136609920 16:31360000-31360022 GCTGGTGAACAGAAGCCAACAGG - Exonic
1137781998 16:51105327-51105349 GCAGGAGAAGTCAGGGCAAAAGG - Intergenic
1137836632 16:51598411-51598433 GGAGGTGAGCAGTGGGCAAGTGG - Intergenic
1138414178 16:56861873-56861895 GCAGAAGCAAAGAGGGCAAAGGG - Intergenic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1139238891 16:65369995-65370017 GCAGGTGAAGAGAGAGAAATTGG + Intergenic
1139369482 16:66457903-66457925 AATGGTGAACAGAGGGAAAATGG + Intronic
1139369587 16:66458481-66458503 GCAGGTTCAGAGAGGGCAAGCGG + Intronic
1140350634 16:74258831-74258853 GCAGGTGTTCAGAAGCCAAACGG - Intergenic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141481144 16:84307827-84307849 GCAAGTGAACTGAGAGCTAATGG + Intronic
1142359538 16:89619684-89619706 GGAGGGGAGCAGGGGGCAAAAGG - Intronic
1142581275 17:944503-944525 TCAGCTGAGCAGATGGCAAAGGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143472499 17:7184734-7184756 GCTGGTGAACAGAGGAGAAGGGG + Intergenic
1144234079 17:13239882-13239904 GCAGGTGCACAGAGGTGGAAGGG - Intergenic
1144571903 17:16405582-16405604 GCAGGTGAGGAGGGTGCAAAGGG + Intergenic
1146589453 17:34116112-34116134 GCAGGAGACCAAAGGTCAAACGG - Intronic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148760458 17:49997139-49997161 GCAGCAGAACAGAGGGCACCCGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149492815 17:57097261-57097283 GCAGCTGAGAAGTGGGCAAAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150642558 17:66959330-66959352 GCAGCTAAACAGAGAGCAAGTGG - Intergenic
1151246172 17:72796562-72796584 AAAGGAGAACAGAGGGGAAAGGG + Intronic
1152189358 17:78879109-78879131 GCAGGTGAAGAGAGGGTACAGGG + Intronic
1152413304 17:80142383-80142405 GCAGGTGAAAGGAGAGCAGAAGG - Intronic
1152870000 17:82748683-82748705 GCAGGTAAAGAGAGAACAAAGGG - Intronic
1153521995 18:5962370-5962392 GCAGGACAACACAGGGCCAAAGG + Intronic
1154461594 18:14595163-14595185 GCAGGAGATTAGAGGGAAAAAGG - Intergenic
1155178560 18:23323402-23323424 GCAGGTGAAAAGCAGGCAACAGG - Intronic
1155704820 18:28795532-28795554 GTAGGTGTAAAGAGGGGAAAGGG + Intergenic
1155840051 18:30632552-30632574 GCAGGTGCACAGTGGACAGATGG - Intergenic
1155986816 18:32238797-32238819 GCGGGAGAACAGAGGACAAGAGG - Intronic
1156033910 18:32744890-32744912 GCCAGTGAACAGTGGGCAAACGG + Intronic
1156292036 18:35755772-35755794 GCAGGTGGAGAGGAGGCAAAAGG - Intergenic
1156762914 18:40614905-40614927 GAAGGTGAAGAGAGAGCAAGAGG + Intergenic
1157943977 18:51958254-51958276 TCAAGTGAAAAGAAGGCAAAAGG + Intergenic
1158197571 18:54905780-54905802 GGAGGTGAGCAGTGGGCAAGAGG + Intronic
1158549527 18:58423330-58423352 GCAGGAGAACAGAATGGAAAAGG + Intergenic
1160223081 18:76991388-76991410 GCAGGGGAACACAGGGGACATGG + Intronic
1160292421 18:77606922-77606944 GTAGATGAACACATGGCAAAGGG + Intergenic
1160432978 18:78824966-78824988 GCAGTTGAACAGAAAGCAAACGG + Intergenic
1160467210 18:79089424-79089446 GCACGTGCACAGTGGGCCAAGGG - Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1161261282 19:3339076-3339098 GCTGGAGGTCAGAGGGCAAAGGG + Intergenic
1162807968 19:13148722-13148744 ACAGGTGCACACAGGACAAATGG + Intronic
1163024621 19:14503351-14503373 GCAGGGGAAGACAGGGTAAATGG - Intergenic
1163819325 19:19487210-19487232 CCAGATGAACAAAGGGCAAGGGG - Intronic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165146604 19:33734917-33734939 CAAGCTGAACAGAGGGTAAACGG + Intronic
1165490924 19:36122170-36122192 GCAGGTGAGCAGAGCGCAGGAGG + Intronic
1166128632 19:40731862-40731884 GCAGGTGAAAGGAGGGCAGGAGG + Intronic
1166648597 19:44552604-44552626 GAATGTCAACAGAGGCCAAATGG + Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167331587 19:48859596-48859618 GGAGGTGAGCAGAGGGGAAGAGG - Exonic
1168413828 19:56156612-56156634 GCAGGTGAAAGTAGGGCAGAAGG + Intronic
925191274 2:1885771-1885793 GCAGGTGCACACAGGGAAAGAGG - Intronic
925438469 2:3862981-3863003 GCAGGTGAGCAGCAGGCAAGTGG + Intergenic
926238192 2:11065699-11065721 GCAGGTGCTCAGAGGGTAACTGG + Intergenic
926785860 2:16517915-16517937 GCAGGGGAAAAGAAGGAAAATGG - Intergenic
926797201 2:16628820-16628842 GCAGGTGAACACAGGGAGAGTGG - Intronic
928342826 2:30460247-30460269 GCAGATGAACACTGGGCAGATGG - Intronic
928619338 2:33072607-33072629 GCAGGTGAAAGGAAGGCAGAAGG + Intronic
929080305 2:38116071-38116093 GCAGCTAAACAGAGGGGAATGGG + Intergenic
929182645 2:39060029-39060051 GCAGGTGAAAAGGGAGAAAAGGG + Intronic
930004880 2:46888726-46888748 GCAGCTGAGCAGACGGGAAAAGG - Intergenic
930171100 2:48252567-48252589 GCATCTGAGCAGAGGACAAAAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
934049358 2:88197621-88197643 GGAGGTGAACAGCAGGCAGAGGG - Intergenic
934556135 2:95287986-95288008 GCTGGTGAACAGATGGAAAGGGG + Intronic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
936039587 2:109140107-109140129 GACGGTGGACAGAGGGAAAAGGG - Intronic
936545399 2:113388085-113388107 GCAGGAGACCGAAGGGCAAAAGG + Intergenic
938576059 2:132605808-132605830 GCAGGGTAGCAGAGGCCAAAGGG + Intronic
938641300 2:133283324-133283346 GGGGGTGAACAAAGGACAAAAGG - Intronic
938734021 2:134169820-134169842 GCAAATGAACAGAGAGCCAAGGG + Intronic
940108577 2:150125729-150125751 TGAGGTGAACAGTGGCCAAATGG - Intergenic
940238901 2:151541876-151541898 GCAGGTGAAAAGAGGGGATTGGG - Intronic
940362521 2:152811913-152811935 GAAGGTGAAGAGAAAGCAAAAGG - Intergenic
940504724 2:154538827-154538849 GCAGGTCATCACATGGCAAAGGG - Intergenic
942045024 2:172095146-172095168 GCAGGAGAAGCGAGGGCGAAAGG - Intergenic
942135246 2:172919009-172919031 GCAGGAAAGCAGAAGGCAAATGG - Intronic
944285918 2:197949654-197949676 GGAGGTAAACAGAGGGAAAGGGG + Intronic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
944764060 2:202846568-202846590 GCAGGTCAAAGGAGGGCAGAAGG + Intronic
944942154 2:204640392-204640414 GCAGGAGAACATAGGACAATGGG + Intronic
944943079 2:204651824-204651846 GTGGGTGTGCAGAGGGCAAAAGG - Intronic
945264711 2:207879600-207879622 GCAGGAACACAGAGGGCAAATGG + Intronic
945613746 2:212040607-212040629 GGAGGTGAATATAGGGCAACTGG - Intronic
945876158 2:215280076-215280098 ACAGATGAACAAAGGGGAAAAGG - Intergenic
945893939 2:215461303-215461325 GCAGCTGAAAAGAAGGAAAAGGG - Intergenic
946226391 2:218266160-218266182 ACAGATGAAGAGAGGGCAGAGGG + Intronic
946301504 2:218827185-218827207 GCAGGTGATCAGAGGGCCTGAGG - Intronic
946385606 2:219382620-219382642 GGAAGGGAAGAGAGGGCAAAGGG - Intronic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
947424655 2:229972533-229972555 GCAAGTGAACAGAGGGAGAGAGG + Intronic
947735456 2:232452252-232452274 GCAGGGGAGCAGGGGGCAAGAGG - Intergenic
947879821 2:233497922-233497944 GCAGGTGAAGACTGGGGAAAGGG + Intronic
947939460 2:234036924-234036946 GAAGGTGAAGAGATGGCCAAAGG + Intergenic
947996191 2:234529759-234529781 GCAGGAGGACAGAGTGCAGAGGG + Intergenic
948082642 2:235219265-235219287 GTGGATGAACACAGGGCAAAGGG - Intergenic
948600055 2:239102616-239102638 GCTTGTGAACAGAGGGTGAAAGG + Intronic
1169172139 20:3473421-3473443 GCAGGAGCAGAGAGAGCAAAGGG + Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169621887 20:7516352-7516374 GCAGCTGGTCTGAGGGCAAAAGG - Intergenic
1170509662 20:17063694-17063716 GCAGGTGAACTCAGGGGAACTGG + Intergenic
1171480296 20:25450179-25450201 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1173008627 20:39160365-39160387 GTAGGTGATGAGAGGGCAACAGG + Intergenic
1173245668 20:41335797-41335819 GCAGAGGAACAGAGGACAACAGG - Intergenic
1173638965 20:44585776-44585798 GCAGGAGACTAGAGGGCACAGGG - Intronic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1174329550 20:49807285-49807307 GCAGGTGAGGAGAGGGAAAGAGG - Intergenic
1174532996 20:51229591-51229613 GCTGACGAACAGAGGGCAAAGGG + Intergenic
1175758981 20:61548323-61548345 GCAGGTGGAAGGAGGGAAAAGGG + Intronic
1176812956 21:13563429-13563451 GCAGGAGATTAGAGGGAAAAAGG + Intergenic
1178306019 21:31490721-31490743 GCAGATGAAAAGAGGCCAACTGG + Intronic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1179614153 21:42570912-42570934 GCAGGTTAACAGAAGGCCAGAGG - Intronic
1181159024 22:20945731-20945753 GCAGGTGCACAGAGAACACAGGG + Intronic
1181666417 22:24401534-24401556 GCAGCTGAACAGCTGACAAAGGG - Intronic
1181848910 22:25735783-25735805 TCAGGATAACAGAGGGCAAGAGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1182110281 22:27718221-27718243 GGAGGTGAAGAGAGGGCACCTGG + Intergenic
1182416603 22:30225301-30225323 GCAGCTGGAGAGGGGGCAAAAGG + Intergenic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1183082101 22:35463242-35463264 GCAGGTGGAGAGAAGGCAAGTGG + Intergenic
1184153394 22:42651174-42651196 ACAGGTGAACAGAGGCCTGATGG + Intergenic
1184319937 22:43733557-43733579 ACAGGTCATCAGAGGGTAAAGGG + Intronic
1184366373 22:44054166-44054188 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
950164184 3:10781084-10781106 GCAAGAGATCAGAGGGCGAAGGG - Intergenic
950468657 3:13171287-13171309 GCAGGTGGACACAGGAGAAAAGG + Intergenic
950678150 3:14567087-14567109 GCAGCAGGACTGAGGGCAAAGGG - Intergenic
950700906 3:14745308-14745330 GCAGGAGATCAGAGGGAAAGAGG - Intronic
950883721 3:16344928-16344950 ACAGATGAAGAGAGGGCAAATGG - Intronic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
952796426 3:37243259-37243281 GCAGGTGAACTGTGCGCCAAGGG - Exonic
953017115 3:39088138-39088160 GCAGGAGAACCGAGTGCAGAAGG + Exonic
953463174 3:43097490-43097512 GCAGGTGAGCAAGGGGGAAAGGG + Intronic
953542636 3:43835712-43835734 GCTGGTGGACAGAGAACAAAAGG + Intergenic
953572733 3:44084394-44084416 GCAGAAGAACAGAGGTTAAAAGG + Intergenic
953797718 3:45997996-45998018 GCAGGTGAAAGGAGGGCAGAAGG + Intergenic
953847998 3:46444116-46444138 GAAGGAGAAGAAAGGGCAAAAGG - Intronic
954495099 3:50950756-50950778 GCAGGTGCTCACAGGGCAAGTGG + Intronic
955704324 3:61712578-61712600 GCAGGAGAAGAGAGAGCACAGGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
957199839 3:77119100-77119122 GCAGGAGAAGAGAGAGCAAGGGG - Intronic
958073370 3:88643223-88643245 GCAGGTGATCAGAGGGTGAGAGG - Intergenic
960434636 3:117610653-117610675 GCATATTAACATAGGGCAAAAGG + Intergenic
960925519 3:122792277-122792299 GCAGGTACAAAGAGGGCAAAAGG + Intronic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
961703295 3:128764060-128764082 GCAGGACTACAGAGGTCAAAAGG + Intronic
961707782 3:128802410-128802432 GCACAGGAACAGAGGGCACAGGG + Intronic
962274456 3:134001553-134001575 GAAGGCAAACAGAGGGGAAAGGG - Intronic
962492202 3:135905301-135905323 GCAGCTTTACAGAGGGCACAAGG + Intergenic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
964029421 3:152119501-152119523 GAAGGTCGACAGAAGGCAAATGG - Intergenic
964073585 3:152665545-152665567 GAAGGTGATGAGAGGGTAAATGG + Intergenic
964439056 3:156685904-156685926 CAAGGTGTAGAGAGGGCAAATGG + Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965162643 3:165154255-165154277 GGAAGTGAACAAAAGGCAAAAGG + Intergenic
967153072 3:186667405-186667427 GTAGGAGAACAAAGGGCAGAAGG + Intronic
967451257 3:189625924-189625946 GCAAGGGAACAGAGGCCAATTGG - Intergenic
967856155 3:194119066-194119088 GCAGGTGTTCAGAGGGCTAGTGG + Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
973010864 4:45070690-45070712 GCAGCAGAAGAGAGAGCAAAGGG - Intergenic
974102627 4:57434585-57434607 GCAGGTGTACAAAGAGGAAAGGG + Intergenic
974520829 4:62977911-62977933 GAAGGGAAACAGAGGTCAAAGGG - Intergenic
974727869 4:65819114-65819136 GAAGGAGAACAAAGGGAAAAAGG + Intergenic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
979700884 4:123666647-123666669 GGAGGTGAACAGCAGGCAAGGGG - Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
981964973 4:150589510-150589532 GCTAATGTACAGAGGGCAAAAGG - Intronic
982581886 4:157189135-157189157 GAAGGTGAAGAGAGAACAAAAGG + Intergenic
984595931 4:181667883-181667905 GAAAGTGAACAGAGGACAAGTGG - Intergenic
987736216 5:21846946-21846968 GCAGATGAACAATGGGTAAATGG + Intronic
989349040 5:40463570-40463592 GCAGGGGATCACAGGGCAATGGG - Intergenic
989365497 5:40651383-40651405 TCAGGTGAAAAGAGGGCAGGAGG - Intergenic
990890042 5:60637962-60637984 GCAAGTGAAAAGAAGGGAAAGGG + Intronic
991705376 5:69353234-69353256 GCTGGGGAACTGAGGGTAAATGG + Intronic
992623449 5:78616042-78616064 GGAGAAGAACAGAGGGCAGAAGG - Intronic
992705073 5:79382207-79382229 GGAGGTGAAGAGAGAGCAAAAGG + Intronic
995783237 5:115800266-115800288 GCCAGTGAACAGAGTGGAAATGG + Intergenic
996088332 5:119326434-119326456 GCAGGTGAGCAGAGGCCCAGAGG + Intronic
996249555 5:121312225-121312247 GGAGGTGAACATATAGCAAAGGG - Intergenic
997655238 5:135549527-135549549 GCTGGAGCTCAGAGGGCAAAGGG - Intergenic
997796620 5:136817235-136817257 GCAGGAGACCAGATGACAAAAGG - Intergenic
998532072 5:142894611-142894633 TCAGGTGGACAGAGTGGAAATGG + Intronic
1001056426 5:168453908-168453930 GCAGGTGAACAGAGGCAGAGCGG + Intronic
1001137248 5:169112744-169112766 GCAGGAGATCAGAGGGCAAGAGG + Intronic
1001816446 5:174673219-174673241 GGAGGGGGGCAGAGGGCAAATGG - Intergenic
1002041878 5:176520665-176520687 GCAGGTGATAAAAGGGCAAAAGG + Intergenic
1003994511 6:11525489-11525511 GAAGGTGGGCAAAGGGCAAAAGG + Intergenic
1004343582 6:14828472-14828494 GCAAGTTAAGAGAGAGCAAATGG + Intergenic
1005669702 6:28092769-28092791 GCCGGAGAACAGAGAGGAAATGG + Intergenic
1005995022 6:30925716-30925738 GCAGGTGACCAGAGGGGATGGGG + Exonic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1007673866 6:43579169-43579191 GCAGGTGAAAGGAGGGCAGAAGG - Intronic
1007781916 6:44259254-44259276 TCAGGTCATCAAAGGGCAAAAGG + Exonic
1007837382 6:44684154-44684176 GAAGGGGAACAGACGCCAAAGGG + Intergenic
1008587851 6:52965358-52965380 GCAGGTGGAGAGGGGTCAAATGG - Intergenic
1010590252 6:77703937-77703959 GTAGTTGAAGAGAGTGCAAATGG + Intronic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1014259061 6:119195293-119195315 GCAAGTGAGCAGAGAGCAAGTGG - Intronic
1014915310 6:127139778-127139800 GGAGGTGAATAGAGGACAAGAGG - Intronic
1017975848 6:159356684-159356706 GCAGTGGGTCAGAGGGCAAAGGG - Intergenic
1018001235 6:159580492-159580514 GCAAGTGGACAGAGGGCGATGGG + Intergenic
1018775877 6:167015358-167015380 GCAGGGGAACAAAGAGCTAAGGG - Intronic
1018842766 6:167530291-167530313 GAAGGATGACAGAGGGCAAAAGG - Intergenic
1019285056 7:219225-219247 GCAGGTGAACAGGTGGAGAATGG + Intronic
1019528967 7:1494302-1494324 GAAGGTGAACAGAGCGCCCAGGG + Intronic
1019660172 7:2219697-2219719 GCAGGGGAGCAGAGGGCCAGGGG + Intronic
1019699985 7:2470140-2470162 GCAGGCGGACACAGGGCAATAGG - Intergenic
1021502624 7:21347138-21347160 GCTGGTGTACATAGGGCATAGGG + Intergenic
1022021017 7:26399119-26399141 GGAGGTGAAGGGAGGGCAAGGGG - Intergenic
1024317030 7:48030136-48030158 GCAGTTGAACGGAAAGCAAAAGG - Intergenic
1024691874 7:51811490-51811512 ACAGGTGAAAAGAGAGAAAATGG - Intergenic
1026617346 7:71917246-71917268 GCAGGTTGCCAGAGGTCAAAGGG + Intronic
1028224030 7:88228815-88228837 GAAGGTGAAGAGAGGACCAAAGG + Intergenic
1028450633 7:90978099-90978121 CCAGGTACAGAGAGGGCAAAGGG + Intronic
1028504114 7:91552780-91552802 GCAGGTGAACAAAGGACCATGGG - Intergenic
1028964999 7:96792215-96792237 GTAGGTGGGAAGAGGGCAAAGGG + Intergenic
1031734451 7:125340239-125340261 GCAGGAGAACAGAGGGAACCCGG + Intergenic
1032691068 7:134287197-134287219 GCAGGGACACACAGGGCAAAGGG + Intergenic
1033227102 7:139570997-139571019 AAAGGTGCAAAGAGGGCAAAGGG + Exonic
1034156370 7:148959149-148959171 GCAGGCGAAAGGAGGGCAGAAGG - Intergenic
1034916471 7:155044053-155044075 GCATGTGAACTGAGGCAAAATGG + Intergenic
1035088160 7:156279130-156279152 GCAGGAGATCAGAGGGCAAGAGG - Intergenic
1035702415 8:1646795-1646817 GAAGGGGGCCAGAGGGCAAACGG + Intronic
1036206449 8:6809033-6809055 AGAGGTCACCAGAGGGCAAAGGG + Exonic
1036466689 8:9004139-9004161 GGAAGTGCACACAGGGCAAAAGG - Intronic
1037794285 8:21978841-21978863 GCAGGAGATTAGAGGGCAGAGGG - Intronic
1037863053 8:22419905-22419927 GGAGGTGAGGAGAGGGCAAGAGG - Exonic
1038484384 8:27923276-27923298 GCACGTGAGCAGAAGGGAAAGGG - Intronic
1040407033 8:47115543-47115565 GCAGCTGAACACAGGGCACCAGG + Intergenic
1042339521 8:67664492-67664514 GCAGGTGCACAGTGGGCTAGAGG - Intronic
1042667587 8:71223236-71223258 GAAGCTGAAAAGAGGGCAGATGG + Intronic
1044711679 8:95064683-95064705 GCAGGTGAAGGGAGAGCAGAAGG - Intronic
1044760958 8:95517004-95517026 TCATGTGAAGAGAGGGCATAAGG - Intergenic
1045318369 8:101062831-101062853 ACAGGCGGACAGAGGCCAAAAGG + Intergenic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1046345081 8:112913398-112913420 GGAGGTGAACAGCGGGCAAGTGG - Intronic
1046526168 8:115384683-115384705 GAAGGAGAAGAGAGGGCAAAGGG - Intergenic
1046695266 8:117332830-117332852 GCAGGTGATTAGGTGGCAAAGGG + Intergenic
1047424990 8:124736938-124736960 GCAGGGGAACAGAGGGGCAGGGG + Intergenic
1047523661 8:125614936-125614958 GCAGGAGACCAAAGGGCAAAGGG + Intergenic
1047855792 8:128910166-128910188 GAAGGGTAACAGAGGGTAAAAGG + Intergenic
1048342411 8:133550490-133550512 GCAGCTGGACAGTGGGCAGAGGG + Intronic
1049064058 8:140299086-140299108 GCATTTGAACAGAGACCAAAAGG + Intronic
1049114298 8:140672628-140672650 GGAGGTGACCAGAGGGTGAATGG - Intronic
1049339855 8:142106279-142106301 ACAGGTGAACAGAGGGACACAGG + Intergenic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049497699 8:142944176-142944198 GCTGGAAAACAGAGGGCAGAGGG + Intergenic
1049968939 9:804350-804372 GCATGTGAAGAGAGGGAGAAGGG - Intergenic
1049979115 9:887612-887634 GGAGGTCAACAGAGGCCCAAAGG - Intronic
1050595599 9:7201480-7201502 GGAGCTAAACAGAGGGAAAATGG - Intergenic
1051991705 9:23160674-23160696 ACAGGGGAACAAAGGTCAAAGGG - Intergenic
1053250053 9:36566834-36566856 GCAGGCCCACAGAAGGCAAAGGG + Intergenic
1053478877 9:38401490-38401512 GCAGGGGACCAGAGGGATAAGGG + Intergenic
1055255147 9:74360604-74360626 ACAGGTGAAGAGAGGGCATGAGG - Intergenic
1055453325 9:76450708-76450730 CCAGGTGAAAAATGGGCAAAGGG - Intronic
1056134764 9:83621214-83621236 GCAGGAGATCACAGGGCAAGAGG + Intergenic
1056326625 9:85485229-85485251 GCTGGTTAACAGAGAGCCAATGG - Intergenic
1057882344 9:98802041-98802063 GCAGGAGATCAGAGGGCAGGAGG - Intergenic
1058559992 9:106217391-106217413 GCAGGTGAAGGGAGAGCAAATGG + Intergenic
1059091146 9:111359757-111359779 GCTGGTGAACAAATGGCAGAAGG - Intergenic
1059395605 9:114032353-114032375 GCAGGAGAGCAGATGGCAAATGG - Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1059781899 9:117538347-117538369 GCAGGTAAAGGGAGTGCAAAAGG + Intergenic
1060394339 9:123305094-123305116 GCAGAAGCACAGAGGGCAAAAGG + Intergenic
1060847312 9:126847680-126847702 GCAGGAGGAGAGAGGACAAAGGG - Intergenic
1061301090 9:129705382-129705404 GCCTGTGAACAGGAGGCAAATGG + Intronic
1061476526 9:130871073-130871095 GCAGGGGAACAGAGAGTGAATGG - Intronic
1062585828 9:137249531-137249553 GCAGGTGAAAGGAGGGCAGGAGG - Intergenic
1185655296 X:1679549-1679571 GAAGATGAACACAGAGCAAAGGG - Intergenic
1186265162 X:7824687-7824709 GCAAGTCAACAGAAGGAAAAAGG - Intergenic
1187734606 X:22290996-22291018 AAAGGTCAACAGAGGGGAAATGG - Intergenic
1188022499 X:25174082-25174104 GTAGGAGCACAGAGAGCAAAGGG - Intergenic
1188807509 X:34610271-34610293 GCAGGTGAGGAGAGTGAAAAGGG - Intergenic
1189481537 X:41395770-41395792 TCAGCTGAACAGAGGGGAAATGG + Intergenic
1192103346 X:68289051-68289073 GTATCTGAAGAGAGGGCAAAAGG - Intronic
1192496514 X:71619934-71619956 GGAGGGGAGAAGAGGGCAAAGGG - Intergenic
1192617983 X:72647709-72647731 GAAGGTGGAAAGAGGGAAAAGGG + Intronic
1193750461 X:85336585-85336607 GAAGGTGTACAAATGGCAAACGG - Intronic
1194302966 X:92209867-92209889 GCAGTTACACAGAGGGCAAGAGG - Intronic
1194910094 X:99631009-99631031 GCAGGTGCACAGAAAGCAAGAGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195111918 X:101658111-101658133 GCAGTTGCACAGAGCCCAAAAGG + Exonic
1195195755 X:102496781-102496803 GCAGGTGAACATAGTGTATATGG - Intergenic
1196998745 X:121414841-121414863 GGAGGTGAAGAGAGAGCAAAAGG - Intergenic
1197968793 X:132093571-132093593 GCAGGTGGAGAGAGGTTAAAAGG - Intronic
1199440058 X:147857701-147857723 GCAGGAGAAGACAGAGCAAAGGG + Intergenic