ID: 1160587848

View in Genome Browser
Species Human (GRCh38)
Location 18:79922722-79922744
Sequence TGACCTCTCCTTACAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160587843_1160587848 2 Left 1160587843 18:79922697-79922719 CCAAGAAGCCTGCAAGGCCCGCA 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 194
1160587844_1160587848 -6 Left 1160587844 18:79922705-79922727 CCTGCAAGGCCCGCACCTGACCT 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 194
1160587842_1160587848 6 Left 1160587842 18:79922693-79922715 CCTGCCAAGAAGCCTGCAAGGCC 0: 1
1: 0
2: 3
3: 15
4: 218
Right 1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160587848 Original CRISPR TGACCTCTCCTTACAGCAGC AGG Intronic
901773399 1:11542836-11542858 TGGCCTGTCCTTGCTGCAGCGGG + Intergenic
902294579 1:15457679-15457701 GGACAGCTCCTTACTGCAGCTGG - Intronic
902800885 1:18829307-18829329 AGCCTTTTCCTTACAGCAGCAGG + Intergenic
904001022 1:27338842-27338864 CAAGCTCTCCTGACAGCAGCAGG + Intergenic
904900603 1:33854377-33854399 TAACCTCTGCTTTCACCAGCAGG - Intronic
906243606 1:44257736-44257758 TGACAGCTCCTAACAGCACCAGG + Intronic
906289929 1:44613243-44613265 TGGCCTCTGCTTACAGGAGTGGG - Intronic
906940507 1:50251534-50251556 TTGCCTCTCCTGACAGCTGCAGG - Intergenic
907305257 1:53509587-53509609 TGGCCTCTCCTCAGGGCAGCGGG + Intronic
907308431 1:53526245-53526267 TGGCCTCTCCTTAGTCCAGCAGG - Intronic
913690389 1:121274328-121274350 TGACCTCTCCTGAGAACAGAAGG + Intronic
914147152 1:145005631-145005653 TGACCTCTCCTGAGAACAGAAGG - Intronic
917597093 1:176539885-176539907 TCACTTCTCCTTTCAGCATCAGG - Intronic
920269424 1:204752123-204752145 TGCCCGCTCCATACAGCAGGAGG - Intergenic
920477707 1:206292816-206292838 TGACCTCTCCTGAGAACAGAAGG + Intronic
920711591 1:208300609-208300631 TCACTTCTCATTAAAGCAGCAGG + Intergenic
921728096 1:218546503-218546525 TGACCTCACATGGCAGCAGCAGG + Intergenic
1063186414 10:3655936-3655958 TGTGTTCTCCATACAGCAGCTGG - Intergenic
1063805211 10:9631251-9631273 TGGCCTCTTCACACAGCAGCTGG + Intergenic
1065777241 10:29132314-29132336 TGCCTTCTCCTTTCAGCAGTGGG + Intergenic
1066431264 10:35354085-35354107 TGGCCTCTCCATAGGGCAGCTGG + Intronic
1068722796 10:60264789-60264811 TCACCTATCCTGACAGCACCAGG - Intronic
1070364731 10:75725619-75725641 TTACCTCCCCTGAAAGCAGCAGG - Intronic
1070853784 10:79589077-79589099 TGACAGCTCCTTTCAGCAGCTGG + Intergenic
1072663653 10:97379101-97379123 TGGCCTCGCCTTGGAGCAGCAGG + Intronic
1073235793 10:102014827-102014849 TGACCTCTCCTTACACCTATGGG + Intronic
1075916222 10:126169879-126169901 TGTCCCCTCCTCACACCAGCTGG + Intronic
1076732962 10:132447368-132447390 GGGCCTCTCCCTCCAGCAGCAGG + Intronic
1077056065 11:593781-593803 TGCCCTCTGCTCCCAGCAGCCGG + Intronic
1077557566 11:3233103-3233125 TGACCTGTCACTACATCAGCAGG + Intergenic
1079947352 11:26760955-26760977 TGGCCTCTCTTTAGAGCAGTGGG - Intergenic
1081596721 11:44464331-44464353 TCACCTCTCCTTCCAGCTCCTGG - Intergenic
1084471345 11:69360943-69360965 TGACGGCTCCTAACCGCAGCTGG + Intronic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1089158908 11:116423140-116423162 TGACCCCTCCTGGCAACAGCTGG + Intergenic
1090610255 11:128464897-128464919 GTGCCTCTCCTTACAGCAGAGGG - Intronic
1091188084 11:133664551-133664573 TGACATCACCTCAGAGCAGCAGG + Intergenic
1091303137 11:134520432-134520454 TGACTTTTCATTCCAGCAGCTGG + Intergenic
1093982855 12:25493942-25493964 CGTCCTCTCCTTAAGGCAGCTGG - Intronic
1097460739 12:59858714-59858736 TGCCCTGTCCAAACAGCAGCTGG - Intergenic
1101539743 12:105654072-105654094 TTAGCTCTCCTTTCAGCAGGTGG - Intergenic
1102464989 12:113124333-113124355 AGACTTCTACTTTCAGCAGCTGG - Intronic
1102736346 12:115163944-115163966 TGGCCTCTCCTATTAGCAGCTGG + Intergenic
1103305549 12:119961183-119961205 TGAGCCCTCCTGCCAGCAGCTGG + Intergenic
1104113721 12:125728450-125728472 TGACATCTTCTTCCAGCAGAAGG - Intergenic
1106303555 13:28490897-28490919 TGGCCTCTACTAACACCAGCAGG + Intronic
1107153127 13:37134952-37134974 TAACCTCTCCTTACACCAAAGGG + Intergenic
1110845293 13:80185532-80185554 TGACCTCTCCCAAAATCAGCTGG + Intergenic
1114567564 14:23643832-23643854 TGCCCTCTCCTTCAAGCACCTGG + Intronic
1118527068 14:66657459-66657481 TGGCATCTTCTTACAGCAGAAGG - Intronic
1120806684 14:88758984-88759006 TCTCCTCTCCTTCCAGCACCTGG - Intronic
1122936748 14:104962183-104962205 AGAACACTCCTGACAGCAGCCGG + Intronic
1125538948 15:40458851-40458873 TGTCCTCTCGCTCCAGCAGCAGG - Exonic
1126375815 15:47995831-47995853 CGACCCCTCCTTACTGGAGCAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1127661993 15:61108507-61108529 TGCTTTCTTCTTACAGCAGCAGG + Intronic
1127866268 15:63035771-63035793 TCACCTCTCATGACAGCATCAGG - Intergenic
1128285372 15:66432271-66432293 TGACCTGTACTTTCAGAAGCTGG - Intronic
1128339314 15:66809311-66809333 TAACCTCACCTGCCAGCAGCTGG + Intergenic
1128418232 15:67466362-67466384 TGGCCTTTCCTTACAACAGTGGG + Intronic
1130702268 15:86196535-86196557 TGAGCTCTCCTTTAAGCACCTGG + Intronic
1131094231 15:89645794-89645816 TCTCCTCTCCTGACAGCAGTGGG - Intronic
1131641300 15:94296993-94297015 TGTCCTCTCCTTGAAGGAGCTGG + Intronic
1132625946 16:891596-891618 TGACCTGTCCTGAGAGCATCTGG + Intronic
1133042258 16:3066924-3066946 TGACCCCTCCTCACAAGAGCAGG - Intronic
1133042269 16:3066964-3066986 TGACCCCTCCTCACAAGAGCAGG - Intronic
1133042280 16:3067004-3067026 TGACCCCTCCTCACAAGAGCAGG - Intronic
1133042291 16:3067044-3067066 TGACCCCTCCTCACAAGAGCAGG - Intronic
1133042302 16:3067084-3067106 TGACCCCTCCTCACAAGAGCAGG - Intronic
1135022800 16:18976977-18976999 TCAACTCTCCTGACACCAGCTGG - Intergenic
1135143377 16:19940556-19940578 GGATATGTCCTTACAGCAGCGGG - Intergenic
1135865988 16:26102398-26102420 AGACATTTCCTTACAGCAGTGGG - Intronic
1136173105 16:28499914-28499936 TGGCCTCTCCTCACAGGTGCTGG - Exonic
1136858544 16:33680749-33680771 TGCCCGCTCCTTTCAGCAGCAGG + Intergenic
1138312730 16:56041933-56041955 TCACCTCTCAGTACAGCAGAGGG + Intergenic
1140672089 16:77289260-77289282 TTACCTCTCTTTTCAGGAGCTGG + Exonic
1141863614 16:86734672-86734694 TGAGCTCTCCTCACACCCGCAGG - Intergenic
1142362953 16:89635914-89635936 TGACCTCCCCTGGCAGCTGCTGG + Exonic
1143880024 17:10022927-10022949 AGACCACTCCTTACAGGAGCTGG + Intronic
1144892475 17:18501891-18501913 TGAGCTCCACTGACAGCAGCAGG + Intergenic
1145139739 17:20442397-20442419 TGAGCTCCACTGACAGCAGCAGG - Intergenic
1146112335 17:30101216-30101238 TGTCTTCTCATTACAGCAGCAGG - Intronic
1147184548 17:38706090-38706112 TGACCTCTTCCTCCAGGAGCCGG - Intronic
1152334264 17:79691536-79691558 TGACCTGGTCGTACAGCAGCAGG - Intergenic
1153750922 18:8229441-8229463 TGCCCTCTCCAGAAAGCAGCAGG + Intronic
1155487720 18:26364953-26364975 TGTCCTCTCCTTCTAGAAGCAGG + Intronic
1156358811 18:36365775-36365797 TGTCCTCTCATCACAGAAGCTGG - Intronic
1156892768 18:42208884-42208906 TAACCTATCCTTTAAGCAGCAGG - Intergenic
1160578660 18:79871362-79871384 TGGCCTGTCCCTACAGCCGCAGG + Intronic
1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG + Intronic
1161002012 19:1915289-1915311 TGCTCTTTCCTTATAGCAGCGGG + Intronic
1163132055 19:15280479-15280501 AGACCTCTCCCTGCAGCACCTGG + Intronic
1164916823 19:32058554-32058576 TTGCCTCTCCTTACATTAGCCGG - Intergenic
925044845 2:765091-765113 TGAGCTCTCAGGACAGCAGCCGG + Intergenic
926170371 2:10549412-10549434 GGACCTGTCCTTGCAGCTGCTGG + Intergenic
926843776 2:17110885-17110907 TGACATCTTGTTATAGCAGCTGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929473844 2:42224911-42224933 TGACCTCTCCTTTCAGTCCCCGG + Intronic
933133870 2:78707197-78707219 TGGCCTTTTATTACAGCAGCAGG - Intergenic
934538816 2:95158656-95158678 TGCCCTCTCCCTGCCGCAGCAGG + Intronic
936014308 2:108946165-108946187 TGACAGCTCCTCACAGCTGCTGG - Intronic
940469230 2:154072692-154072714 TGTCTACTCCTTACAGCAACTGG + Intronic
941848822 2:170158833-170158855 TCACCTCTCATAACACCAGCTGG + Intergenic
942653321 2:178191214-178191236 TGTACTCTCACTACAGCAGCTGG - Intergenic
943506851 2:188771246-188771268 TGAACTCTCCTTACATCACCCGG - Intronic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
1169997068 20:11570501-11570523 TGTCTTCTCCTTAAAGCACCTGG - Intergenic
1170502115 20:16985115-16985137 TGACATCTCCTTCCAACAGAAGG - Intergenic
1171129871 20:22642052-22642074 TGCCTGCTCCTTACAGCAGCTGG + Intergenic
1171527920 20:25830318-25830340 TGAACTGTCCTCACAGAAGCTGG + Intronic
1171548906 20:26025562-26025584 TGAACTGTCCTCACAGAAGCTGG - Intergenic
1171962255 20:31503299-31503321 TGCCCTCTCCTGCCAGCAGAGGG - Intergenic
1173187658 20:40853461-40853483 TGACTTCTCCATTCACCAGCTGG + Intergenic
1173882140 20:46423527-46423549 TGGTCTCTCCAGACAGCAGCCGG + Intronic
1176246400 20:64099289-64099311 TGACGTCTCCTCAGGGCAGCTGG + Exonic
1178037791 21:28603994-28604016 TCACCTCTCCCTATAGCAGTTGG - Intergenic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1179829764 21:43989259-43989281 TGACCTCACTTCACAGCTGCTGG + Intergenic
1179873201 21:44254140-44254162 TGTCACCTCCTTCCAGCAGCGGG + Intronic
1180797837 22:18615732-18615754 TCACCTCTCCTTAGACAAGCTGG - Intergenic
1180901213 22:19374683-19374705 TGACCTGTCCTTGCAGTAGATGG - Intronic
1181223879 22:21379528-21379550 TCACCTCTCCTTAGACAAGCTGG + Intergenic
1181254754 22:21555289-21555311 TCACCTCTCCTTAGACAAGCTGG - Intronic
1182736972 22:32537691-32537713 TGACCTCTTCCTATAGCAGCTGG + Intronic
1184797229 22:46739236-46739258 TCACCTCTGCCTGCAGCAGCAGG - Intergenic
1184832113 22:46995463-46995485 TGACATCTCCTAACAAGAGCAGG - Intronic
1185213974 22:49588005-49588027 TGACCTCGCCTTAAAGCCGAGGG + Intronic
950449802 3:13059186-13059208 AGGGCTCTCCTTACACCAGCAGG + Intronic
950884874 3:16354374-16354396 TGACATCTCCTGAAAGCAGATGG - Intronic
951044339 3:18021610-18021632 TCACCTCTCCCTTCAGCTGCTGG - Intronic
951812460 3:26715784-26715806 TCACCTCTTCTCACAGCAGTTGG - Intergenic
951909511 3:27734970-27734992 CAACCTCTCCTTAATGCAGCTGG - Intergenic
953605542 3:44411022-44411044 TCACCTCTCCTGCCTGCAGCAGG - Intergenic
963114072 3:141710913-141710935 TGACCTCTCTTATCATCAGCTGG + Intergenic
963948410 3:151171255-151171277 TGACCTCACCTCTGAGCAGCTGG + Intronic
964918057 3:161860093-161860115 TGTCATCTCCTTTCAGGAGCTGG - Intergenic
969147540 4:5137274-5137296 AGACCTCTCCTCATGGCAGCTGG + Intronic
970014429 4:11497672-11497694 TGACCTCTACTGACAGCCGTGGG + Intergenic
970471673 4:16385505-16385527 TGACCAAACCTCACAGCAGCTGG + Intergenic
973817425 4:54631801-54631823 TGACCTACACTTCCAGCAGCTGG + Intergenic
975650269 4:76586128-76586150 GGACTTCCCCTTACATCAGCGGG + Intronic
975801051 4:78059059-78059081 TGAACTCTTCTTCCCGCAGCTGG - Intronic
975804011 4:78093653-78093675 GTACCTCTACTTACAGCAGATGG - Intronic
976144806 4:82032171-82032193 TGGTATGTCCTTACAGCAGCAGG - Intronic
977000993 4:91502590-91502612 AGACCTCTTCTAACTGCAGCAGG + Intronic
978492882 4:109327633-109327655 TGAAGTCTCCTGACAACAGCTGG - Intergenic
978857022 4:113404925-113404947 TGAGCTCTCAAGACAGCAGCTGG - Intergenic
980744829 4:137000481-137000503 TGTGCTTTCCTTACTGCAGCTGG - Intergenic
985042201 4:185902810-185902832 TCACCTCTGCTGACAGCAGTTGG + Intronic
985749337 5:1665452-1665474 TGAGCACTCCCTACAGCTGCAGG - Intergenic
986316086 5:6587358-6587380 TGACCTTCACTTACAGCAGCTGG - Intergenic
989281137 5:39644826-39644848 TGACCTCTCTATACATCTGCTGG - Intergenic
992030347 5:72714858-72714880 TGGCCATTCCTTACACCAGCAGG + Intergenic
996303958 5:122024617-122024639 TGACCTCACCTAACTGCAGCAGG + Intronic
996837146 5:127805978-127806000 TGAGCTCTCTTCACATCAGCAGG + Intergenic
997589165 5:135062434-135062456 TGGCCTCTCCCTACCCCAGCAGG - Intronic
998131967 5:139655852-139655874 TGCGCTCTGCTTAGAGCAGCGGG + Intronic
1000680090 5:164172690-164172712 TGGCCTCTTCTAACAGCAGATGG - Intergenic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1006383337 6:33714274-33714296 TGAACTCTCCTTACCTCAGCGGG - Intergenic
1007378046 6:41469663-41469685 TGACCTTTCTTTCCAGGAGCTGG + Intergenic
1015805685 6:137106138-137106160 TGGCTTCTCTTTGCAGCAGCTGG - Intergenic
1019269642 7:139795-139817 TGACCTTGACTTACTGCAGCTGG + Intergenic
1023089616 7:36605461-36605483 TGTCCTCTAGTTGCAGCAGCAGG + Intronic
1024237878 7:47411729-47411751 TGACATCTCCCTTCAGAAGCTGG + Exonic
1025023306 7:55496563-55496585 TCACCTGACCTTACAGCTGCTGG - Intronic
1025297723 7:57789565-57789587 TGAACTGTCCTCACAGAAGCTGG - Intergenic
1029257204 7:99277688-99277710 TGACCTCACCATCCAGCTGCAGG + Intergenic
1029996512 7:105013085-105013107 TGACCTCATCCTGCAGCAGCGGG - Intergenic
1034486512 7:151368135-151368157 TGAAGTCTCATTACAGCATCTGG - Intronic
1035653170 8:1284089-1284111 TGCCCTGTCCTTAGAGCAGCAGG + Intergenic
1035681581 8:1492656-1492678 TGACCCCTCCTCACAGCCGGAGG + Intergenic
1035702548 8:1647748-1647770 TGACGCTTCCTTATAGCAGCCGG - Intronic
1037705864 8:21314516-21314538 TTACATCCCCTTCCAGCAGCAGG - Intergenic
1038375388 8:27035004-27035026 TGAGCTCTCCTGAAAGCAGATGG - Intergenic
1038431173 8:27500977-27500999 TGATCTCTCCTTTCATAAGCCGG - Exonic
1043988729 8:86725682-86725704 TGACTTCTACTAACAGCAGATGG + Intronic
1046234367 8:111403251-111403273 TCACTTCTCCTGACAGAAGCAGG - Intergenic
1046687728 8:117245643-117245665 TGAGATAACCTTACAGCAGCAGG + Intergenic
1048977940 8:139683472-139683494 TGGCCTCTGCCTTCAGCAGCAGG + Intronic
1049046258 8:140154396-140154418 TGGCCTCCCCATCCAGCAGCTGG + Intronic
1049280089 8:141739886-141739908 CCACCTCTCCTTTCAGCAGTGGG - Intergenic
1049450209 8:142657098-142657120 TGCTCTCTCCTTACAGAAACTGG + Intergenic
1049734688 8:144198783-144198805 CCACCTCTCCTACCAGCAGCAGG - Intronic
1050072508 9:1830705-1830727 AGACCTCTGCACACAGCAGCTGG + Intergenic
1051492576 9:17683206-17683228 TGAATTCTCCTTGCAGCTGCAGG - Intronic
1053056822 9:34997939-34997961 TGAACACTCCTGAGAGCAGCAGG - Exonic
1053795884 9:41726466-41726488 TGAACTGTCCTCACAGAAGCTGG + Intergenic
1054149295 9:61588407-61588429 TGAACTGTCCTCACAGAAGCTGG - Intergenic
1054184291 9:61938537-61938559 TGAACTGTCCTCACAGAAGCTGG + Intergenic
1054469057 9:65519518-65519540 TGAACTGTCCTCACAGAAGCTGG - Intergenic
1054654215 9:67649958-67649980 TGAACTGTCCTCACAGAAGCTGG - Intergenic
1056487516 9:87073738-87073760 TGACCTTTCCAGACAGGAGCAGG + Intergenic
1056771690 9:89482102-89482124 TGCCTTCTTCTTAGAGCAGCTGG - Intronic
1056803622 9:89711428-89711450 TGAGCTCTGCTTCCAGGAGCTGG + Intergenic
1060206220 9:121684391-121684413 TGTCCTCTCCTCCCAGCACCTGG + Intronic
1060397576 9:123326847-123326869 TGACCTCATGTTACAGGAGCTGG - Intergenic
1060857716 9:126928102-126928124 TGAGCTCAGCTTACAGAAGCAGG + Intronic
1060965562 9:127710629-127710651 TGACCTCCTCTTTCTGCAGCCGG - Exonic
1061467702 9:130795284-130795306 TGACCTTTCCTTAATACAGCTGG + Intronic
1062437688 9:136553891-136553913 GGGCCTCTTCTTACAGCATCAGG - Intergenic
1062688015 9:137826213-137826235 TGGTCTCTCCTTCCAGCATCTGG + Intronic
1186263876 X:7810527-7810549 TGACCTCCCCTTCCAGTGGCAGG + Intergenic
1186629551 X:11334422-11334444 GGAACTCTCCTTACTGCAGTTGG + Intronic
1187450049 X:19388019-19388041 TGTCCTCTCCTTCCTGCAGCTGG + Intronic
1188190460 X:27166085-27166107 TGACATCCCCAAACAGCAGCAGG + Intergenic
1193833557 X:86316179-86316201 AGACATCTTCTTACAGCTGCAGG + Intronic
1195308864 X:103610546-103610568 TGAGCTGTCCTTACAGGAGCAGG + Intronic