ID: 1160588281

View in Genome Browser
Species Human (GRCh38)
Location 18:79925180-79925202
Sequence CCTCCCAGGTCCCTCGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160588281_1160588290 8 Left 1160588281 18:79925180-79925202 CCTATTCCGAGGGACCTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1160588290 18:79925211-79925233 CCCCCCTTTCCAAAGCAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160588281 Original CRISPR CCTCCCAGGTCCCTCGGAAT AGG (reversed) Intronic
900100706 1:960888-960910 CCTCCCCCGGCCCTCGGAAGCGG - Intronic
900349605 1:2228322-2228344 CCTCCCGGGCCCCTCGGCCTCGG + Intergenic
902582159 1:17414751-17414773 CCTCCCAAGTCGCTAGGACTTGG + Intronic
902784835 1:18726265-18726287 CCTCCAAGGACCCCTGGAATGGG + Intronic
903235030 1:21944594-21944616 CCTCCCAGGCCCCTCCCAACAGG - Intergenic
904153588 1:28463852-28463874 CCTCCCAGGTAGCTGGGACTAGG + Intronic
904627542 1:31815425-31815447 CCTCCCAGTTCCCACTGAACGGG - Intronic
906287454 1:44596702-44596724 CCAGCCAGGTCCCTTGGGATGGG - Intronic
906678611 1:47710080-47710102 CCTTCCAGGTCCCGCGGCCTCGG - Intergenic
907390258 1:54153426-54153448 CCTTTCAGCTCCCTCGGAGTGGG - Exonic
915056293 1:153134074-153134096 CCTCCCAGGGGCCTGAGAATGGG + Intergenic
920015331 1:202902874-202902896 CCTCCCAGGTAGCTGGGACTTGG - Intronic
920066943 1:203275890-203275912 CATCCCAGGTCCCCCAGACTTGG - Intergenic
1063087076 10:2829970-2829992 CATCCTAGGTCCCTCGGAGTTGG - Intergenic
1063664126 10:8051609-8051631 CCTCCCAGGTACCTGGGCCTCGG - Intergenic
1068812008 10:61266580-61266602 CCTCCCAGGAAACTGGGAATGGG + Intergenic
1068967200 10:62924562-62924584 CCTCCCTGTTCCCTTGGAGTTGG - Intergenic
1069756020 10:70774914-70774936 CCTCCCAGGTGCCTAGGCCTGGG + Intronic
1071231254 10:83588713-83588735 CCTCCCAGGTCCTGAGGATTTGG + Intergenic
1071467461 10:85954701-85954723 CCTCCCAGGTCCTTCCGAACTGG + Intronic
1071862490 10:89688539-89688561 CCTCTCAGCTTCCTCGGACTTGG - Intergenic
1073257395 10:102161853-102161875 CCTCCCTGACCCTTCGGAATGGG - Exonic
1074685621 10:115959975-115959997 TCTCCCAGGTTCCTGGGATTAGG - Intergenic
1075799895 10:125147089-125147111 CCTCCCAGGTCCCTGAGGAATGG - Intronic
1076108442 10:127843451-127843473 CCAGCAAGGTCCCTAGGAATAGG + Intergenic
1077265816 11:1649043-1649065 CCTCCGAGGTGACACGGAATCGG + Intergenic
1077339703 11:2020822-2020844 CCTCCCTGGGCCCTCGGAGAGGG + Intergenic
1079591766 11:22191715-22191737 CCTCACAGGCCCCTCTGCATTGG - Intergenic
1081930696 11:46868804-46868826 CCTCCCCTGTCCCTGGGAGTAGG - Intronic
1084422044 11:69065386-69065408 CCTTCCAGGTGCCTCAGGATGGG - Intronic
1085366441 11:75950377-75950399 CCTCCCACGTAGCTGGGAATGGG + Intronic
1087632698 11:100669479-100669501 CCTCCCAAGTACCTGGAAATAGG + Intergenic
1088986955 11:114917650-114917672 GCTCCCAGGACCCTCAGAACTGG + Intergenic
1089386851 11:118074162-118074184 CCTTCCAGGGCCCTGGGAAAGGG - Intergenic
1090439237 11:126712510-126712532 CCTCCCACATCCCTAGGAAAAGG - Intronic
1202822688 11_KI270721v1_random:76011-76033 CCTCCCTGGGCCCTCGGAGAGGG + Intergenic
1097997695 12:65907563-65907585 CCTCCTAGGTCCCTCCAAAGAGG - Intronic
1101123697 12:101609411-101609433 CCTCCCAAGTCGCTGGGACTTGG + Intronic
1102194089 12:111012035-111012057 CCTCCAATGTCCCTAGGAGTGGG - Intergenic
1104583454 12:130028759-130028781 CATCCCAGATCACTGGGAATGGG + Intergenic
1105853745 13:24358334-24358356 CCCCCCAGGGCCCTGGGAAAGGG - Intergenic
1108321926 13:49298176-49298198 CCTCCCTGTTCCCTGGGGATGGG + Intergenic
1108499447 13:51056241-51056263 CCTCCAAAGTCCATCTGAATGGG + Intergenic
1112435851 13:99390739-99390761 CCTCCCAGGGCCCTCGCCTTTGG - Intergenic
1113492535 13:110703753-110703775 CCTCCCAGGACACTGGGAAACGG - Intronic
1118739586 14:68729939-68729961 ACTCCCAGGTCCCCCGGCAAAGG + Intronic
1119431837 14:74573480-74573502 CCTCCCAGCTCCCTCGCAACAGG + Intronic
1121184244 14:91952688-91952710 CCTCCCAAGTCGCTGGGACTAGG - Intergenic
1122909425 14:104819810-104819832 CCTCCCAGGGCCCTGAGAAAGGG - Intergenic
1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG + Intronic
1124402263 15:29359532-29359554 CCTCCCAAGTAGCTGGGAATAGG + Intronic
1133305629 16:4806485-4806507 CCTCCCAAGTAGCTAGGAATAGG + Intronic
1142142625 16:88479361-88479383 CCTCCCAGGTCCCTGGTGAGTGG - Intronic
1142292676 16:89200142-89200164 TCCCCGGGGTCCCTCGGAATAGG - Intronic
1143895463 17:10132961-10132983 CCTCCCAAGCCCCTCTGACTTGG + Intronic
1146367564 17:32240941-32240963 CTTCCCAGGTCCCTTGGCTTTGG - Intronic
1146673493 17:34757721-34757743 CCTCCCAGGTCCCAGGAAACAGG + Intergenic
1149669011 17:58388489-58388511 CCTCACAGGTACATCAGAATGGG + Intronic
1149807593 17:59633638-59633660 CCTGGCAGGTCCCTCAGTATAGG + Intronic
1149991600 17:61386634-61386656 CCTCTCAGGTCCCTGAGACTAGG + Intronic
1151013682 17:70530939-70530961 CCTCCCCGGTCCCTGGCTATTGG - Intergenic
1152089676 17:78239659-78239681 TCTCCCAGGTCCTTAGGAATGGG - Intronic
1152147927 17:78580421-78580443 CCTCCCATGTCCCTCTGAGCCGG - Intergenic
1152627016 17:81392538-81392560 CCTCCCATGTCCCTGGCAGTGGG + Intergenic
1154356505 18:13625910-13625932 CCTCCCATGTCCCTTGGCCTGGG + Intronic
1158355665 18:56616008-56616030 CCTCCCAGGTAGCTGGGACTGGG - Intronic
1160588281 18:79925180-79925202 CCTCCCAGGTCCCTCGGAATAGG - Intronic
1161281376 19:3447584-3447606 CGTCCCAGATCCCTGGGCATCGG - Intronic
1162731864 19:12722969-12722991 CCTCCCAAGTACCTCTGGATGGG - Intronic
1162975542 19:14205769-14205791 CCTCCCAGGCCCCTCGCCAGTGG + Intronic
925826180 2:7850370-7850392 GCTCCCAAGCCCCTCAGAATAGG - Intergenic
926055438 2:9771432-9771454 CCTCCCGGGGCCCTGTGAATGGG + Intergenic
926149067 2:10414607-10414629 AACCCCAGGTCCCTCAGAATGGG - Intronic
926167860 2:10532687-10532709 CCTCCCCGGCCCCTCGGTCTTGG - Intergenic
927154505 2:20213708-20213730 CCCACCAGGTCCCCTGGAATGGG + Intronic
928360891 2:30661557-30661579 TCTACCAGGTCCCTGGGATTGGG - Intergenic
932592245 2:73074501-73074523 TCTCTCAGGGCCCTGGGAATGGG - Exonic
933993054 2:87647391-87647413 CCTCCCATGTCCCCTGGCATGGG + Intergenic
936300804 2:111303488-111303510 CCTCCCATGTCCCCTGGCATGGG - Intergenic
940894101 2:159063849-159063871 CCTACCAGGCCACTCAGAATAGG - Intronic
944681948 2:202085255-202085277 CCTCTCAGGTCCCAGGGATTAGG - Intronic
1170023674 20:11865026-11865048 CCTCCCAAGTAGCTAGGAATAGG - Intergenic
1174267173 20:49340356-49340378 TCTCCCAGGTCCCTCGGCACCGG - Intergenic
1177204325 21:17994429-17994451 CCACCCAAGTGCCTGGGAATTGG - Intronic
1179044294 21:37831003-37831025 CCTCCCATGTCCCTCAGGGTGGG - Intronic
1179407027 21:41134833-41134855 ACTCCCAGGTCCCGTGGAACTGG + Intergenic
1179801750 21:43814539-43814561 GCTCCCAGCTCCCTCGGCCTGGG + Intergenic
1180921109 22:19522198-19522220 CCTGCCAGGCACCTCGGAATGGG - Intergenic
1184430958 22:44441366-44441388 GCTCCCAGGCCCCTGGGACTTGG - Intergenic
1185279935 22:49965691-49965713 TCTGCCAGGGCCCTGGGAATGGG + Intergenic
952108069 3:30092145-30092167 CCACCAAGGTCTCTGGGAATCGG - Intergenic
954109293 3:48425212-48425234 CCTCCGAGAGCCCTCAGAATAGG + Intronic
954178702 3:48864661-48864683 CCCCCCAGGTCACTGTGAATTGG - Intronic
954217768 3:49133835-49133857 CCACCCAGGGCCCTGGGAACGGG + Intergenic
954323711 3:49849742-49849764 TCTCCCTGGTCCCTAGGAGTAGG - Intronic
965782998 3:172307569-172307591 CCTCCCAGGTAGCTGGGACTAGG - Intronic
970876456 4:20876540-20876562 CCTCCAAGATGCCACGGAATTGG + Intronic
971298796 4:25424962-25424984 GTTCCCAGGCCCCTAGGAATTGG + Intergenic
972624758 4:40785936-40785958 CCTCCCTGGTGCCAGGGAATAGG + Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
981148330 4:141351460-141351482 CCTCCCAAGTAGCTGGGAATAGG + Intergenic
982202958 4:152976305-152976327 ACTCTCAGGGCCCTCGGAGTGGG - Exonic
984466164 4:180101738-180101760 CCTCACACGTCCCTAGGAAAGGG - Intergenic
986841171 5:11699341-11699363 CCTCCCAGGTCCTAAGAAATAGG - Intronic
988984018 5:36599438-36599460 CCACCTACGTCCCTAGGAATAGG + Intergenic
992279175 5:75156026-75156048 CCTCCCAGGTAGCTGGGAAAAGG + Intronic
992885708 5:81157846-81157868 CCCACCAGGTCCCTCCCAATAGG + Intronic
993311069 5:86332473-86332495 CCTCCCAGGCCCCTCAAACTTGG + Intergenic
993941448 5:94063278-94063300 CCTCCTAGGGGCCTCAGAATGGG + Intronic
998758306 5:145404885-145404907 CCTCCAAGGTTTCTCTGAATTGG + Intergenic
1002826810 6:781549-781571 CCTCCCAGGTCCCTCGGGTGGGG + Intergenic
1004320001 6:14624974-14624996 CCTCCCAGGTAGCTGGGATTAGG + Intergenic
1006383705 6:33716730-33716752 CCTCCCAAGTCATTTGGAATGGG + Intergenic
1007358614 6:41339747-41339769 CCTCACAGGTACCTGGGATTAGG + Intronic
1015971575 6:138747836-138747858 TCTCTCAGGTTCCTCAGAATGGG + Intergenic
1017067929 6:150547537-150547559 CCTCCCAGCTCCCTCCCAAGGGG - Intergenic
1019724988 7:2597004-2597026 ACTCCCAGGTCCCTAGAAACAGG + Intronic
1020153457 7:5702021-5702043 CCTCCCTGATCCCTAGGAAATGG - Intronic
1033742697 7:144286533-144286555 CCTCCCAGGTCACTGGAAAATGG + Intergenic
1035714370 8:1742736-1742758 CCTCCCAAGTACCTGGGACTGGG - Intergenic
1036205848 8:6805336-6805358 CCTGCCAGGTCCCTGGGGGTTGG + Intergenic
1036653991 8:10663737-10663759 CCTCTCAGGTCCCTGAGAAAGGG - Intronic
1039377110 8:37045525-37045547 CCTCCCTGGTCCCTGGCTATTGG + Intergenic
1042810437 8:72819774-72819796 CCTCCCAAGTCACTCTGCATGGG + Intronic
1049312093 8:141938664-141938686 CATCCCAGGGCCCTGGGAGTCGG - Intergenic
1049664088 8:143835431-143835453 CCTCCCAGGTCCTTAGGATCAGG - Exonic
1051482258 9:17573747-17573769 CCTCCCAATCCCCTGGGAATTGG - Intergenic
1059716239 9:116915933-116915955 CCTCACAGTTCCCTCTGACTTGG - Intronic
1061486155 9:130921480-130921502 TCTCCCAGGGCCCCCGGAACCGG + Intronic
1061763935 9:132869644-132869666 CCTCCCAGGGCCCTCCCCATGGG + Intronic
1062522482 9:136964046-136964068 ACTCCCAGGTGCCTCTGAAGGGG - Intergenic
1062607828 9:137355924-137355946 CCTCCCAGGCCCCTCTGGACAGG - Intronic
1189372920 X:40444290-40444312 CCTCCCTGTTCCCTCAGAAAAGG + Intergenic
1190229456 X:48570867-48570889 CCTCCCAGGTAGCTGGGATTTGG + Intergenic
1194253135 X:91602837-91602859 TCTCCCAGGATCCTTGGAATGGG - Intergenic
1195588311 X:106592522-106592544 CTTCCCAGCTCCCTTGGATTTGG - Intergenic
1200162150 X:154015144-154015166 CGCCCCAGGTCCCTGGGACTCGG - Intronic
1200572073 Y:4844081-4844103 CCTCCCAGGATCCTTGGAATGGG - Intergenic
1201943043 Y:19480084-19480106 CCTCCCTGGGCCCTGGGAACAGG + Intergenic