ID: 1160589745

View in Genome Browser
Species Human (GRCh38)
Location 18:79936879-79936901
Sequence GTTTTCAGTAACCGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160589739_1160589745 -7 Left 1160589739 18:79936863-79936885 CCCCAATAAAACAAACGTTTTCA No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589740_1160589745 -8 Left 1160589740 18:79936864-79936886 CCCAATAAAACAAACGTTTTCAG No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589741_1160589745 -9 Left 1160589741 18:79936865-79936887 CCAATAAAACAAACGTTTTCAGT No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589737_1160589745 -3 Left 1160589737 18:79936859-79936881 CCACCCCCAATAAAACAAACGTT No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589735_1160589745 14 Left 1160589735 18:79936842-79936864 CCTGAGCATATAAACCTCCACCC No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589736_1160589745 0 Left 1160589736 18:79936856-79936878 CCTCCACCCCCAATAAAACAAAC No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589738_1160589745 -6 Left 1160589738 18:79936862-79936884 CCCCCAATAAAACAAACGTTTTC No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data
1160589734_1160589745 30 Left 1160589734 18:79936826-79936848 CCTGAGGATGTGCAATCCTGAGC No data
Right 1160589745 18:79936879-79936901 GTTTTCAGTAACCGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160589745 Original CRISPR GTTTTCAGTAACCGGGAGGC CGG Intronic