ID: 1160591275

View in Genome Browser
Species Human (GRCh38)
Location 18:79945882-79945904
Sequence CAGCCTCAGGTCTCTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 354}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160591275_1160591281 -8 Left 1160591275 18:79945882-79945904 CCACCCACAGAGACCTGAGGCTG 0: 1
1: 0
2: 3
3: 35
4: 354
Right 1160591281 18:79945897-79945919 TGAGGCTGAGGAGGTGACGCTGG 0: 1
1: 0
2: 4
3: 44
4: 423
1160591275_1160591283 10 Left 1160591275 18:79945882-79945904 CCACCCACAGAGACCTGAGGCTG 0: 1
1: 0
2: 3
3: 35
4: 354
Right 1160591283 18:79945915-79945937 GCTGGGCAAGCATCTAAAATAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1160591275_1160591284 22 Left 1160591275 18:79945882-79945904 CCACCCACAGAGACCTGAGGCTG 0: 1
1: 0
2: 3
3: 35
4: 354
Right 1160591284 18:79945927-79945949 TCTAAAATAGGCCAGTCCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 102
1160591275_1160591285 23 Left 1160591275 18:79945882-79945904 CCACCCACAGAGACCTGAGGCTG 0: 1
1: 0
2: 3
3: 35
4: 354
Right 1160591285 18:79945928-79945950 CTAAAATAGGCCAGTCCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1160591275_1160591282 -7 Left 1160591275 18:79945882-79945904 CCACCCACAGAGACCTGAGGCTG 0: 1
1: 0
2: 3
3: 35
4: 354
Right 1160591282 18:79945898-79945920 GAGGCTGAGGAGGTGACGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160591275 Original CRISPR CAGCCTCAGGTCTCTGTGGG TGG (reversed) Intronic
900420846 1:2555371-2555393 CAGCCACAGGAATCTGTGGCAGG - Intergenic
900518073 1:3092623-3092645 CATCCTCAGGGCTCTGTGGAGGG + Intronic
900670661 1:3852236-3852258 CAGCCTCGGGTCCCTGAGGAGGG - Intronic
901173293 1:7279834-7279856 CAGCCTCAGGTTACTGCTGGTGG + Intronic
902459738 1:16564991-16565013 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
902501601 1:16914698-16914720 CGGCCTCAGGCCTCTGTGCCCGG + Intronic
902657329 1:17878292-17878314 CAGACCCAGGTGTCTGTGTGTGG + Intergenic
903152921 1:21425592-21425614 GAGCCTGAGGTCCCTGTGTGAGG - Intergenic
903153091 1:21427146-21427168 GAGCCTGAGGTCCCTGTGTGGGG - Intergenic
903160037 1:21480834-21480856 GAGCCTGAGGTCCCTGTGTGGGG + Intronic
903160210 1:21482389-21482411 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
903858386 1:26350829-26350851 CAGAGTCAGGTCTCTTGGGGAGG - Intronic
904907988 1:33912415-33912437 CAGCCTCAGGAGTGTGTGTGGGG - Intronic
905273209 1:36800550-36800572 TGGCCTCATGTCTCTGTGTGGGG + Exonic
905303217 1:36999512-36999534 CTGCCTCAGGCCTCTGTGGGTGG - Intronic
905881168 1:41464741-41464763 CAGCCTCTTTTCTCTGTGTGTGG - Intergenic
905890270 1:41514499-41514521 CGGACTCTGGCCTCTGTGGGCGG + Intronic
906556994 1:46721849-46721871 GAGCCTGTGCTCTCTGTGGGTGG + Intergenic
907278938 1:53332389-53332411 CAGCCTAAGGTACCTGGGGGTGG - Intergenic
911155275 1:94630197-94630219 CATCCTCAGTCCTCTGTGGAAGG + Intergenic
913176469 1:116277163-116277185 CAGCCTCAAGTCTCTCTGCAGGG + Intergenic
913494273 1:119413515-119413537 CAGCCTATGGTCTATGTTGGTGG - Intergenic
913605855 1:120465168-120465190 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
913643272 1:120832780-120832802 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
913643573 1:120835422-120835444 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
913644039 1:120839537-120839559 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
913989511 1:143597714-143597736 GAGCCTGAGGTCCCTGTGTGAGG - Intergenic
914082700 1:144424048-144424070 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914177604 1:145292562-145292584 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914178149 1:145297320-145297342 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914178694 1:145302082-145302104 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914179070 1:145305251-145305273 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914179448 1:145308434-145308456 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914179992 1:145313190-145313212 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914180537 1:145317962-145317984 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914181080 1:145322724-145322746 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914181623 1:145327472-145327494 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914182168 1:145332239-145332261 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914182713 1:145336995-145337017 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914183258 1:145341745-145341767 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914184890 1:145356037-145356059 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914185435 1:145360784-145360806 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914185981 1:145365538-145365560 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914186527 1:145370298-145370320 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914187071 1:145375046-145375068 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914187614 1:145379798-145379820 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914188159 1:145384552-145384574 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914188702 1:145389302-145389324 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914210573 1:145575005-145575027 GAGCCTGAGGTCCCTGTGTGAGG - Intergenic
914269502 1:146067361-146067383 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914269857 1:146070505-146070527 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914270397 1:146075227-146075249 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914270934 1:146079963-146079985 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914271472 1:146084699-146084721 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914272007 1:146089420-146089442 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914272543 1:146094138-146094160 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914273081 1:146098860-146098882 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914273620 1:146103582-146103604 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914274158 1:146108300-146108322 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914274696 1:146113010-146113032 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914275229 1:146117728-146117750 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914275766 1:146122464-146122486 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914367061 1:146988746-146988768 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
914367597 1:146993504-146993526 GAGCCTGAGGTCCCTGTGTGAGG + Intronic
914485386 1:148104718-148104740 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914532335 1:148534042-148534064 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914532695 1:148537192-148537214 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914533230 1:148541912-148541934 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914533765 1:148546626-148546648 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914534301 1:148551334-148551356 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914534837 1:148556048-148556070 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914535372 1:148560765-148560787 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914535909 1:148565501-148565523 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914536444 1:148570223-148570245 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914536803 1:148573411-148573433 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914585349 1:149056693-149056715 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914585712 1:149059881-149059903 GAGCCTGAGGTCCCTGTGTGAGG - Intronic
914628764 1:149488810-149488832 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914629116 1:149491931-149491953 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914629298 1:149493565-149493587 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914629649 1:149496694-149496716 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914629832 1:149498322-149498344 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914630184 1:149501449-149501471 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914630366 1:149503083-149503105 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914630718 1:149506210-149506232 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914630900 1:149507844-149507866 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914631249 1:149510971-149510993 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914631431 1:149512605-149512627 GAGCCTGAAGTCTCTGTGTGAGG + Intergenic
914631781 1:149515727-149515749 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914632318 1:149520480-149520502 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914632853 1:149525237-149525259 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914633388 1:149529966-149529988 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914633924 1:149534717-149534739 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914634459 1:149539468-149539490 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914634992 1:149544205-149544227 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914635527 1:149548942-149548964 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
914636062 1:149553679-149553701 GAGCCTGAGGTCCCTGTGTGAGG + Intergenic
915835651 1:159172941-159172963 GAGCCTCAGGTCCCTGAGGAGGG + Intronic
916100138 1:161387625-161387647 CAACCTCAGGTCCCTGTGGCTGG + Intergenic
917499462 1:175573308-175573330 AAGCCGCAGGGCTCTGAGGGAGG - Intronic
919145709 1:193632139-193632161 CAGAGTCAGGTATCTGTGGGAGG + Intergenic
919920949 1:202166130-202166152 CATCCTCAGCTGTCTGTAGGTGG + Intergenic
920963310 1:210682651-210682673 CAGCTTCAAGTGTCTATGGGAGG + Exonic
921297016 1:213713581-213713603 CAGAATTAGGTCCCTGTGGGTGG + Intergenic
921445483 1:215242228-215242250 CAGCCTCCAGAGTCTGTGGGAGG - Intergenic
1065437104 10:25714166-25714188 CATCCTCTGGTGTCTGTGGGGGG - Intergenic
1067121500 10:43475797-43475819 CAGCATCATGTCTCTGTACGGGG - Exonic
1067793376 10:49303966-49303988 CAGCTTCAGACCTATGTGGGAGG + Intronic
1069593821 10:69657613-69657635 CAGCCTCACGCCTCTGAGGTAGG + Intergenic
1070284031 10:75070804-75070826 CAGCCTCTGGTCGCTGTGTCAGG + Intergenic
1070850112 10:79556665-79556687 CACTCTGAGGTCTCTGTGGCAGG - Exonic
1070854366 10:79594756-79594778 CACTCTGAGGTCTCTGTGGCAGG - Intergenic
1070857106 10:79614624-79614646 CACTCTGAGGTCTCTGTGGCAGG + Exonic
1071337079 10:84609278-84609300 CAATCTCAGGTCCCTGTGGGTGG + Intergenic
1072616303 10:97050872-97050894 AAGCCACCTGTCTCTGTGGGTGG - Intronic
1074145598 10:110714627-110714649 CAGCCTCTGGGAGCTGTGGGTGG + Intronic
1074772852 10:116744510-116744532 CACCCTCATGTCACTGTGGCTGG - Intergenic
1076107313 10:127834015-127834037 CACCCGCAGGTGTCAGTGGGAGG + Intergenic
1076587265 10:131558044-131558066 CTGCCTCAGGCCTCTGAGAGAGG + Intergenic
1076690582 10:132222104-132222126 CAGCATCAGGTGTGTGTGTGGGG - Intronic
1076873173 10:133203378-133203400 CAGCCTCACGTTTCTCTTGGAGG + Intronic
1079152166 11:17909839-17909861 CAGCCCCTTGCCTCTGTGGGAGG - Intronic
1083316188 11:61816248-61816270 GAGCCTCAGGTCTCTGGGCGGGG - Intronic
1083328251 11:61884661-61884683 GAGCCTCAGGGAACTGTGGGAGG + Intronic
1083344322 11:61978943-61978965 CAGCCTCAGCTCTCTGGCGGGGG + Intergenic
1083448828 11:62728697-62728719 AAACCGCAGGTCCCTGTGGGGGG + Exonic
1083616492 11:64028985-64029007 CAGCCCCAGGACTCTGGGAGAGG + Intronic
1085251326 11:75145772-75145794 CAGCCCCAGGTCACTGGGCGAGG + Intronic
1086178477 11:83920569-83920591 CAGCCTGAGGTATCTATTGGGGG + Intronic
1087792686 11:102423467-102423489 CAGCCTCAGTTCTCTATATGAGG - Intronic
1088843156 11:113643626-113643648 CTGCCTCAGGGCTTTGGGGGTGG - Intergenic
1095050340 12:37548445-37548467 CAGCCTCAGGTCTGCATGGACGG + Intergenic
1095921136 12:47532538-47532560 CAATCTCAGGCATCTGTGGGAGG + Intergenic
1098357782 12:69627431-69627453 CAGTCTCCTGGCTCTGTGGGAGG + Intergenic
1102584292 12:113912302-113912324 GAGACTCAGGTCTCTCTGTGGGG - Intronic
1103128539 12:118446307-118446329 GAGCCTGAGATGTCTGTGGGTGG + Intergenic
1103817599 12:123671294-123671316 CATCCTGAGGCTTCTGTGGGGGG + Exonic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1104835537 12:131787509-131787531 CAGCCTCCTGGCTGTGTGGGTGG + Intronic
1105631798 13:22176803-22176825 CTGCCTCTTGTCTCTGAGGGAGG - Intergenic
1107977733 13:45706072-45706094 TAGCAACAGGTCTCTCTGGGTGG - Intronic
1108699387 13:52930893-52930915 CAAAGTTAGGTCTCTGTGGGTGG - Intergenic
1109651810 13:65336880-65336902 CAGCCTCAGGCCTCTCTTGGGGG - Intergenic
1112966891 13:105208246-105208268 CAGCCTCAGTTTTCTGAGTGTGG + Intergenic
1113400940 13:109992727-109992749 CATCCTCCTATCTCTGTGGGAGG + Intergenic
1113759341 13:112836851-112836873 CAGCCACAGGTCAGAGTGGGAGG - Intronic
1113977147 13:114236072-114236094 TAGCCGTAGGTCACTGTGGGTGG + Intronic
1115017321 14:28633366-28633388 CAGCCACAGGACTCCCTGGGTGG + Intergenic
1115377408 14:32693180-32693202 CAGCTACAGCCCTCTGTGGGAGG - Intronic
1117237043 14:53789268-53789290 CAGCCTCAGATCTGTCTGAGAGG - Intergenic
1122440050 14:101725498-101725520 CAGCCCAAAGTGTCTGTGGGTGG + Intergenic
1122449826 14:101796715-101796737 CAGTCTCAGCTCTCTCTGGGTGG + Intronic
1122919540 14:104874386-104874408 AAGCCACAGGTCTCTGAGAGTGG - Intronic
1123056156 14:105571724-105571746 CAGCCTCAGGTCTCCCAGGAGGG + Intergenic
1123057776 14:105580081-105580103 CAGCCTCAGGTCTCCCAGGAGGG - Intergenic
1123080588 14:105691854-105691876 CAGCCTCAGGTCTCCCAGGAGGG + Intergenic
1123082058 14:105700014-105700036 CAGCCTCAGGTCTCCCAGGAGGG - Intergenic
1124641443 15:31398799-31398821 CAGCTATAGGACTCTGTGGGTGG + Intronic
1125738226 15:41943357-41943379 CAGCATCTGTTCTCTGTGGCTGG - Intronic
1127910452 15:63411876-63411898 CAAGCTCTGCTCTCTGTGGGAGG + Intergenic
1129105673 15:73305601-73305623 CAGCTTCAGGTCCCTATGAGTGG - Intergenic
1132248267 15:100314779-100314801 CAGCCTCCTGTCTTTGTGGCTGG - Intronic
1132764752 16:1528766-1528788 CGGGCTCGGGGCTCTGTGGGCGG - Intronic
1136269352 16:29139316-29139338 AGCCCTCCGGTCTCTGTGGGGGG - Intergenic
1136363899 16:29799619-29799641 CACCCTCAGGACTCTCTGGGTGG + Exonic
1136395923 16:29992489-29992511 CTGCCTGGGGTCTGTGTGGGAGG - Exonic
1136984496 16:35085882-35085904 CAGCCTGAGGTTCCTGTGAGTGG + Intergenic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1141481280 16:84308412-84308434 CAGCCTCTGCTCTCAGTGTGGGG + Intronic
1141967604 16:87457118-87457140 CAGCTCCAGGTCACTGTGTGTGG - Intronic
1142126132 16:88411566-88411588 CAGCCTCAGGTGTGTTTGGAAGG + Intergenic
1142225654 16:88876362-88876384 CAGCCTCACGCCCCTGGGGGAGG + Exonic
1142356875 16:89605490-89605512 CAGCCGGAGGGCTCCGTGGGGGG + Intergenic
1143178089 17:4967972-4967994 CAGCCTCCGGCCTCTGTCTGCGG - Intronic
1143388971 17:6549026-6549048 GAGCCTCATCTCTCTTTGGGAGG - Intronic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144872378 17:18379176-18379198 CAGCCTCAGCTCTCTGTGGATGG + Intronic
1144873586 17:18384828-18384850 CAGCCTCAGCTCTCTGTGGATGG + Intronic
1146647064 17:34582552-34582574 TAACCTCAGTTCTCTATGGGAGG + Intronic
1147402508 17:40189423-40189445 CAAGCTCAGGGCTCTGGGGGAGG + Intronic
1147758672 17:42783927-42783949 CCGCCTCAGGTACCTGGGGGAGG - Exonic
1148742182 17:49899073-49899095 CAGCAACAGGTCTCTGGGAGGGG - Intergenic
1148998693 17:51734883-51734905 CAGGCTCAGTTCTCTGGTGGAGG + Intronic
1150220889 17:63495365-63495387 CAGCCACAGCCCTCTGGGGGTGG - Intronic
1150326985 17:64265133-64265155 GAGCCTGAGATCTGTGTGGGAGG - Intergenic
1150739175 17:67765812-67765834 CAGGCACAGGTCTCTGGGGGAGG - Intergenic
1151201094 17:72468519-72468541 CTGCCTTTGGTCTCAGTGGGAGG - Intergenic
1151362133 17:73595468-73595490 CAGACTCATGGCTGTGTGGGAGG - Intronic
1151748887 17:76025846-76025868 CAGCCTCAGCAATCTGTGGATGG - Intronic
1151820702 17:76495218-76495240 CAGCCTGGGGTCTGTGTGAGAGG + Intronic
1152184030 17:78843002-78843024 CACCCTCAGGTCTGCGGGGGTGG + Intergenic
1152312308 17:79558731-79558753 CAGCCTCCGCGCACTGTGGGTGG - Intergenic
1152564983 17:81096358-81096380 CAGCCTCAGGAATGTGTGTGAGG - Intronic
1152847616 17:82611807-82611829 GGGCCGCAGGTGTCTGTGGGAGG + Intronic
1155004079 18:21712541-21712563 CAGCCTCTGGGATCTATGGGTGG + Intronic
1157540257 18:48496636-48496658 CAGCCTCCTGTCACTGGGGGAGG + Intergenic
1160246883 18:77166257-77166279 CCACGTCCGGTCTCTGTGGGAGG - Intergenic
1160408319 18:78658310-78658332 CATCCTAATGTCTCTGTGCGAGG - Intergenic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1160682603 19:418656-418678 CCGCCTCCTGTCTCTGTGGATGG - Intronic
1160754693 19:751246-751268 GAGCGTCATGTGTCTGTGGGCGG + Intronic
1160911059 19:1474022-1474044 CAGCCCCAGGTCTCTGGGTCAGG + Exonic
1161211072 19:3066009-3066031 CAGGCCTAGGTCCCTGTGGGTGG - Intergenic
1163018254 19:14469902-14469924 CAACTTCAGGTCCCTGTTGGGGG - Exonic
1163541288 19:17912363-17912385 CAGCCTCAGGCCTCAGTGTCTGG - Intergenic
1165509525 19:36257922-36257944 CAGCCTCAGGTGTGTGCGGACGG + Intergenic
1165800761 19:38548203-38548225 CAGCCCCAGGTCAGTGTGGCCGG - Intronic
1166008641 19:39925203-39925225 CCGCCTCAGGCCTCAGAGGGAGG + Intronic
1166391056 19:42409133-42409155 CTGCCTCAGGTCCCTGTGCCTGG - Intronic
1166645056 19:44525351-44525373 AGGACTCAGGTCTCTGTGGGTGG - Intronic
1166852005 19:45765633-45765655 CAGCCTCAGCACGGTGTGGGGGG + Exonic
1167410826 19:49342722-49342744 CAGTCTCCAGTCACTGTGGGTGG - Intronic
1168245649 19:55112111-55112133 CTGCCGCAGGTCTTTCTGGGAGG - Intronic
1168351854 19:55680516-55680538 CAGCCTCAGTTCCCCGGGGGAGG + Intronic
1202675982 1_KI270711v1_random:7175-7197 GAGCCTGAGGTCCCTGTGTGAGG - Intergenic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
932730999 2:74221939-74221961 CAGCCTCAGCTCCCTATAGGTGG - Intronic
933276381 2:80288748-80288770 CAGGCCCAGCTCTTTGTGGGGGG - Intronic
933973105 2:87486152-87486174 CAGACGCCGGCCTCTGTGGGCGG - Intergenic
934623704 2:95832081-95832103 CAGCCTGAGGACACTGGGGGAGG + Intergenic
935386878 2:102509213-102509235 CAGCCTCTGGAAGCTGTGGGAGG - Intronic
935840232 2:107101251-107101273 CACCCTCAGGAATCTGTGGCAGG + Intergenic
936073028 2:109384059-109384081 CACCCTTAGGTTTCTGTTGGTGG + Intronic
936160938 2:110083750-110083772 CAACCTAAGTTCTCTGAGGGTGG - Intergenic
936183725 2:110287604-110287626 CAACCTAAGTTCTCTGAGGGTGG + Intergenic
936320615 2:111464061-111464083 CAGACGCCGGCCTCTGTGGGCGG + Intergenic
937822105 2:126322110-126322132 CAGCCCCAGGTTTCTGTTAGGGG + Intergenic
938238404 2:129724277-129724299 CAGCCACAGGTTCCTGTGAGAGG + Intergenic
938639978 2:133267302-133267324 CAGCCTCAGCTCTGTCTGGGTGG + Intronic
942456277 2:176140590-176140612 CAGCCTCAGGTTTCCGGGGCTGG + Intergenic
947971990 2:234332430-234332452 CAGCCTCATGTCTCTCTGTCCGG + Intergenic
948768373 2:240234849-240234871 CAGACACAGGCCTCTGGGGGTGG + Intergenic
949041286 2:241851081-241851103 CATCCTCAGGCCTCAGTGGCTGG + Exonic
949069239 2:242013479-242013501 CAGCTGCAGGCCTCTCTGGGGGG + Intergenic
1170861584 20:20109398-20109420 CAGCCTCAAGTACCTGTGGTGGG - Intronic
1170916412 20:20630982-20631004 GGGCCTCACGTCTCTGTGGAAGG - Intronic
1171189510 20:23149313-23149335 CAGCCCCAGGTCCCTGTGGCTGG - Intergenic
1171324166 20:24276274-24276296 CAGGCACAGGTCTCTGAGTGAGG + Intergenic
1171332815 20:24356466-24356488 GAGCCTCAGGTCTGAGGGGGTGG - Intergenic
1172174098 20:32961781-32961803 CTGCCCCAGGGCTCTGTGCGGGG - Intergenic
1172230591 20:33333260-33333282 CAGCGACAGGTGCCTGTGGGTGG - Intergenic
1173479944 20:43390537-43390559 CAGCCTCCGGCCTCTGAAGGGGG + Intergenic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1173842121 20:46164469-46164491 CGGCCTCATGTATCTGTGTGAGG + Intergenic
1173929781 20:46809098-46809120 TAGCCACAGATCTCTGTAGGGGG + Intergenic
1174713175 20:52728533-52728555 CAGACAAACGTCTCTGTGGGGGG + Intergenic
1174806537 20:53608537-53608559 CAGTCTCCGGGCCCTGTGGGAGG - Intronic
1175908109 20:62391732-62391754 CAGGCTCTGCTCTCGGTGGGGGG + Intronic
1176309468 21:5142060-5142082 CAGCCTCAGGCCTGTTGGGGAGG - Intronic
1177403238 21:20633577-20633599 CAGCCTCTGCTCTCTCTAGGAGG + Intergenic
1177827110 21:26096414-26096436 CACCCTCAGCTCTCTGAAGGAGG + Intronic
1178393054 21:32214994-32215016 CAAACTCAGGACTCTGTGAGAGG + Intergenic
1179405871 21:41125242-41125264 CAGCCTCACCTCTCTGTGCCAGG - Intergenic
1179482153 21:41685308-41685330 CAGGCTCAAGTCCCTGTGGTTGG - Intergenic
1179847592 21:44119973-44119995 CAGCCTCAGGCCTGTTGGGGAGG + Intronic
1179958346 21:44753644-44753666 CAGCCCCAGGCCACTGTGCGAGG + Intergenic
1180141307 21:45895101-45895123 CAGCCACAGGTGTCAGGGGGTGG - Intronic
1181041108 22:20193029-20193051 CTGTGTCAGGCCTCTGTGGGAGG + Intergenic
1181436820 22:22915949-22915971 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181437661 22:22919875-22919897 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181438309 22:22922930-22922952 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1181446431 22:22978829-22978851 GAGCCTCATCTCTCAGTGGGGGG - Intergenic
1181550886 22:23638586-23638608 CAGCTCCAGGCCCCTGTGGGTGG + Intergenic
1181797400 22:25320103-25320125 CAGCTCCAGGCCCCTGTGGGTGG - Intergenic
1182094903 22:27619542-27619564 CAGCCACAAATATCTGTGGGTGG + Intergenic
1183084807 22:35480268-35480290 CAGCCACAGTTCTCAGTCGGGGG - Intergenic
1183680751 22:39327914-39327936 CAGCCTCATGTCCCTGGGGCAGG + Intergenic
1183831625 22:40421135-40421157 CAGCCTCAGGCTTCTCGGGGTGG + Intronic
1184173177 22:42771485-42771507 CAGCCACAGGTGTCTCAGGGAGG - Intergenic
1184472391 22:44703000-44703022 GAGCCTCGGGGCTCAGTGGGTGG + Intronic
1185038116 22:48490051-48490073 CAGCCGCAGGTCGCGGAGGGCGG + Intronic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
954745965 3:52787754-52787776 CAGCCTGAGGTCCCTGGGGGAGG + Intronic
955147190 3:56331579-56331601 AAGCCTCAGGGCTTTCTGGGTGG - Intronic
955852659 3:63237864-63237886 TGGCCTCAGGTGTCTCTGGGAGG + Intronic
960006987 3:112790757-112790779 CAGCGTCAGGTCTGTGATGGCGG + Intronic
961501102 3:127336726-127336748 CAACCTCAGGTCTCCATGGCTGG + Intergenic
962663353 3:137627616-137627638 ATGCCTGAGGTCTCTGTGGTGGG - Intergenic
964344022 3:155738108-155738130 CAGCCTCTTCTCTCTGTGGCTGG - Intronic
964655641 3:159063464-159063486 ATGCCTTAGGTTTCTGTGGGTGG + Intronic
966639601 3:182175068-182175090 CAGCATCAGGTGTCTGTGGTGGG + Intergenic
967035772 3:185647361-185647383 CAGCCCCAGGAATCTGTGGCTGG - Intronic
968611233 4:1558082-1558104 CAGCCTCACGCCTCACTGGGAGG + Intergenic
969145636 4:5121712-5121734 AAGCCTCAGGTCCTAGTGGGTGG + Intronic
969197441 4:5574217-5574239 CAGCCTCAGGGCTCTGTATCAGG + Intronic
969522192 4:7684884-7684906 CAGGGTCAGGGCTCTCTGGGAGG - Intronic
972388105 4:38587307-38587329 TATCCTCAGGAATCTGTGGGTGG - Intergenic
972629937 4:40834081-40834103 CAGCCTCAGGCTTTTTTGGGAGG + Intronic
973757388 4:54088951-54088973 TACCCTCAGGTCTCTGTTGCTGG - Intronic
975631710 4:76410588-76410610 CAGTCTCAGGTTTCTGTGGAAGG - Intronic
978341123 4:107721677-107721699 CAGCCTCAGGTCTTGGTGATGGG - Intergenic
978341131 4:107721734-107721756 CAGCCTCAGGTCTTGGTGATGGG - Intergenic
984913956 4:184703386-184703408 CTGCCTCAGGTCTCTGTCACTGG + Intronic
985728356 5:1527281-1527303 CAGCCCCAGGGAGCTGTGGGGGG - Intergenic
987087162 5:14481531-14481553 CTTCCACAGCTCTCTGTGGGAGG - Exonic
988854658 5:35216245-35216267 CAACCTCAAGTCTCTGTTGGTGG - Intronic
996730739 5:126715221-126715243 CAGTCTCAGGAGTCTATGGGAGG + Intergenic
997236666 5:132275885-132275907 CTGCCTGAGTTCTCAGTGGGAGG + Intronic
998435989 5:142109097-142109119 CCGCCTCAGGCCTCTCTGGCCGG + Intronic
999243546 5:150140943-150140965 GAGCCTCAGGACCCTGAGGGAGG - Intronic
1001112048 5:168904741-168904763 AGGCCTCTGGTCTCTGGGGGAGG + Intronic
1001123222 5:168996968-168996990 CTGCTGCAGGTCTCTGTGAGTGG + Intronic
1001424950 5:171616852-171616874 CAGCCTCCAGTCTCTGTGCAAGG - Intergenic
1001553685 5:172622151-172622173 CAGCCTCAGATCTCAGTAGGAGG - Intergenic
1001834478 5:174820102-174820124 CTGCCTCAGGTGGGTGTGGGTGG + Intergenic
1002443769 5:179277387-179277409 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443795 5:179277459-179277481 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443943 5:179277906-179277928 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443969 5:179277976-179277998 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443980 5:179278001-179278023 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002896758 6:1384098-1384120 CAGCCTCTGGTCTCGGTTGGAGG + Intergenic
1002897428 6:1387979-1388001 CAACCTCAGGTCACTGTCTGGGG + Intergenic
1002939164 6:1700769-1700791 CAGCCTCAGGTCCCAGTGCTGGG - Intronic
1003343860 6:5246943-5246965 ACACCTCAGATCTCTGTGGGTGG - Intronic
1005963808 6:30712302-30712324 AAGCATCAGGTGTCTGTGGAGGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006423683 6:33950813-33950835 CAGCCTCAGGGCCCTGAGAGGGG + Intergenic
1006457781 6:34141883-34141905 CAGCCTCAGGTTCATCTGGGAGG + Intronic
1006554976 6:34858402-34858424 AAGCCTTAGGTCTCTGGGGAGGG - Exonic
1006582813 6:35086599-35086621 CAGCCTCGGGTCTCTCTGGTAGG - Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1007638644 6:43317620-43317642 CAGCAGCAGTTCTCTGTGGGTGG - Intronic
1008060026 6:46987129-46987151 CAGCCTCAGGTATCTTTTTGTGG - Intergenic
1013357226 6:109356737-109356759 CTGCCTCAGGTCTCTATGGAGGG + Intergenic
1014459765 6:121682510-121682532 CAGTGTAAGGTCTCTGAGGGAGG + Intergenic
1014750865 6:125254522-125254544 CAGCCTTAGGGCTCGGTGGGTGG - Intronic
1015369104 6:132430530-132430552 GAGACTCAGGTCTCAGTGGAAGG + Intergenic
1018344608 6:162887829-162887851 CAGCATCCAGTCTCTGAGGGTGG + Intronic
1018430416 6:163717437-163717459 CAGCCTGGGGACACTGTGGGGGG - Intergenic
1019103126 6:169648205-169648227 CAGTCTCATGCCGCTGTGGGTGG + Intronic
1019620265 7:1988363-1988385 GGGCCTCAGGTCCCTGTGGTGGG - Intronic
1019685571 7:2380075-2380097 CGGGCTCAGCTCTCTGTGGCCGG + Intronic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1021069929 7:16224109-16224131 TAGCCTCATGGCTTTGTGGGTGG + Intronic
1023816437 7:43954004-43954026 CAGCCAAAGGTGGCTGTGGGAGG + Exonic
1023934609 7:44730421-44730443 CAGCCTCTGGGCTGCGTGGGTGG + Intergenic
1023996203 7:45160509-45160531 CTGCCCCTGGTCTCTGTGGTTGG - Intronic
1023996760 7:45163271-45163293 AAGCCTCAGGGCTTTCTGGGTGG + Intronic
1024321162 7:48071357-48071379 CAGCCCCAGGTCTGAGTGAGTGG - Intergenic
1024630647 7:51244167-51244189 CAGCCTCAGTTCTCATTGGCAGG - Intronic
1025026070 7:55517393-55517415 CATCCACAGGTGTCTGTGGAGGG - Intronic
1026830580 7:73607610-73607632 CAGCCTCAGGCCCCTGCAGGGGG + Exonic
1028020815 7:85768679-85768701 CAGCCTCAGGCCTCTGCTGGAGG - Intergenic
1030116906 7:106068868-106068890 CAGCCTCATCTCTCTATGCGGGG + Intergenic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1034843702 7:154423361-154423383 CTGTGTCTGGTCTCTGTGGGAGG - Intronic
1034858181 7:154573454-154573476 CAGCTTCTGGTCTCAGTGGGTGG - Intronic
1034963367 7:155375746-155375768 CAGCCTCTGGTCTCGGAGGTAGG - Intergenic
1035415884 7:158685470-158685492 CAGATTCTGGTCTCTGAGGGAGG - Intronic
1036065571 8:5378048-5378070 CAGTCTCACTTCTTTGTGGGAGG + Intergenic
1037729385 8:21511105-21511127 GAGCCTCAGCTCTCAGTGGGAGG - Intergenic
1037882507 8:22579876-22579898 CAGCATCAGGAATCTGGGGGTGG + Intronic
1038428381 8:27480052-27480074 CAGCCTCAGCAGTCTGTGGCCGG - Intergenic
1039474303 8:37831413-37831435 CAGCGTCAGCTCACTGCGGGTGG - Exonic
1040331424 8:46387639-46387661 GAGCCTCAGGGCGGTGTGGGCGG + Intergenic
1041738028 8:61132231-61132253 TTGCCTGAGGTCTCTTTGGGAGG + Intronic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1048983034 8:139713389-139713411 CAGCCCCTGGTCCCTGTGAGTGG - Intergenic
1049042413 8:140122724-140122746 CTGCCTCAGGTGTCTGAGGAGGG + Intronic
1049735744 8:144203411-144203433 GAGCGTCAGCTCTCTGTGGAGGG + Intronic
1049813661 8:144587966-144587988 CAGCCTCCAGTCTCTGAAGGTGG + Intronic
1051653125 9:19350464-19350486 GTGCCTCAGGTGTATGTGGGAGG - Intronic
1051750959 9:20340582-20340604 AAGCCTCAGAACTCTGTGGTGGG + Intergenic
1052465292 9:28821999-28822021 CTGCTTCAGGTCTCTGTTGATGG - Intergenic
1053577273 9:39365209-39365231 CCACATGAGGTCTCTGTGGGAGG - Intergenic
1053841773 9:42193134-42193156 CCACATGAGGTCTCTGTGGGAGG - Intergenic
1054098844 9:60923899-60923921 CCACATGAGGTCTCTGTGGGAGG - Intergenic
1054120244 9:61199528-61199550 CCACATGAGGTCTCTGTGGGAGG - Intergenic
1054587510 9:66983034-66983056 CCACATGAGGTCTCTGTGGGAGG + Intergenic
1056436143 9:86577645-86577667 CAGCCTCAGGACCTCGTGGGTGG + Intergenic
1059777343 9:117488845-117488867 CAGCCTCTGGTCACTGGAGGAGG - Intergenic
1060198112 9:121636203-121636225 CAGCCTCAGATGTCTTTTGGGGG + Intronic
1060532589 9:124356613-124356635 AAGCCGAAGGTCTGTGTGGGAGG + Intronic
1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG + Exonic
1060550275 9:124481695-124481717 GGGCTTCAGGTCTCTGTGGGTGG - Exonic
1061873088 9:133531045-133531067 CCGCCCCTGGTCACTGTGGGTGG + Intergenic
1062151456 9:135021316-135021338 CACCCTCAAGTCTCTGGAGGTGG + Intergenic
1062278485 9:135741634-135741656 CAGCTTCTGGTCCCTGGGGGAGG - Intronic
1187960333 X:24561761-24561783 CAACATCAGGTCTCAGTGGCTGG + Intronic
1189029197 X:37432455-37432477 CAGCATCCTGTCTCTGTGGGTGG - Intronic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1193798298 X:85904165-85904187 CTTCCTCAGGTTTATGTGGGAGG - Intronic
1194972011 X:100353971-100353993 CCGTCTCAGGTCTCTTTGTGAGG + Intronic
1196183066 X:112716171-112716193 CAGACTTAGGTCTCTGAGGCTGG - Intergenic
1198006829 X:132503467-132503489 CTGCCTAAAGTCTGTGTGGGAGG - Intergenic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1199233663 X:145467567-145467589 CATCCTCAGATTTCTGAGGGTGG + Intergenic
1200060186 X:153480608-153480630 CAGCCTCAGGCTTGTCTGGGTGG - Intronic
1200068161 X:153514814-153514836 CAGCCTCAGGGCTCTGGGCTGGG + Intergenic
1200908422 Y:8509375-8509397 CAGCCTGTGTCCTCTGTGGGGGG + Intergenic