ID: 1160591542

View in Genome Browser
Species Human (GRCh38)
Location 18:79947607-79947629
Sequence AGGCTCCGGTGAGAAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160591542 Original CRISPR AGGCTCCGGTGAGAAGGGGC TGG (reversed) Intronic
900097425 1:945674-945696 GGGCTCAGGTGAGAGAGGGCAGG + Intronic
900380736 1:2382557-2382579 GTGCTCGGGTGGGAAGGGGCGGG + Intronic
901443694 1:9293777-9293799 AGGTTCCGGTGAGGACGGGACGG + Intronic
901685183 1:10939917-10939939 GAGCTCAGGTGGGAAGGGGCTGG + Intergenic
901737106 1:11319599-11319621 AGTCCTCGGAGAGAAGGGGCAGG + Intergenic
901899098 1:12342834-12342856 GGGCTCCTGTGAGAGGGAGCTGG + Intronic
902187411 1:14735629-14735651 AGGCTGCCGTGAGAAGCAGCAGG + Intronic
902290445 1:15431505-15431527 GGGCTTCGGGGAGAAGGGACGGG + Intergenic
902568387 1:17330919-17330941 AGGATGCAGTGAGGAGGGGCTGG - Intronic
902799041 1:18818169-18818191 AGGTTCTGGAGAGGAGGGGCCGG + Intergenic
903981930 1:27195020-27195042 AGGCTGTGGTCAGATGGGGCAGG - Intergenic
904275781 1:29383346-29383368 AGGCTGCTGTGAGCAGAGGCAGG + Intergenic
904684075 1:32248247-32248269 AAGCTGAGGTGAGAGGGGGCTGG + Intronic
905584327 1:39105265-39105287 AGGCGGCGGGGAGAGGGGGCGGG + Intronic
906319831 1:44808971-44808993 AGGCCCTGGTGAGAAGAGGCTGG + Intronic
907294284 1:53439606-53439628 GGGCGCCGGGGCGAAGGGGCGGG - Intergenic
907980101 1:59472412-59472434 AGGCTCCGTGGAGCAGGGGGCGG - Intronic
908111710 1:60904600-60904622 AGGCTCCTGTGTCATGGGGCTGG + Intronic
913047924 1:115089494-115089516 AGGCTCCGGCGGGGAGGGGGCGG + Intronic
915528493 1:156490277-156490299 AGGCTGCTGTGGGAGGGGGCGGG - Intronic
915562374 1:156694699-156694721 AGGCTAAGGTGGGAAGGGGTAGG + Intergenic
921068115 1:211637193-211637215 AGGAGGCAGTGAGAAGGGGCAGG + Intergenic
923195904 1:231667064-231667086 AGGCTCCTGTCTGAAGGGCCAGG - Intronic
924628456 1:245715137-245715159 ATCCACCGGAGAGAAGGGGCTGG - Intergenic
1063087802 10:2835461-2835483 TGGCTCCTGTGAGGAGTGGCTGG - Intergenic
1063410503 10:5833219-5833241 AGGCTGCAGGGAGCAGGGGCAGG + Intronic
1063422417 10:5923883-5923905 AGGCTCCTGTGAGGAGGATCTGG - Intronic
1064245037 10:13661437-13661459 AGGGGCTGGTGAGGAGGGGCAGG + Intronic
1066732636 10:38449200-38449222 AGGCCACTGTGAGAAGGAGCTGG - Intergenic
1066987001 10:42476328-42476350 AGGACCCGGTGAGAGGGCGCTGG + Intergenic
1067945478 10:50685788-50685810 AGGGTCTGGGGGGAAGGGGCTGG + Intergenic
1068296621 10:55079875-55079897 AGGCTCTGGTGGGGAGGGACTGG + Intronic
1069707250 10:70466768-70466790 ACACTCTGGGGAGAAGGGGCAGG + Intergenic
1069997772 10:72353674-72353696 AGGCTCAAGTGAGAAGGCACAGG + Intronic
1070866991 10:79712661-79712683 AGGGTCTGGGGGGAAGGGGCTGG + Exonic
1070880781 10:79850782-79850804 AGGGTCTGGGGGGAAGGGGCTGG + Exonic
1071317375 10:84415576-84415598 AGGCACCTGTGGGAAGTGGCTGG + Intronic
1071633903 10:87234884-87234906 AGGGTCTGGGGGGAAGGGGCTGG + Exonic
1071647353 10:87367101-87367123 AGGGTCTGGGGGGAAGGGGCTGG + Exonic
1072455097 10:95568521-95568543 AGGCTTTGCTGAGAGGGGGCAGG - Intergenic
1072494015 10:95936469-95936491 ATGTTCCTGTGAGAAGGGGCAGG + Intronic
1072770549 10:98134058-98134080 GAGCTCAGGTGAGAAGGGACTGG + Intergenic
1072813460 10:98481898-98481920 AGGCCACAGTGAGAAGGGCCTGG - Intronic
1074027067 10:109647351-109647373 AGGTTCTGGAGAGAAGGGGTTGG + Intergenic
1075630622 10:123998712-123998734 GGGCTGGGGTGAGCAGGGGCAGG - Intergenic
1075655338 10:124157247-124157269 AGGCGGCGGGAAGAAGGGGCTGG + Intergenic
1076417147 10:130300335-130300357 AAGCTCCAGTGAGAAGGTTCAGG + Intergenic
1077806497 11:5596094-5596116 AGACTCAGGGGGGAAGGGGCGGG - Intronic
1078891389 11:15561250-15561272 AGGCACCGGGGAGCAGGGGGCGG - Intergenic
1081620305 11:44615366-44615388 AGGCTCAGGTGAGGTGGGGCGGG + Exonic
1083686855 11:64381605-64381627 AGGCTGCTGTGAGTAGAGGCAGG + Intergenic
1084502906 11:69545454-69545476 AGGCTCAGGAGAGGAGGGGCTGG - Intergenic
1085321348 11:75576033-75576055 AGACTCCTGGAAGAAGGGGCTGG + Intergenic
1086176261 11:83894794-83894816 AGGCTGGGAAGAGAAGGGGCTGG - Intronic
1086392026 11:86375053-86375075 AAGCTCCGTGGAGAAGGGGCTGG + Exonic
1087033692 11:93733699-93733721 AGGCTACAGTGAGATGTGGCAGG + Intronic
1088138718 11:106590167-106590189 AGGCTCCAGTGAGTAGGAGCAGG - Intergenic
1089015836 11:115164491-115164513 AGGCTACAGTGGGGAGGGGCGGG + Intergenic
1089443000 11:118531758-118531780 AGGCTGCTGAGAGAAGGGGGCGG - Exonic
1090820479 11:130337429-130337451 AGGCTCCGTGGAGCAGGGGGTGG + Intergenic
1091309601 11:134563116-134563138 GTCCTCTGGTGAGAAGGGGCTGG - Intergenic
1091556050 12:1574347-1574369 AGGCTGGGGTGAGAGGAGGCTGG + Intronic
1092257879 12:6937060-6937082 AGGCACCGGTGGGAAAGGGTAGG - Exonic
1092761273 12:11813261-11813283 GGGCTGGGGTGAGGAGGGGCAGG - Intronic
1095611653 12:44135500-44135522 AGGCTCCAGTGATATGGGGAAGG - Intronic
1096103005 12:48980620-48980642 GGACTCCGGGGAGAAGGGGCGGG + Exonic
1096228116 12:49882215-49882237 AGGCTACGGTGGGAGAGGGCAGG + Intronic
1096776641 12:53968341-53968363 AGGCTCAGGAGACATGGGGCTGG - Intergenic
1096784628 12:54009880-54009902 AGGCTCCGCTGGGGCGGGGCAGG + Intronic
1100379906 12:94051756-94051778 AGGCTGAGGGGAGAAAGGGCTGG - Intergenic
1100380101 12:94053984-94054006 AGTCTCTGGAGAGAAGGGGAGGG + Intergenic
1101121193 12:101582003-101582025 AGTCCCCTGTGAGGAGGGGCAGG + Intronic
1101217302 12:102596943-102596965 AGGCACAGGTGAGAGGGTGCAGG + Intergenic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1103013105 12:117473047-117473069 AGGCTCTGGTGTATAGGGGCTGG - Intronic
1103058022 12:117836791-117836813 TGGCTACGATGAGAAGTGGCTGG - Intronic
1104930923 12:132339106-132339128 AGGCTGCGGCGAGGTGGGGCCGG + Intergenic
1105073464 12:133252808-133252830 AAGCTGAGGTGAGAAGGTGCAGG - Intergenic
1105202749 13:18194199-18194221 AGGCTCCGGGGAGGTGGAGCGGG - Intergenic
1107123452 13:36819571-36819593 AGGTACCTGTGCGAAGGGGCCGG + Exonic
1109342515 13:61079154-61079176 AGGCCATGGTGAGAAGGGGTTGG + Intergenic
1109432867 13:62258543-62258565 TGGCTCCTGTGAGATAGGGCTGG - Intergenic
1110332753 13:74291586-74291608 ATGCTCCAGTGAGAAGGGCAGGG + Intergenic
1112648704 13:101366933-101366955 GGGCTGCGGTGAGAAGGAGATGG - Intronic
1113565795 13:111318984-111319006 AGGACCCAGTGAGAAGGCGCCGG - Intronic
1113822836 13:113227340-113227362 AGGATGCAGTGAGAAGGTGCTGG - Intronic
1114267344 14:21080775-21080797 AGGTCCAGGTGAGAAGGGGCTGG + Exonic
1115547015 14:34472925-34472947 AGGCTGCCGTGAGAAGGGGAAGG + Intergenic
1115768833 14:36649112-36649134 TGGCTGGGGTGAAAAGGGGCTGG + Intergenic
1116671388 14:47846646-47846668 AGACTCAGGTGAATAGGGGCTGG + Intergenic
1119545234 14:75467272-75467294 AGGCTGGGTTGAGAAGGGGAAGG - Intronic
1119649270 14:76372159-76372181 AGGCTGGGGTGGGAAAGGGCGGG + Intronic
1122208479 14:100159974-100159996 GGGCTGCGGAGAGAACGGGCCGG - Exonic
1122374356 14:101248391-101248413 TGGCCCCGGGGAGAAGGGGAGGG - Intergenic
1122393076 14:101403587-101403609 GGGCTGCGGTGGGAAGGGGAAGG + Intergenic
1122469736 14:101958118-101958140 AGGCTGGGGTGAGGAGAGGCAGG - Intergenic
1123040445 14:105488127-105488149 AGGCCCCGGTGAGACGCTGCAGG - Intronic
1123068071 14:105628118-105628140 AGCCACAGGTGAGCAGGGGCAGG - Intergenic
1123072022 14:105646660-105646682 AGCCACAGGTGAGCAGGGGCTGG - Intergenic
1123072108 14:105646971-105646993 TGCCTCAGGTGAGCAGGGGCTGG - Intergenic
1123091662 14:105744807-105744829 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091687 14:105744886-105744908 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091712 14:105744965-105744987 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091803 14:105745281-105745303 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091933 14:105745795-105745817 AGCCACAGGTGAGCAGGGGCAGG - Intergenic
1123091991 14:105746027-105746049 AGCCTCAGGTGAGAAGGGGCAGG - Intergenic
1123092137 14:105746577-105746599 AGCCTCAGGTGAGCAGGGGCTGG - Intergenic
1123097565 14:105773705-105773727 AGCCTCAGGTGAGCAGGGGCAGG - Intergenic
1123097649 14:105774021-105774043 AGCCACAGGTGAGCAGGGGCTGG - Intergenic
1123106830 14:105845712-105845734 AGGCTCTGAGGACAAGGGGCAGG + Intergenic
1123694332 15:22866340-22866362 AGTCTCCTGTGTGAAGGGCCTGG + Exonic
1124156754 15:27232933-27232955 AGGCTGTGGTCAGGAGGGGCAGG + Intronic
1124159910 15:27258879-27258901 AGGCTGCGGAGAGAAGAGGTTGG - Intronic
1124615090 15:31235863-31235885 AAGCTCCACAGAGAAGGGGCTGG - Intergenic
1124810982 15:32937725-32937747 AGGCTTCGCTGAAAGGGGGCTGG + Intronic
1128109713 15:65068490-65068512 AGGCTTCTGGGAGAGGGGGCGGG + Intronic
1128153627 15:65378105-65378127 GGCCTCCGGGGAGAGGGGGCTGG - Intergenic
1128513403 15:68327234-68327256 AGGATCCGGCAGGAAGGGGCTGG - Intronic
1128868823 15:71136800-71136822 AGGCCCTGAGGAGAAGGGGCAGG + Intronic
1129052813 15:72796908-72796930 AGGCGCCGGCGGGAAGAGGCGGG - Intergenic
1129082183 15:73051727-73051749 CGGCTCCCGTGGGAGGGGGCCGG - Exonic
1129082305 15:73052152-73052174 CGGCTCCGGGGAGAAGGGGGAGG + Intronic
1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG + Intergenic
1131022664 15:89112476-89112498 AGGCTGTGGTGAGGTGGGGCCGG - Intronic
1131829894 15:96347506-96347528 AGGCTCCGGCGAGGAGGGGGAGG + Intergenic
1132343493 15:101092680-101092702 AGGTGCCTGAGAGAAGGGGCAGG - Intergenic
1132690011 16:1178080-1178102 AGGCCCCAGGGAGAGGGGGCAGG - Intronic
1133035382 16:3031185-3031207 AGGCACCGATGAGACTGGGCAGG + Intronic
1133058485 16:3159175-3159197 AGGCTCCAGTCAGGAGGCGCAGG - Intergenic
1133140839 16:3742873-3742895 ATGCTGCGGTGGGAGGGGGCTGG + Intronic
1133287372 16:4696907-4696929 AAGCCCCGGTGAGAAGGGAGGGG + Intronic
1135114854 16:19715825-19715847 AAGCACCTGTGAGAATGGGCTGG + Intronic
1136229457 16:28878091-28878113 AGGCTCCGGGCAGATGAGGCAGG + Intergenic
1136366615 16:29812029-29812051 AGGCGCGCGTGAGAAGGGGCAGG + Intronic
1136637160 16:31531762-31531784 AGGCTCAGGTGTGAAGGAGGGGG - Intergenic
1137369055 16:47887646-47887668 AGGCTCCTGTGAGCTAGGGCAGG + Intergenic
1138320368 16:56106143-56106165 CAGCTGCAGTGAGAAGGGGCTGG + Intergenic
1138445281 16:57059447-57059469 AGGCTGCAGAGAGAAGGGCCTGG - Exonic
1139432435 16:66918330-66918352 AGGCTATGGTGAGAAGGAGCTGG - Intronic
1139954911 16:70688456-70688478 AGGGTCTGGGGAGAAGGGGGAGG + Intronic
1140776918 16:78257415-78257437 AGGCTCCCGTGAGGCGGTGCAGG + Intronic
1141528414 16:84628630-84628652 AGCCTCCAGTGAGGAAGGGCAGG + Intergenic
1141536339 16:84683349-84683371 AGCCTCCTGGGAGAAGGGGAGGG - Intergenic
1141685083 16:85565571-85565593 AAGCTCTGGAGAGAAGGGGAAGG + Intergenic
1142354689 16:89596916-89596938 CTGCCCCGATGAGAAGGGGCAGG + Exonic
1142434492 16:90047806-90047828 GGGCCGCGGTGAGAAGGGGCGGG + Intergenic
1142434513 16:90047855-90047877 GGGCCGCGGTGAGATGGGGCGGG + Intergenic
1142434531 16:90047895-90047917 GGGCCGCGGTGAGAGGGGGCGGG + Intergenic
1142684877 17:1571973-1571995 AGGCTCTGGCGGGAAGGAGCAGG - Intronic
1142780861 17:2180182-2180204 AGCCTCTGGTGAGAAGGGAGAGG - Intronic
1143740676 17:8951403-8951425 AGGCTGGGGGGAGAAGTGGCGGG - Intronic
1144452472 17:15392417-15392439 AAGCTCCAGTGAGAAGGCGTGGG + Intergenic
1145416436 17:22717236-22717258 AGGCACCTGTGATAAGAGGCAGG - Intergenic
1148110593 17:45143031-45143053 AGGCTCCTTGGAGAAGTGGCTGG - Intronic
1148241851 17:46004369-46004391 AGGCTGTGGTGAGGTGGGGCTGG - Intronic
1150229916 17:63544177-63544199 AGGCTCTATTGAGAAGGGTCAGG + Intronic
1151494222 17:74449868-74449890 AGGCCCTGGTGAGAAGGGCAAGG - Intronic
1152106265 17:78330982-78331004 AGGCTCCACTGGGATGGGGCAGG - Intergenic
1152111011 17:78357856-78357878 TGGCTCCGGGGAGAAGGGCTTGG - Exonic
1152318805 17:79596456-79596478 AGGCTCCACTGAGAAGGGGTAGG - Intergenic
1152812848 17:82390556-82390578 AGGCTCTGGGCAGATGGGGCAGG - Intronic
1156461722 18:37325090-37325112 AGGCCTGGCTGAGAAGGGGCAGG + Intronic
1160419201 18:78732553-78732575 TGTCCCCTGTGAGAAGGGGCCGG - Intergenic
1160513087 18:79463421-79463443 AGGCTGCGGGGAGGAGAGGCCGG - Intronic
1160554400 18:79716632-79716654 ATGCTCAGGAGAGAAGGGTCAGG - Intronic
1160591521 18:79947551-79947573 GGGCTCTGGTGAGAAGGGGCGGG - Intronic
1160591542 18:79947607-79947629 AGGCTCCGGTGAGAAGGGGCTGG - Intronic
1160686315 19:438572-438594 AGGCCCCGCTGAGCAGGAGCTGG - Intronic
1161086283 19:2337098-2337120 AGGCATCTGTGAGAAGGGGGAGG - Intronic
1161741131 19:6021843-6021865 TGGCTGCTGTGAGAAGGGGCTGG + Intronic
1162179533 19:8858585-8858607 AGGATGCGGTGAGAAGGGGGTGG - Exonic
1162364189 19:10238051-10238073 AGGATCTGGTGTGAAGGGCCTGG - Intergenic
1162572293 19:11480524-11480546 AGGCTCCGCGGAGATTGGGCGGG - Intronic
1163186321 19:15641679-15641701 AGGCTCAGGTGAGAGGGGGTGGG + Intronic
1163754829 19:19100508-19100530 AGGCTAGGGTGAAAAGGAGCAGG - Intronic
1163798103 19:19348721-19348743 AGCCTCTGGTGAGAAGGGCCGGG - Intronic
1164921790 19:32093817-32093839 AGGCTGCAGAGAGGAGGGGCAGG + Intergenic
1164939326 19:32239975-32239997 AGGAGCAGGAGAGAAGGGGCAGG - Intergenic
1165064590 19:33221585-33221607 GGGCCCCGGTGAGGAGGGGCTGG + Intronic
1165075182 19:33276400-33276422 AGGCTCCAAAGAGAATGGGCTGG - Intergenic
1165309041 19:35019526-35019548 CGGCTCCGGTGAGTGGTGGCTGG + Exonic
1165385784 19:35510079-35510101 AGGCTCCGCGGAGATGGGGCTGG - Intronic
1167409373 19:49335901-49335923 AGCCTCCGGTGAGCAGTGGATGG - Intronic
1167433975 19:49468584-49468606 AGGCTACGGGGAGGAGAGGCAGG - Intronic
1167499611 19:49837685-49837707 GGGCTCCTGGGAGAAGGAGCTGG + Intronic
925295264 2:2772244-2772266 TGGCTCCGGTGAGATGGCGTAGG - Intergenic
925611297 2:5705548-5705570 AGGAGCCGGTGAGAAAGGGGTGG + Intergenic
926075644 2:9940912-9940934 GGGCTGTGGTGAGGAGGGGCAGG - Intergenic
927088403 2:19692029-19692051 AGGCTCCTGCAAGAAGGGCCTGG + Intergenic
929078256 2:38096180-38096202 AGGCTGAGCTCAGAAGGGGCGGG - Intronic
930028476 2:47044131-47044153 AGGCTCCGGTGTGGAGGGTGGGG - Intronic
930872079 2:56180830-56180852 AGGGACCAGTGAGAAGGGCCAGG + Intergenic
931893637 2:66704048-66704070 AGGCTCAGGAGAGTAGGGGCGGG - Intergenic
932283425 2:70513766-70513788 AGGTTCCAGTGGGAGGGGGCGGG - Intronic
932594709 2:73086772-73086794 GAGCTCTGGTGAGTAGGGGCGGG + Intronic
933727851 2:85436665-85436687 AGGCTAGGGTGAGGAGGGGTGGG - Intronic
933804021 2:85984896-85984918 AGGCTCCTGGGAGAAGCTGCAGG - Intergenic
934564335 2:95330116-95330138 GGGCTGGGGTGAGAAGAGGCAGG + Intronic
934623406 2:95830139-95830161 AAGCTCCTGAGAGAAGGAGCAGG - Intergenic
934735466 2:96687714-96687736 GGGCTCAGGGGGGAAGGGGCAGG + Intergenic
936607553 2:113973366-113973388 AGGCAGAAGTGAGAAGGGGCGGG + Intergenic
937230442 2:120395419-120395441 GGGATCCGGTGGGTAGGGGCGGG - Intergenic
937419597 2:121742512-121742534 AGGCTCTGGTGGGCAGGGGGTGG + Intronic
938770783 2:134499026-134499048 TGGCTTTGGTAAGAAGGGGCAGG - Intronic
939969539 2:148644560-148644582 CCGCTCCGGGGAGAGGGGGCGGG - Intronic
940019294 2:149140180-149140202 AGGCTGTGGTGGGAAAGGGCTGG + Intronic
942558859 2:177199560-177199582 TGGCTCCGGTGAGTAGCAGCAGG - Intergenic
946159328 2:217826511-217826533 AGGATCAGGTGAGAAGAGGCAGG + Intronic
946416570 2:219543125-219543147 AGGCTCCGGAAGGAAGGGGCTGG - Intronic
947363746 2:229372739-229372761 AGGCTCCTGTAGGACGGGGCAGG + Intronic
947524178 2:230868426-230868448 AGGGTGTGGGGAGAAGGGGCAGG - Intronic
947873829 2:233455263-233455285 AGGCTCGGGTGTGATGGGGGAGG - Intronic
948059749 2:235034058-235034080 AGGGTCCAGGGAGAAGGGACAGG - Intronic
948601345 2:239109083-239109105 AAGGCCTGGTGAGAAGGGGCCGG - Intronic
948654448 2:239468159-239468181 AGGCTCCGGGGAGGAGGTGGTGG + Intergenic
948865665 2:240773517-240773539 AGGCCCAGGTGAGAAGGGACAGG + Intronic
949031489 2:241799349-241799371 GGGCTCTGGGGAGCAGGGGCCGG + Intronic
1168769714 20:407812-407834 AGGCTTGGGTGAGCAGGCGCCGG + Intronic
1169393704 20:5211773-5211795 AGGCTGAGGTGAGAGGGGGTGGG - Intergenic
1169658167 20:7949361-7949383 AGGCAGCTGGGAGAAGGGGCAGG - Intergenic
1170736146 20:19015571-19015593 TGGCTCCGCTGGGGAGGGGCAGG + Intergenic
1171282213 20:23910417-23910439 GAGCTCCCGGGAGAAGGGGCAGG - Intergenic
1171519742 20:25766629-25766651 AGGCACCTGTGATAAGAGGCAGG - Intronic
1171557178 20:26089864-26089886 AGGCACCTGTGATAAGAGGCAGG + Intergenic
1172577646 20:36021654-36021676 AGGCTCAGGCAAGGAGGGGCAGG - Intronic
1172597633 20:36161082-36161104 AGGCTCCAGTGAGGAGAGGAGGG - Intronic
1173912138 20:46678215-46678237 AGGCCTTGGTAAGAAGGGGCTGG + Intronic
1174899506 20:54483958-54483980 AGGCTCCAGTGAGAGGATGCAGG + Intronic
1175927939 20:62480127-62480149 TGGCTGGGGTGAGAGGGGGCAGG + Intergenic
1175927953 20:62480160-62480182 TGGCTGGGGTGAGAGGGGGCAGG + Intergenic
1175927966 20:62480193-62480215 GGGCTGGGGTGAGAGGGGGCAGG + Intergenic
1176041343 20:63067487-63067509 ATGCTCCCGTGGGAAGGGCCCGG - Intergenic
1176653884 21:9572913-9572935 AGGCACCTGTGATAAGAGGCAGG - Intergenic
1176715204 21:10343806-10343828 AGGCTCCGGGGAGGTGGAGCGGG + Intergenic
1178609401 21:34067787-34067809 AGGATAGGGTGAGATGGGGCTGG + Intergenic
1178743559 21:35226124-35226146 TTGCTCCAGTGAGGAGGGGCTGG + Intronic
1178832684 21:36069910-36069932 AGGTTCCGGTGGGGAGGGGTAGG + Intronic
1179713830 21:43277679-43277701 AGGATCCGGTGGGGAGGGACAGG - Intergenic
1179734232 21:43383158-43383180 AGGCTCGGGGGAGGGGGGGCGGG - Intergenic
1179988548 21:44933898-44933920 CGGCTGGGGTGAGAAGGGGCTGG + Intronic
1180180849 21:46118133-46118155 AGGCCTCGGTGAGCAGCGGCGGG - Intronic
1180209581 21:46286548-46286570 CGGCTGGGGAGAGAAGGGGCTGG - Exonic
1180858741 22:19064643-19064665 AGGGTCCTGGGAGCAGGGGCAGG - Intronic
1180968334 22:19802036-19802058 AGGCTCCGCGGGGAAGGCGCTGG - Exonic
1181169462 22:21000137-21000159 AGGCTCCGGCGGGTGGGGGCAGG + Exonic
1181510423 22:23386459-23386481 AGGCTCCGACTAGAAGGGACAGG + Intergenic
1181672825 22:24433729-24433751 CCGCTCCGGTGAGCAGGGCCGGG + Exonic
1183160662 22:36110795-36110817 AGACTCCGGTGGGAAGTGGGAGG + Intergenic
1183302425 22:37064911-37064933 ATGATCCAGTGGGAAGGGGCCGG - Intergenic
1183455303 22:37919264-37919286 GGGCTCTGGTGTGAAGGGCCTGG - Intronic
1184364657 22:44042409-44042431 AGACTCCGAAGTGAAGGGGCTGG + Intronic
1184492926 22:44820569-44820591 AGCCCCCGGAGGGAAGGGGCTGG - Intronic
950011704 3:9728814-9728836 AGGAGTCTGTGAGAAGGGGCTGG - Intronic
950207576 3:11092475-11092497 AGGCTCCAGTGTCAAGGGGGTGG + Intergenic
950407700 3:12815066-12815088 TGGCTCGGGGGAGAAGGGACAGG - Intronic
953023408 3:39130367-39130389 GGGCTAGGGTGTGAAGGGGCAGG + Intronic
953663716 3:44910088-44910110 AGGCTCCTCTGAGGAGAGGCAGG + Exonic
955054450 3:55443493-55443515 AGGCTCTGGTGGGAAAGGGAAGG - Intergenic
959252478 3:103965971-103965993 AGGCTGTGGTGACAAGGGGCTGG - Intergenic
963045805 3:141101853-141101875 AGTCTCCAGTGAGCAAGGGCTGG - Intronic
965087188 3:164113936-164113958 AGGCCCCTGGGTGAAGGGGCAGG + Intergenic
967853609 3:194100192-194100214 ACGGTCCAGAGAGAAGGGGCTGG + Intergenic
967947779 3:194817876-194817898 TGGCTCTGGTGGGAAAGGGCTGG - Intergenic
968570541 4:1338195-1338217 AGGCCGGGGTGAGAAGGCGCAGG + Intronic
968727440 4:2254741-2254763 TGGCTCGGGTGAGATGGAGCCGG - Intronic
968752074 4:2395516-2395538 AGGCTGTGCTGAGCAGGGGCCGG - Intronic
968922018 4:3527246-3527268 GAGCTCTGGGGAGAAGGGGCTGG - Intronic
969101082 4:4768686-4768708 AGGGGCCGGTAACAAGGGGCCGG - Intergenic
969299970 4:6292010-6292032 AGGCATGGGTGAGACGGGGCAGG - Intronic
969299989 4:6292085-6292107 AGGCACGGGTGAGATAGGGCAGG - Intronic
973792873 4:54394681-54394703 GGACTCCGGAGAGAAGGGGATGG - Intergenic
980051880 4:128047591-128047613 AGGCGCCGGGGAGCAGGGGGCGG + Intergenic
984684615 4:182652479-182652501 AAGCTCAGGTGAGAAGGTGTAGG - Intronic
985535660 5:464579-464601 GGGCTCTGGTGAGAATGGCCGGG + Intronic
985649735 5:1101899-1101921 TAGGTCCGGTGAGCAGGGGCAGG - Intronic
985676133 5:1232202-1232224 AGGCCCCTGTGAGGAGGGGGTGG - Exonic
985745328 5:1643534-1643556 AGGCTGCGGAGAGAGGGAGCTGG + Intergenic
987063467 5:14264768-14264790 GGGCTCCGCAGAGAAGTGGCCGG + Intronic
988577911 5:32444519-32444541 AGGCTCCGGGGAGGAGGCGGCGG - Intronic
989633997 5:43515197-43515219 AGCCTCCGGAGTGGAGGGGCGGG - Intergenic
991039863 5:62163998-62164020 AGGCTCCAGGGAGAAGGACCTGG - Intergenic
997381474 5:133441196-133441218 AGGCACCTGGGAGATGGGGCAGG + Intronic
997810386 5:136962127-136962149 AGTCTCAGCTCAGAAGGGGCAGG + Intergenic
1002082107 5:176743356-176743378 GGGCTGCGGGGAGAAGGCGCGGG + Intergenic
1002894592 6:1369427-1369449 TGGCTAAGGTGAGAAGGGGGAGG + Intergenic
1004277624 6:14252543-14252565 GGGCTCCTGTGAGGAGAGGCTGG + Intergenic
1006912087 6:37570093-37570115 AGGCTCCTCTGAGCAGGAGCAGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1011381439 6:86746169-86746191 AGGCTGCGGTGAAAAGAGCCAGG - Intergenic
1014969052 6:127791785-127791807 AGGCTGAGGTGATAGGGGGCTGG + Intronic
1018818697 6:167356105-167356127 AGGAGCAGGAGAGAAGGGGCGGG + Intronic
1019110045 6:169702280-169702302 AGGCCCCGGGGAGGAGGGGTGGG - Exonic
1019267157 7:124336-124358 GTCCTCCGGTGGGAAGGGGCAGG + Intergenic
1019525049 7:1477095-1477117 TGGCTCCCGTGGGAAGGGGCGGG - Intronic
1020138414 7:5599130-5599152 AGGATAAGGTGAGCAGGGGCTGG - Intronic
1021998419 7:26201917-26201939 GGGGTCCGGCGAGAAGGGGAGGG - Intronic
1022112509 7:27240170-27240192 ATGCGCCGGTGGAAAGGGGCGGG + Intergenic
1025280231 7:57621579-57621601 AGGCACCTGTGATAAGAGGCAGG - Intergenic
1025304502 7:57843922-57843944 AGGCACCTGTGATAAGAGGCAGG + Intergenic
1026235252 7:68521464-68521486 AGGCTCTGGGGTGTAGGGGCTGG - Intergenic
1026319970 7:69259811-69259833 GGGCTACAGTGAGGAGGGGCTGG - Intergenic
1027773281 7:82433744-82433766 AGGCTCTGGTGAGAAGGGTGGGG - Intronic
1029432231 7:100538989-100539011 AGGCAGCGGCGAGAGGGGGCGGG + Intergenic
1032855255 7:135828663-135828685 AGGGTGCGGGGAGAGGGGGCAGG - Intergenic
1034413910 7:150955244-150955266 AGGCGCGGGTGAGCAGGGCCAGG + Intronic
1034694479 7:153041795-153041817 AGGCTCCCATGTGCAGGGGCTGG - Intergenic
1034983381 7:155492087-155492109 AGACTCCGGGGACAAGGGGTAGG + Intronic
1035387333 7:158482921-158482943 TGCCTCCGAGGAGAAGGGGCTGG - Intronic
1035494037 7:159306237-159306259 AAGCTGAGGTGAGAAGGTGCAGG - Intergenic
1036221040 8:6921868-6921890 GGGCTCTGGTGAGAAGGCACAGG + Intergenic
1038160964 8:25037241-25037263 AGGATAGGCTGAGAAGGGGCAGG - Intergenic
1038420521 8:27431267-27431289 GGGTTTCGGTGAGAAGGAGCTGG + Intronic
1038537474 8:28363902-28363924 GGGCTCCAGTCAGAAGTGGCAGG - Intronic
1038778208 8:30549668-30549690 AGCCTCCTGTGAGAGTGGGCTGG + Intronic
1040877811 8:52171171-52171193 AGACTCCGGGGAGAAAGAGCAGG + Intronic
1041313086 8:56536177-56536199 AGGGTCTGGTGGGATGGGGCTGG + Intergenic
1041394820 8:57379509-57379531 AGGCTTAGGTGACAAGGGGATGG + Intergenic
1042837472 8:73091569-73091591 AGGATGCTGTGAGGAGGGGCTGG + Intronic
1049257389 8:141621196-141621218 ACGCTCCTCTGAGGAGGGGCTGG + Intergenic
1049267808 8:141678541-141678563 AGGCTCCAGTGAGAATTGGCTGG - Intergenic
1049411274 8:142475047-142475069 AGGCTCTGATGAGCAGGGCCTGG + Intronic
1049454101 8:142678286-142678308 AGCGTCAGGGGAGAAGGGGCCGG + Intronic
1049755669 8:144310321-144310343 GGGTCCCGGTGAGGAGGGGCTGG - Intronic
1051989515 9:23135216-23135238 AGGCTGGGAGGAGAAGGGGCAGG - Intergenic
1052352380 9:27470738-27470760 AGGGTCAGGAGAGAAGGGGAAGG - Intronic
1054731474 9:68705782-68705804 AGGGTCTAGTGGGAAGGGGCCGG - Intronic
1055397903 9:75892669-75892691 AGGCGGCGGGGAGGAGGGGCGGG - Intronic
1060224837 9:121784363-121784385 AGGCAGCGGTGGGAGGGGGCTGG - Exonic
1060404425 9:123366170-123366192 AGGCGCGGGGCAGAAGGGGCAGG + Intronic
1061000318 9:127899086-127899108 GGGCTCCAGGGAGAAGGGGGAGG + Intronic
1061078535 9:128356220-128356242 AGGCTCCTCTGAGGAGGGGATGG + Intronic
1061931220 9:133834136-133834158 ATGCCCCGGTGGGAAGGGCCAGG + Intronic
1061935471 9:133855160-133855182 AGACTCAGGGGAGAAGAGGCCGG + Intronic
1062155472 9:135045882-135045904 AGGGTCCGGAGGGATGGGGCTGG + Intergenic
1062323287 9:136000984-136001006 AGGCCCCTGGGGGAAGGGGCAGG + Intergenic
1203631605 Un_KI270750v1:76365-76387 AGGCACCTGTGATAAGAGGCAGG - Intergenic
1192207915 X:69108322-69108344 AGGATCCTGTGTGCAGGGGCTGG - Intergenic
1194867384 X:99085871-99085893 GAGCTCCCATGAGAAGGGGCAGG + Intergenic
1195421723 X:104683033-104683055 ATGCTCTGGTAAGAAGGGACCGG + Intronic
1198048631 X:132927329-132927351 TGGCTTCTGTGTGAAGGGGCTGG - Intronic
1199559463 X:149147205-149147227 AGGTTCCTGGGGGAAGGGGCAGG + Intergenic
1199698856 X:150362278-150362300 AGGCTCTGGTGAAAATGGGAAGG + Intronic
1200951262 Y:8902145-8902167 AGCCTGCTGTGAAAAGGGGCAGG + Intergenic