ID: 1160591849

View in Genome Browser
Species Human (GRCh38)
Location 18:79949363-79949385
Sequence TGACTTAAAAACTAACAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160591849 Original CRISPR TGACTTAAAAACTAACAGGC GGG Intronic
902305390 1:15534217-15534239 TGCCTGAAACACAAACAGGCAGG - Exonic
902515803 1:16988928-16988950 TGTCTCAAAAAATAATAGGCCGG - Intronic
903880666 1:26506900-26506922 TGTGTTAAAAACAAAAAGGCAGG + Intergenic
906874312 1:49520179-49520201 GAAGTTAAATACTAACAGGCAGG - Intronic
908555078 1:65249509-65249531 TGTCTCAAAAACTCCCAGGCTGG + Intronic
909685778 1:78346791-78346813 GAACTGAAAAACTAACAGGCAGG - Intronic
909769819 1:79407553-79407575 TGAATTTAAAAATAACAGGTTGG + Intergenic
911046313 1:93631628-93631650 AGACTCAAAAACTAACAGGCAGG - Intronic
912869420 1:113290441-113290463 TGAAAAAAAAAGTAACAGGCAGG + Intergenic
913665939 1:121048963-121048985 TGACTTATATAATAGCAGGCTGG - Intergenic
914655948 1:149740771-149740793 TGACTTATATAATAGCAGGCTGG - Intergenic
914935097 1:151971820-151971842 TGACTTAAAGTTTAACAGGCAGG + Intergenic
915929895 1:160053874-160053896 TGACTGGAAAACACACAGGCAGG - Intronic
917955943 1:180098263-180098285 TTACTTAAGAACTACCATGCTGG - Intronic
918410947 1:184257246-184257268 AGACTTAAAAAGAAACAGGCCGG - Intergenic
918432219 1:184473267-184473289 TGACTTCAGAAATAACATGCTGG + Intronic
919402671 1:197139031-197139053 TTTCTTGAAAACTAACTGGCTGG + Intronic
922382269 1:225042508-225042530 TGAGTTAAAAAGTCAGAGGCAGG - Intronic
924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG + Intronic
924155040 1:241167079-241167101 TGACTGACAAACTAAAAGACAGG - Intronic
924870589 1:248039580-248039602 TGATTAAAAAAAAAACAGGCAGG - Intronic
1063006684 10:1978448-1978470 TGAGTTTAAAAATAATAGGCTGG - Intergenic
1063258483 10:4355964-4355986 TGCCTTAAACACTAACAGGAAGG + Intergenic
1064163501 10:12966372-12966394 TTACACAAAAACTAGCAGGCTGG - Intronic
1064686249 10:17865330-17865352 TGATTTAAAAAGTAACAGGATGG + Intronic
1065052331 10:21807853-21807875 TGACTTAAAAATTTACACGGAGG + Intronic
1068091324 10:52435977-52435999 TGATTTAAAAGCTAACAGTAAGG - Intergenic
1068288483 10:54970752-54970774 TGACTAAGTTACTAACAGGCAGG - Intronic
1068784765 10:60959623-60959645 TGGCAATAAAACTAACAGGCAGG + Intronic
1069489835 10:68851836-68851858 TGTCTTAAAAACAAACAGCCGGG + Intronic
1070171592 10:73937204-73937226 AGTTTTAAAAAATAACAGGCTGG - Intergenic
1071861838 10:89682206-89682228 TGACTATAAAAGAAACAGGCCGG + Intergenic
1071901089 10:90120475-90120497 TTACATAAAAATTAACAGGTGGG - Intergenic
1072409398 10:95185658-95185680 TGAATTAAAAACTTACATGTAGG + Intergenic
1073277117 10:102321860-102321882 TGTCTCAAAAACAAACAGGCTGG - Intronic
1073504706 10:103974967-103974989 TGACTTAAAAGCCAAAAGACGGG - Intronic
1079661558 11:23043148-23043170 TGACTTAAAAAAAATCAGGCTGG - Intergenic
1080345828 11:31323239-31323261 TGGCTCAAAAACAAACATGCAGG + Intronic
1080703522 11:34666600-34666622 TGACTTCAACTCTAACTGGCTGG + Intergenic
1088803201 11:113326063-113326085 TGAATGAGAAACTAACAGGTGGG - Intronic
1089761127 11:120724308-120724330 AGTATTAAAAACGAACAGGCTGG - Intronic
1089904462 11:122024275-122024297 TTACTTAATATCTTACAGGCTGG + Intergenic
1092176467 12:6411533-6411555 GGTCATAAAAACTTACAGGCAGG - Intergenic
1092515669 12:9209344-9209366 TGAAATAAAAACTAATAGGAAGG - Intergenic
1094290579 12:28843431-28843453 TAATTAAAAAAATAACAGGCTGG - Intergenic
1095342618 12:41109593-41109615 TGTCTTAAAAAGTAACAGAAAGG - Intergenic
1096207343 12:49734049-49734071 AGAAGTAAAAACTAAAAGGCAGG + Intronic
1096738356 12:53673927-53673949 TGAGTTAAAAACCTAAAGGCAGG + Intronic
1097004126 12:55902768-55902790 TGTCTCAAAAACAAACAGGCAGG - Intronic
1098079289 12:66766705-66766727 TGACTTAAAGATCAACAGTCAGG + Intronic
1098331823 12:69360894-69360916 TGCCTTAAAAATTAACGTGCAGG + Intronic
1098337105 12:69415555-69415577 TGTCTTAAAAACAAACAAACAGG + Intergenic
1098496048 12:71136724-71136746 TGATTTAAAAAATAACAGACTGG + Intronic
1098980031 12:76945894-76945916 TGACTTAAAAAAAAATAGGCCGG - Intergenic
1100997547 12:100318866-100318888 AGACTACAAAACTAACAGTCTGG - Intronic
1101371254 12:104133298-104133320 TGTATGAAAAACTACCAGGCAGG - Intronic
1101989418 12:109472506-109472528 TCACTTAAAAAAAAAAAGGCAGG + Intronic
1102450044 12:113035142-113035164 TATCTTGAAAAATAACAGGCTGG + Intergenic
1103390410 12:120568770-120568792 TCTCTTAAAAACAAACAGGCTGG - Intronic
1104194716 12:126524043-126524065 TGACCTAAAAACAGACAGACAGG - Intergenic
1105044278 12:132988541-132988563 TGACTTCAAGACTTATAGGCTGG - Intronic
1105053282 12:133074634-133074656 TGACTGAAAAGGTAATAGGCTGG - Intergenic
1105682195 13:22740259-22740281 TGACTGAAAAACTAAAAATCTGG + Intergenic
1106438170 13:29742124-29742146 TGACATAAAAAATAACCAGCTGG - Intergenic
1108172089 13:47751941-47751963 TGCTTTAAAAACCAACAGTCTGG - Intergenic
1108945049 13:56011761-56011783 TGACTTAAAAATTCACTGGGTGG + Intergenic
1110055980 13:70972559-70972581 TGACATAAAAATTAGCATGCAGG + Intergenic
1110486503 13:76051010-76051032 TGGCTTAAAAACATCCAGGCAGG - Intergenic
1111656657 13:91162331-91162353 TTACCTAAAAACTGGCAGGCAGG + Intergenic
1113697539 13:112356668-112356690 GGAATCAAAAACTAAAAGGCTGG + Intergenic
1114996450 14:28358444-28358466 TGACTTTAAAAATTCCAGGCTGG - Intergenic
1118722966 14:68607589-68607611 TGACTTAAAAACAAACAAAAGGG - Intronic
1118763129 14:68892728-68892750 TGACTTAAAAGGGAAGAGGCTGG + Intronic
1119453278 14:74731129-74731151 TGTTTTAAAAATTACCAGGCTGG - Intronic
1119838144 14:77769831-77769853 TGCCCTAAAAACTAATGGGCTGG + Intergenic
1121197582 14:92087879-92087901 TGATTTTGAAACTAAGAGGCAGG + Intronic
1123212846 14:106777493-106777515 TGACCAAAGAATTAACAGGCAGG + Intergenic
1125011994 15:34887999-34888021 AAACTTAAAAAGCAACAGGCCGG + Intronic
1126242522 15:46461537-46461559 TTACTAAATGACTAACAGGCAGG + Intergenic
1126844501 15:52746298-52746320 CTCCTTAAAAACTAACAGCCTGG + Intergenic
1126937058 15:53722329-53722351 CTACTATAAAACTAACAGGCCGG - Intronic
1127420796 15:58803810-58803832 TGCCTCAAAAAATAAGAGGCCGG + Intronic
1127751920 15:62054307-62054329 TGACTTACAAACTAGCTGGCAGG + Intronic
1128844367 15:70877067-70877089 TGCTTTAAAAACCAACAGGAAGG - Intronic
1128899436 15:71406978-71407000 TAAAGTAAAAACTGACAGGCTGG - Intronic
1129013697 15:72446580-72446602 TAATTTAAAAATTAGCAGGCAGG - Intergenic
1130776690 15:86991696-86991718 TGACATAAGTACTCACAGGCAGG - Intronic
1133265083 16:4578461-4578483 TAATTTAAAAACTAATAGGCCGG + Intronic
1133848436 16:9478954-9478976 GGACTTAAAAACTGACATTCTGG - Intergenic
1133938907 16:10292222-10292244 TGTCTTCAAAACTATCAGACAGG + Intergenic
1134438640 16:14284179-14284201 TGAGTCCAAAACTAACGGGCAGG - Intergenic
1135386250 16:22043315-22043337 TGACTAAAAGACTAAAATGCTGG - Intronic
1135749191 16:25043151-25043173 TCACATAAAAAATATCAGGCTGG - Intergenic
1137631539 16:49949553-49949575 TGCCTTAAAAAAAAAAAGGCAGG + Intergenic
1137892811 16:52180133-52180155 TGAATTCAAACGTAACAGGCTGG + Intergenic
1138837888 16:60460201-60460223 TGACTTAAAAACTGACAGTGTGG - Intergenic
1140071252 16:71652014-71652036 TGAGATAAAAACTGACAGGTGGG + Intronic
1140086205 16:71799602-71799624 TTATTAAAAAACTAATAGGCTGG + Intronic
1140828917 16:78733449-78733471 TGTCTCAAAAAATAACTGGCTGG + Intronic
1141208681 16:81956274-81956296 TGACATGAGAACTAAAAGGCAGG - Intronic
1141916757 16:87103005-87103027 TTACTTAAAAACAAATCGGCAGG + Intronic
1142730171 17:1848858-1848880 TGCCATAAAAAGGAACAGGCTGG - Intronic
1146069960 17:29671183-29671205 TAAGTTAAAAATTAGCAGGCTGG + Intronic
1146253222 17:31369162-31369184 TGACTAAAAAATTGTCAGGCTGG + Intronic
1146382695 17:32342637-32342659 CTACGTAAAAACTAAAAGGCCGG + Intronic
1146593308 17:34147601-34147623 TGACTTAAAACCATACAGACTGG - Intronic
1147616744 17:41833613-41833635 TAACTTATAAAGAAACAGGCCGG - Intronic
1148955875 17:51353302-51353324 TGACCTGTAAACTAAAAGGCTGG - Intergenic
1150563640 17:66318024-66318046 TGACTTAAAATTTAATAGGTGGG + Intronic
1151177215 17:72298589-72298611 TGACTTAAAAACTTTCCGGCTGG - Intergenic
1152585265 17:81186461-81186483 TGAATTAAAACCCAACAGGCTGG + Intergenic
1153672555 18:7426142-7426164 TTACTTAAATATTATCAGGCAGG - Intergenic
1153782385 18:8505728-8505750 GTATTTAAAAAATAACAGGCTGG + Intergenic
1155040547 18:22061955-22061977 TGATTTAAAAAAGAATAGGCTGG + Intergenic
1155208501 18:23580986-23581008 TGACTTAAACACCCACATGCAGG - Intronic
1155368501 18:25073512-25073534 TGATTTAAAAACTGACTGGCAGG + Intronic
1156299030 18:35819052-35819074 GCACTTAAAAACTTACAGGAAGG + Intergenic
1156342662 18:36224794-36224816 CTACTTAAAAACTAAGAGGAGGG - Intronic
1157807701 18:50670454-50670476 TGCCTTAAAAATTAACTAGCAGG + Intronic
1158189491 18:54810531-54810553 TGAATTAAAAAAAATCAGGCTGG + Intronic
1159158887 18:64618977-64618999 GGACTTAAAGACTAACAAGATGG - Intergenic
1159877408 18:73827754-73827776 TCACTTAAACAATATCAGGCTGG - Intergenic
1160016871 18:75150002-75150024 TGACTAAAAAATAAAGAGGCCGG - Intergenic
1160591849 18:79949363-79949385 TGACTTAAAAACTAACAGGCGGG + Intronic
1161574038 19:5046043-5046065 TCACTTGAAAACAATCAGGCAGG - Intronic
1162497207 19:11029970-11029992 TGAAATAAAAACTGGCAGGCCGG - Intronic
1163693904 19:18752932-18752954 TGACTTAAGAAAAAATAGGCTGG - Intronic
1163828487 19:19536673-19536695 TATCTTAAAAACAAACAGGCTGG + Intronic
1164083817 19:21883439-21883461 GGACGTAAAAACTAACACACGGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168367725 19:55803783-55803805 AGAATCAAAAAATAACAGGCTGG + Intronic
926859534 2:17293761-17293783 TAACATAAAAATTAACTGGCTGG + Intergenic
927458104 2:23274919-23274941 TGACTTAAAAACGACAGGGCTGG - Intergenic
927889066 2:26737086-26737108 TGGCTCAAAAGGTAACAGGCTGG - Intergenic
928062741 2:28131375-28131397 TCAATTAAAAAATAATAGGCCGG - Intronic
928875934 2:36039660-36039682 TGACTTGAAAATTTACACGCAGG - Intergenic
929201323 2:39240112-39240134 TAACTTAAAAATTAACCGCCAGG + Intergenic
929883577 2:45858742-45858764 TTACTTAAATAGTATCAGGCCGG + Intronic
932075737 2:68660727-68660749 TGACTTTAATACTAACAGCAAGG + Intergenic
932201030 2:69828978-69829000 TTACTTAAAAAGTAACAGAAGGG + Intergenic
932312797 2:70757373-70757395 TGCCTTAAAAACTAAAAGTTTGG + Intronic
933564636 2:83935052-83935074 AGGTTTAAAAACAAACAGGCCGG + Intergenic
934150095 2:89138180-89138202 TGAATTAAAAAATAACAAGGTGG - Intergenic
934217200 2:90043849-90043871 TGAATTAAAAAATAACAAGGTGG + Intergenic
934879997 2:97968417-97968439 TGAATTACACACTGACAGGCAGG - Intronic
935241942 2:101186497-101186519 AGAAGTAAAAACTAAAAGGCAGG - Intronic
935510525 2:103966815-103966837 ATACTTAAAAAATAATAGGCCGG - Intergenic
935629894 2:105204954-105204976 TTACTGAAAAACTAAAAGGATGG - Intergenic
936615665 2:114045210-114045232 TGACTTTAAATGCAACAGGCAGG + Intergenic
936679319 2:114752443-114752465 CGAATTAAAAACTGACAGACAGG + Intronic
936896584 2:117434626-117434648 TGAATGAAAAACTATCAGGATGG + Intergenic
936957076 2:118033356-118033378 GTACTTAATAAATAACAGGCAGG + Intergenic
938645503 2:133326157-133326179 TGATTGAAAAACTATAAGGCCGG + Intronic
941764984 2:169286926-169286948 TGCCTAAAGAACTAAAAGGCTGG + Intronic
942265560 2:174221382-174221404 TGACTTAAAATTTTCCAGGCTGG - Intronic
944640820 2:201723818-201723840 TAACTTAAAAAGAAAGAGGCTGG + Intronic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
946234672 2:218316565-218316587 TGCCTTAAAAACTTCCTGGCCGG - Intronic
946302699 2:218833698-218833720 TGACCTAAAAACTAACAGGCAGG - Intergenic
947919557 2:233857340-233857362 AGAAGTAAAAACTAAAAGGCAGG - Intergenic
947991559 2:234492048-234492070 TGACTTAAAGACCTGCAGGCGGG + Intergenic
948249879 2:236518703-236518725 TGGTTTAAAAAATATCAGGCAGG + Intergenic
948327807 2:237140653-237140675 TGAATTAACAACTAAAAAGCAGG + Intergenic
948561994 2:238860449-238860471 TGTCTTAAAAAGAAACAGGATGG - Intronic
948986471 2:241527761-241527783 TAATTTAAAAAATAAGAGGCTGG - Intergenic
948999411 2:241603855-241603877 CGGCTTAAAAACTAACTCGCTGG + Intronic
1169151296 20:3291636-3291658 TGAAATAAAACTTAACAGGCTGG - Intronic
1170514457 20:17114377-17114399 TGTTTTAAAAACTCACATGCTGG + Intergenic
1172374680 20:34428269-34428291 TGACTATAAAACTAAAAGGCAGG + Intronic
1175635414 20:60578741-60578763 AGAAGTAAAAACTAAAAGGCAGG + Intergenic
1177598519 21:23279779-23279801 TTACTAAACGACTAACAGGCAGG - Intergenic
1179789311 21:43747298-43747320 TGAGTTAAAAACCCACAGGCAGG - Intronic
1180364447 22:11926124-11926146 TGACTTAAAAAAAAAAAGTCTGG - Intergenic
1181123488 22:20688585-20688607 TGTCTTAAAAAAAAAAAGGCCGG - Intergenic
1181309328 22:21935699-21935721 TCTCTTAAAAACAAACAGGCTGG + Intronic
1182228495 22:28818600-28818622 TGAATTAAAAACTGAAAGGGGGG + Intergenic
1183530951 22:38353104-38353126 AGACATAAAAACAAACAGCCGGG - Intronic
1184675698 22:46041831-46041853 TGTCTTAAATACAAACAGGCAGG - Intergenic
950245788 3:11417316-11417338 TGAGGTAAAAACTAACAGTACGG - Intronic
951428321 3:22575878-22575900 TGAACTAAAAACTAACAAGCTGG + Intergenic
953144063 3:40257328-40257350 TGAATGAAAAAATAACAGGTAGG + Intronic
953918079 3:46933324-46933346 TGCCTTAAAAACAAGGAGGCCGG + Intronic
955134576 3:56203883-56203905 TTAGGAAAAAACTAACAGGCCGG + Intronic
957243133 3:77684796-77684818 GGACTTAAAAAATGAGAGGCAGG - Intergenic
960603429 3:119480542-119480564 TCACTTAAAAATAAATAGGCTGG - Intronic
961758146 3:129143208-129143230 TGTCACAAAAACTAAGAGGCTGG + Intronic
961946931 3:130701086-130701108 TCACTTGAGAACTAACAAGCAGG + Intronic
963194385 3:142510197-142510219 AGAAATAAAAACTAACAGGCTGG + Intronic
963428696 3:145167508-145167530 TGATTTAAAAAAAAATAGGCTGG + Intergenic
965827909 3:172749569-172749591 AGACTTAAATACTGACAAGCAGG + Intergenic
967184666 3:186934233-186934255 TTACTTTAAAACCAGCAGGCTGG + Intronic
967227664 3:187307300-187307322 TTACTTAAAAAGTAAGGGGCTGG - Intergenic
970837949 4:20433706-20433728 AGAGTTAAAAACTCACTGGCTGG - Intronic
972418498 4:38865840-38865862 TGAATTTAAAAATGACAGGCTGG + Intergenic
973067918 4:45820705-45820727 TGACATTAAAACTTACAGGATGG - Intergenic
976269132 4:83213113-83213135 TGTCTTAAAAACTAAGTGTCTGG - Intergenic
977325505 4:95570675-95570697 TGAGTTCAAACCTTACAGGCTGG - Intergenic
978142898 4:105337666-105337688 TGTTTTAAAAACTATCAGGCTGG - Intergenic
979693733 4:123588137-123588159 TTTATTAAAAACTCACAGGCTGG - Intergenic
980837658 4:138216724-138216746 TTACTTACAGGCTAACAGGCTGG + Intronic
981418243 4:144518763-144518785 TGACTCAAAAACTAACAATGTGG - Intergenic
981819090 4:148865740-148865762 TTACTAAAAAATCAACAGGCAGG + Intergenic
984294606 4:177838642-177838664 TTACTTCAAAACAAACTGGCCGG - Intronic
984361198 4:178735018-178735040 TTACTTTAAAACTAACAAGTCGG + Intergenic
984781921 4:183533859-183533881 CGTCTTTAAAAGTAACAGGCCGG + Intergenic
984812814 4:183809696-183809718 TGACTTAAAAAATAAAAGTCAGG - Intergenic
984949049 4:184993307-184993329 TGAGATAAAAAGTAAGAGGCTGG + Intergenic
986485853 5:8236184-8236206 AGATTTAAAAAAAAACAGGCTGG - Intergenic
988584681 5:32498144-32498166 CGTCTCAAAAACAAACAGGCTGG + Intergenic
988596673 5:32599657-32599679 TACCTTTCAAACTAACAGGCAGG - Intronic
989014619 5:36915888-36915910 TGACTTATAAGCTAACAGCTGGG - Intronic
990024658 5:51171232-51171254 GGACTTAAATAATAACAGGTCGG - Intergenic
994329522 5:98489182-98489204 TGACTTCATAGCTAGCAGGCAGG + Intergenic
995962491 5:117859517-117859539 TAACATATAAACTAACAGCCAGG - Intergenic
996065597 5:119075533-119075555 TGAAAAAGAAACTAACAGGCAGG - Intronic
996489955 5:124082537-124082559 TGACTTAAATATAAACAGTCTGG - Intergenic
996499038 5:124195992-124196014 TGACATAAATACTAATAGGATGG + Intergenic
997723687 5:136102273-136102295 TGCTATAAAAACAAACAGGCAGG + Intergenic
1000152770 5:158519486-158519508 TCACTTAAAAACCACCAGTCTGG + Intergenic
1000457417 5:161468420-161468442 TGACTGAAAACCTAACTGACAGG + Intronic
1000572220 5:162929231-162929253 TGACTTAAAAATGAATGGGCAGG - Intergenic
1002492034 5:179585277-179585299 TGACTAAAAAAGAAATAGGCCGG + Intronic
1005712910 6:28519656-28519678 TGAATTAAAACCTAACAAGCTGG - Intronic
1006324192 6:33340997-33341019 TAATTTAAAAATTAACAGGCAGG + Intergenic
1011842625 6:91520559-91520581 TGACTGAAAAACTACCAGTTGGG - Intergenic
1013029167 6:106314258-106314280 TGATTTAAAAGTAAACAGGCTGG + Intronic
1013658723 6:112272665-112272687 TAACTTAAGAAATCACAGGCCGG - Intergenic
1014901572 6:126972210-126972232 ACACTTAAGAATTAACAGGCTGG + Intergenic
1015234687 6:130957371-130957393 TGACATAAAGAACAACAGGCGGG + Intronic
1015546518 6:134367189-134367211 TGGGTTAAAAACTACCAGTCTGG - Intergenic
1016454778 6:144219139-144219161 TGAATTAAAAATTAACAGTGTGG + Intergenic
1017480461 6:154848916-154848938 TGACTTCAAAAATAATATGCAGG - Intronic
1017970497 6:159308354-159308376 TGACATAAAATCAACCAGGCAGG - Intergenic
1018623816 6:165758168-165758190 TCAATTAAAAAATACCAGGCTGG + Intronic
1019377054 7:698101-698123 GGAATTAGAAATTAACAGGCTGG + Intronic
1021581688 7:22160898-22160920 TATCTTAAAAAATAATAGGCCGG + Intronic
1021683277 7:23156362-23156384 TGATTTAAAAACATACAGGATGG - Intronic
1025143729 7:56486416-56486438 TTATTTAAAAACAAACAGGCCGG - Intergenic
1026671328 7:72393165-72393187 TGCCTTAAAAACTAGCACTCCGG + Intronic
1026717655 7:72803986-72804008 TCACTTTAAAAGAAACAGGCTGG + Intronic
1030343764 7:108410002-108410024 TGATTTAAAAACAAACAAGGTGG - Intronic
1031118756 7:117696770-117696792 TGATTTACAAACTCACTGGCAGG - Intronic
1031924087 7:127621375-127621397 TTACTTAAAAACAAACATCCCGG - Intergenic
1033304327 7:140213292-140213314 TGTCTTAAAAATAAATAGGCTGG + Intergenic
1033382296 7:140833765-140833787 TAAGATAAAAACTTACAGGCTGG + Intronic
1033469678 7:141634035-141634057 TGAATTAAAACCTGAAAGGCAGG - Intronic
1033823854 7:145165358-145165380 TGACTCAAAAACTCAAAGACAGG + Intergenic
1034903709 7:154925113-154925135 TGTCTTAAAAACAAAAAGGAGGG + Intergenic
1037243985 8:16810031-16810053 TGACTTAGAGACTTAAAGGCAGG - Intergenic
1037391468 8:18396688-18396710 TTATTTAAAAAATTACAGGCTGG - Intronic
1037724867 8:21474709-21474731 TGGCTTAAAAACCTCCAGGCTGG - Intergenic
1038714914 8:29982974-29982996 TGTCTCAAAAACAAACAGGTTGG - Intergenic
1038942284 8:32318488-32318510 TGACTTAACCTGTAACAGGCTGG + Intronic
1040046109 8:42965258-42965280 TGACATGAAAAGTTACAGGCAGG + Intronic
1040103474 8:43525195-43525217 AGAAGTAAAAACTAAAAGGCAGG - Intergenic
1040442736 8:47461604-47461626 TAATTAAAAAACAAACAGGCTGG - Intronic
1040805950 8:51396458-51396480 GGATTTAAAAATAAACAGGCTGG + Intronic
1040986182 8:53296597-53296619 AGAAGTAAAAACTAAAAGGCAGG - Intergenic
1041507901 8:58621611-58621633 TTACTCAAAAAATAACATGCTGG - Intronic
1042049874 8:64691827-64691849 TGACCTAAGAACTAGGAGGCAGG - Intronic
1042261080 8:66860156-66860178 TCATTTAAGAAGTAACAGGCCGG + Exonic
1042340731 8:67676010-67676032 TGATTTAAAAACGTACAGGTTGG - Intronic
1045538923 8:103062464-103062486 TCAATCAAAAACTGACAGGCTGG - Intronic
1045783734 8:105897565-105897587 TCTCTTAAGAACTGACAGGCAGG - Intergenic
1046616080 8:116478738-116478760 TGAATTAAAAACAAACAGTGAGG + Intergenic
1046684519 8:117210201-117210223 TGAATTAAAGACTAATAAGCTGG - Intergenic
1048034171 8:130661500-130661522 AGAATTAAATACAAACAGGCAGG - Intergenic
1050501784 9:6305773-6305795 AAAATTAAAAACAAACAGGCTGG - Intergenic
1050578485 9:7025906-7025928 TGATTGAAAAACTCCCAGGCTGG + Intronic
1051778825 9:20666273-20666295 TGAATAAAAAAATAACTGGCTGG + Intronic
1054909832 9:70444167-70444189 AAATTTAAAAACTCACAGGCTGG + Intergenic
1056187175 9:84146895-84146917 TGAATGAAAAACGGACAGGCTGG + Intergenic
1057204159 9:93160893-93160915 CGACATTAAAACCAACAGGCAGG + Intergenic
1057408969 9:94799564-94799586 TGTCTTAAATAATAATAGGCCGG + Intronic
1057632317 9:96729783-96729805 TGATTTAAAAATTAAAAGGGAGG - Intergenic
1059044003 9:110844385-110844407 TAACTGAGAACCTAACAGGCAGG + Intergenic
1060501402 9:124159250-124159272 TTACTTAAAATCTAAGAGGCTGG - Intergenic
1185654036 X:1669857-1669879 CGTCTCAAAAACAAACAGGCAGG + Intergenic
1186028699 X:5343056-5343078 TGACTTATAAACAAACATGAAGG + Intergenic
1186400774 X:9257525-9257547 TGACATAAAGAAAAACAGGCTGG + Intergenic
1188229430 X:27642928-27642950 TGACTTAAAAACCAACAATATGG - Intronic
1189451603 X:41137648-41137670 TGACTTAAAATCTTTCTGGCTGG - Intronic
1189704708 X:43748370-43748392 TGTCTCAAAAAATAAAAGGCCGG + Intergenic
1190829788 X:54049484-54049506 TGAAATAAAAACTAGCAGGATGG + Intergenic
1190856484 X:54300154-54300176 TGTCTTAAAAACAAACAGGCTGG - Intronic
1191797536 X:65036332-65036354 TGGCTTAAAAACCAATAGGGAGG - Intergenic
1196092188 X:111756613-111756635 TGACTTAAAATGTAACAAGATGG + Intronic
1201512065 Y:14775248-14775270 TCACTTAAAAAATAAAATGCAGG + Intronic