ID: 1160592533

View in Genome Browser
Species Human (GRCh38)
Location 18:79952145-79952167
Sequence CGGGGCCGTCGCCGGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160592514_1160592533 26 Left 1160592514 18:79952096-79952118 CCCCCCGCGGGTCTCCGCTCCGA No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592523_1160592533 -5 Left 1160592523 18:79952127-79952149 CCCCACGAGCAGATGCGCCGGGG No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592525_1160592533 -6 Left 1160592525 18:79952128-79952150 CCCACGAGCAGATGCGCCGGGGC No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592520_1160592533 7 Left 1160592520 18:79952115-79952137 CCGATGCAAGTGCCCCACGAGCA No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592515_1160592533 25 Left 1160592515 18:79952097-79952119 CCCCCGCGGGTCTCCGCTCCGAT No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592516_1160592533 24 Left 1160592516 18:79952098-79952120 CCCCGCGGGTCTCCGCTCCGATG No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592518_1160592533 22 Left 1160592518 18:79952100-79952122 CCGCGGGTCTCCGCTCCGATGCA No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592526_1160592533 -7 Left 1160592526 18:79952129-79952151 CCACGAGCAGATGCGCCGGGGCC No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592517_1160592533 23 Left 1160592517 18:79952099-79952121 CCCGCGGGTCTCCGCTCCGATGC No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data
1160592519_1160592533 12 Left 1160592519 18:79952110-79952132 CCGCTCCGATGCAAGTGCCCCAC No data
Right 1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160592533 Original CRISPR CGGGGCCGTCGCCGGGGGGC CGG Intergenic
No off target data available for this crispr