ID: 1160594576

View in Genome Browser
Species Human (GRCh38)
Location 18:79964797-79964819
Sequence CCCCGACTCCTGCTTCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160594563_1160594576 24 Left 1160594563 18:79964750-79964772 CCCTGAAGCCCCCGGCGGGCGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273
1160594564_1160594576 23 Left 1160594564 18:79964751-79964773 CCTGAAGCCCCCGGCGGGCGCGC 0: 1
1: 0
2: 0
3: 18
4: 113
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273
1160594570_1160594576 13 Left 1160594570 18:79964761-79964783 CCGGCGGGCGCGCGCTGCGGGAC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273
1160594567_1160594576 15 Left 1160594567 18:79964759-79964781 CCCCGGCGGGCGCGCGCTGCGGG 0: 1
1: 0
2: 3
3: 26
4: 275
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273
1160594569_1160594576 14 Left 1160594569 18:79964760-79964782 CCCGGCGGGCGCGCGCTGCGGGA 0: 1
1: 0
2: 1
3: 22
4: 156
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273
1160594565_1160594576 16 Left 1160594565 18:79964758-79964780 CCCCCGGCGGGCGCGCGCTGCGG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG 0: 1
1: 0
2: 2
3: 28
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160594576 Original CRISPR CCCCGACTCCTGCTTCTCTC TGG Intronic
900130767 1:1086237-1086259 CCCCGGCCTCAGCTTCTCTCAGG + Intronic
900422775 1:2562753-2562775 GCACAACTCCTGCTTCTCCCTGG - Intronic
900531675 1:3156870-3156892 CGCCCCCACCTGCTTCTCTCAGG - Intronic
900607168 1:3529037-3529059 CCCCGACTCCTGTGCCTCTGTGG + Intronic
902188885 1:14746615-14746637 CCCCAACTCCAGCTTCTCCCTGG - Intronic
902210600 1:14901790-14901812 CCCCCACAGCTGCCTCTCTCTGG + Intronic
902293034 1:15447401-15447423 TCCCAACTCCTTCCTCTCTCTGG - Intronic
902658658 1:17886736-17886758 CCCCGACTCCTGCTTCAGTCGGG - Intergenic
904300157 1:29549047-29549069 CCCCTCCTCCTGGTTCTCACTGG + Intergenic
904940895 1:34164505-34164527 CCCCGGCTCCTGATTCTGCCAGG - Intronic
907528549 1:55070010-55070032 CCTCCACCCCTGCTTCTCTCTGG - Intronic
909254066 1:73395788-73395810 CCCCGACTCCACCATCACTCTGG + Intergenic
909806000 1:79875184-79875206 CCCTGTCTCCTGCTACTCCCAGG - Intergenic
910294331 1:85629211-85629233 CCCTGCTTTCTGCTTCTCTCTGG - Intergenic
910669556 1:89759402-89759424 CCACTCCTCCTGCTGCTCTCAGG + Intronic
911143799 1:94533392-94533414 CCGCCACGCCTGCTTCTTTCAGG - Intronic
911806412 1:102213926-102213948 CCCTCACTCCAGCTTCTTTCAGG - Intergenic
913484091 1:119317587-119317609 CCCCTATTTCTGCTTCTCCCGGG - Intergenic
915670158 1:157482358-157482380 CCCTGTCTCCTGGATCTCTCAGG + Intergenic
915953649 1:160205983-160206005 CCCCAGCTCCTCCTTCCCTCTGG - Intronic
916206477 1:162320203-162320225 CCCCGACACCTGCTTTTCGGTGG + Intronic
916601221 1:166295414-166295436 CCCTGACACCTGATTCTCTCAGG + Intergenic
917929324 1:179812953-179812975 TCCCGGCACCTGCTGCTCTCAGG + Intronic
917959842 1:180133380-180133402 CCCTGACTCCTGCTTTTCACTGG - Intergenic
918188510 1:182148920-182148942 TCCCTATTCCTGCTTCACTCTGG + Intergenic
920115277 1:203616381-203616403 CCCCCACTCCTCCTTGCCTCTGG + Intergenic
921189804 1:212699527-212699549 CCCCTACCTCTGCTTGTCTCCGG + Intronic
922912682 1:229230609-229230631 TCCCAACTCCTGCTGCTCTCGGG + Intergenic
923437048 1:233977174-233977196 GCCCTGCACCTGCTTCTCTCTGG + Intronic
1065472198 10:26093932-26093954 CCCCGACTCTCTCTTCACTCAGG + Intronic
1065637188 10:27744321-27744343 CCTCGACACCCGCCTCTCTCTGG + Intronic
1068514397 10:58008187-58008209 CTCAGACTCCTCCTACTCTCTGG + Intergenic
1069635747 10:69923798-69923820 CATCGACACCTGCTTCTCCCTGG - Exonic
1069714928 10:70514552-70514574 CCCCGACTCCTTCATCTCTTGGG - Intronic
1069752486 10:70753151-70753173 CCTCGACTCCTACTCCTCCCTGG - Intronic
1070642689 10:78180792-78180814 CCCAGCCTCCTGCTGGTCTCTGG + Intergenic
1071688648 10:87791339-87791361 CCCCAACTCCAGCTCCTTTCAGG - Intronic
1072336496 10:94402843-94402865 CCCCGGCTCCAGCTGCTCCCCGG - Exonic
1073178347 10:101569846-101569868 CCCCATCTCTTTCTTCTCTCAGG + Intergenic
1073836052 10:107444129-107444151 CCCCAAACCCTGCTTCTCTATGG - Intergenic
1074200683 10:111232256-111232278 CCCCAACTCCTGCTTTCCGCAGG + Intergenic
1075048061 10:119161718-119161740 CCCCGAATCCGGCTTGCCTCTGG + Intronic
1075520421 10:123140341-123140363 CCCAGGCACCTGCTTCTGTCGGG - Intergenic
1075746438 10:124731433-124731455 GCCCTACTCTTTCTTCTCTCAGG + Intronic
1076374935 10:129977103-129977125 CACCGACTCCTGCGGCTCTGAGG + Intergenic
1077581487 11:3420119-3420141 CCCTGCCTCCTGAATCTCTCCGG - Intergenic
1082629231 11:55521154-55521176 ACCCGTCTTCTGCTTCGCTCAGG + Intergenic
1082875340 11:57982191-57982213 TGCCCACTCCTGCTCCTCTCTGG - Intergenic
1082944135 11:58740369-58740391 CCCCAACCCCTGTTGCTCTCGGG + Intergenic
1083203349 11:61132934-61132956 CCCTGCTTCCTGCTTCCCTCCGG - Intronic
1084238401 11:67802948-67802970 CCCTGCCTCCTGAATCTCTCCGG - Intergenic
1084640195 11:70421067-70421089 GCCCCGCTCCTGCTTCTCTCAGG - Intronic
1084834007 11:71789877-71789899 CCCTGCCTCCTGAATCTCTCCGG + Intronic
1084941803 11:72617074-72617096 CCCAGAGTCCTGCTTGTCTTTGG + Intronic
1085037672 11:73309643-73309665 CCCGGAGTCCTTCTTCTCTAGGG - Exonic
1085306761 11:75490694-75490716 CCCAGGGTCCTGCTTCTCTGAGG + Intronic
1086337191 11:85811337-85811359 CCCCGCCTGCTGCTTCTCTCCGG + Intergenic
1086575758 11:88337620-88337642 GCCCTCCTGCTGCTTCTCTCCGG - Exonic
1088024009 11:105155952-105155974 CCCCAACTACTGCTTCATTCTGG - Intergenic
1089229427 11:116958854-116958876 CATCTGCTCCTGCTTCTCTCAGG + Intronic
1089608966 11:119658824-119658846 CCTCCCCTCCTGCTGCTCTCAGG + Intronic
1090242983 11:125197116-125197138 CCGGGACCCCTGCTTCTCTGAGG + Intronic
1091356863 11:134944110-134944132 CCCCTTCTCCTGCTTCCCACTGG - Intergenic
1094764303 12:33574382-33574404 CCCCAACTCCTGAACCTCTCAGG - Intergenic
1096510003 12:52122348-52122370 TCCCCACTCCAGCTGCTCTCGGG - Intergenic
1096803421 12:54126443-54126465 CCCCGAGTCCTGCTTCCCCGGGG + Intergenic
1097173033 12:57128172-57128194 CCTCGACCCCTTCTGCTCTCTGG + Intronic
1098893456 12:76031952-76031974 CCCCGCGTCCCGCTTCTCCCCGG + Exonic
1100160568 12:91855599-91855621 TCCCGACTCCTACTTCTCAATGG + Intergenic
1102919274 12:116779663-116779685 CCCCGGGACCTGCTTCTCCCAGG + Intronic
1103933554 12:124463401-124463423 CCCCGTCTGCTCCTGCTCTCAGG + Intronic
1104273210 12:127301247-127301269 TCCCCTCTCCTGCTTCTGTCTGG + Intergenic
1105591929 13:21800217-21800239 CCCCAACCCTGGCTTCTCTCTGG + Intergenic
1106032739 13:26017521-26017543 CCCAGCCTCCTGCCTCCCTCTGG - Intronic
1106447574 13:29850287-29850309 CCCCGACCCCAGCTGCTGTCCGG - Exonic
1109320994 13:60809756-60809778 CTCTGACTTCTGCTTGTCTCAGG + Intergenic
1110060532 13:71033437-71033459 CCCCCACTCCTACTGCCCTCAGG + Intergenic
1110836978 13:80094104-80094126 CCCCTACTCCTGTGGCTCTCAGG + Intergenic
1112550652 13:100417564-100417586 CCCCGGCCACTGCATCTCTCAGG - Intronic
1113940389 13:114015821-114015843 CCCCGGCTCCTCCTTCCCTTGGG - Intronic
1114535182 14:23418055-23418077 CCCCACCTCCTTCTCCTCTCAGG - Intronic
1115738021 14:36355845-36355867 GCCCAAATCCTGCTCCTCTCAGG - Intergenic
1117365302 14:55021497-55021519 CCCACACTCCACCTTCTCTCAGG - Intronic
1122922656 14:104886382-104886404 CCACTCCTCCTGCTGCTCTCTGG - Exonic
1124652143 15:31482262-31482284 CCCCCACACCTGCATCTGTCTGG - Exonic
1125582305 15:40795036-40795058 AGCCGACTCTTGCTCCTCTCTGG + Intronic
1126055946 15:44729506-44729528 CACAGACACCTGCTTCTCCCCGG - Exonic
1128683158 15:69666027-69666049 CCCCCACTCCTGCTGGTCTCTGG + Intergenic
1128709061 15:69858370-69858392 CCTACACTCCTGCTTCTCACTGG + Intergenic
1129055128 15:72813881-72813903 CCCCGCCTCCTGCTGTTCCCAGG + Intergenic
1129235742 15:74222803-74222825 CCCCGCCGCCTGCATGTCTCTGG + Intergenic
1129928314 15:79385545-79385567 GCAGGACTCCTGCTTGTCTCTGG + Intronic
1130060894 15:80569240-80569262 CCCGGACTCCTGCACCTCGCCGG + Intronic
1130063309 15:80584830-80584852 CCCAGCCTCCTGCTTCTGGCTGG + Intronic
1130183018 15:81651130-81651152 CCCTGGCTCCTGCTTGTCCCTGG - Intergenic
1130183022 15:81651147-81651169 CCCTGGCTCCTGCTTGTCCCTGG - Intergenic
1130871956 15:87978662-87978684 CCCCTACTTCCTCTTCTCTCTGG - Intronic
1131019345 15:89085282-89085304 TCCCAACACCTGCTTATCTCAGG + Intergenic
1131921609 15:97334215-97334237 CCCCCTATCCTGCTTCTGTCTGG - Intergenic
1132252294 15:100342700-100342722 CACTGAGTCCTGCTTCCCTCGGG - Intergenic
1132300234 15:100770837-100770859 CCCCGTCTCTTCCTTCCCTCGGG + Intergenic
1132826876 16:1909545-1909567 CCCCGCCTCCTGCTAGTTTCTGG - Intergenic
1134225002 16:12382831-12382853 GGCCTTCTCCTGCTTCTCTCTGG + Intronic
1134297942 16:12963127-12963149 CCCAGGCTCCTGCTTCCCTCAGG - Intronic
1134507890 16:14822990-14823012 CCCAGACCCCTGCTGTTCTCAGG + Intronic
1134695591 16:16221753-16221775 CCCAGACCCCTGCTGTTCTCAGG + Exonic
1134976238 16:18572933-18572955 CCCAGACCCCTGCTGTTCTCAGG - Intergenic
1137621480 16:49879343-49879365 GCACCACTCCTGCTTGTCTCGGG - Intergenic
1138170336 16:54843616-54843638 CCCCTCCTCCTGATTCTCTGGGG + Intergenic
1139491076 16:67286373-67286395 CCCCTACTCCTCCTAATCTCAGG - Intronic
1141588299 16:85049832-85049854 GCCCGAGTCCTGCATCTCTTAGG + Intronic
1141990170 16:87604783-87604805 CCCAGACTCCTCCTCCTCTTCGG - Intronic
1142253202 16:89002220-89002242 CTCCGGCTCCTGCGTCCCTCCGG - Intergenic
1142253240 16:89002328-89002350 CTCCGGCTCCTGCGTCCCTCCGG - Intergenic
1142253415 16:89002822-89002844 CTCCGGCTCCTGCGTCCCTCCGG - Intergenic
1142253487 16:89003021-89003043 CCCCGGCTCCTGCGTCCCTCCGG - Intergenic
1142253514 16:89003095-89003117 CCCCAGCTCCTGCGTCCCTCCGG - Intergenic
1142871617 17:2824817-2824839 CGCCGCCTCCTCCTCCTCTCTGG - Intronic
1143631457 17:8142619-8142641 CCCCGCCTCCAGCATCTCCCAGG - Intronic
1144651165 17:17008085-17008107 CCCCGGCTCCTGCTTGTTACAGG + Intergenic
1147256497 17:39185128-39185150 CACCGACTTCTGCTTCTGTTTGG + Exonic
1147332130 17:39705423-39705445 CCCCAGCTCCTGTTTCTCTTGGG + Intronic
1147705646 17:42423154-42423176 CTTCCGCTCCTGCTTCTCTCCGG - Exonic
1150135621 17:62693306-62693328 CCCAGACTCCTGCTCCTCTGGGG - Exonic
1151673807 17:75588113-75588135 CCCCGACTCCTGCTCCCCTGAGG - Intergenic
1152089219 17:78237706-78237728 CCCCCACCCCTGCTTCTCCCAGG + Intronic
1152222445 17:79076026-79076048 CCCCGACCCCTGCAGTTCTCAGG + Intronic
1152322377 17:79614919-79614941 CTCCTCCTCCTCCTTCTCTCTGG - Intergenic
1153821896 18:8839178-8839200 CCCCTCCTCCTGCCCCTCTCTGG - Intergenic
1156275159 18:35577171-35577193 TCACCACTTCTGCTTCTCTCAGG - Intergenic
1158993081 18:62890019-62890041 CCCCGACTCCTTGTTCTGTAGGG + Intronic
1159840472 18:73393336-73393358 CCCCAGTTACTGCTTCTCTCTGG - Intergenic
1160539024 18:79610442-79610464 CCCCGGCCTCTGCTGCTCTCTGG + Intergenic
1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG + Intronic
1160745504 19:709254-709276 CGCCGCCTCCTGCTCCTCGCGGG - Intronic
1160870835 19:1277117-1277139 CCCTGCCTCCTCCTTCCCTCAGG - Intronic
1161032224 19:2062750-2062772 TCCTCATTCCTGCTTCTCTCAGG + Intergenic
1161592111 19:5133571-5133593 CCCCAACACCTGGTTCTCCCTGG - Intronic
1164608022 19:29613796-29613818 CCCTGAGGCCTGCTTCTCTGTGG + Intronic
1165454212 19:35901260-35901282 CCCCCAGTCCTGCCTCCCTCTGG - Intronic
1165549963 19:36575469-36575491 CCCCGCCTCCTGCTTGCCCCTGG + Intronic
1165860206 19:38905387-38905409 CCCCGACACCTACCTCGCTCAGG + Exonic
1166291859 19:41868687-41868709 CCTTCACTCCTGCTTCTCTGGGG + Intronic
1166349838 19:42191355-42191377 CCACAACTCCAGCTCCTCTCAGG + Intronic
1168273892 19:55265734-55265756 CCCTGACTCCTGCTCCTTTCTGG + Intronic
1168633480 19:57975527-57975549 CCCAGACTTCTGCTTCTTCCTGG - Intergenic
925156427 2:1651770-1651792 TCCCGCCTGCTGTTTCTCTCTGG + Intronic
925850912 2:8081270-8081292 GCCCTCCTCCTGCTTCTCACAGG + Intergenic
926314196 2:11697444-11697466 GCTCGGCTCCTGCTTCTCCCTGG + Intronic
929452343 2:42046488-42046510 CCCGGACTCCTTGTTCTCTATGG - Intergenic
929778792 2:44944354-44944376 CTCCGACTTCTGCTTCTCCAGGG + Intronic
930722779 2:54653916-54653938 TCAAGGCTCCTGCTTCTCTCTGG - Intronic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
933484060 2:82896361-82896383 CCCCTGCTCCTGCTGCCCTCAGG + Intergenic
934102532 2:88666682-88666704 CCCCAACTGCTGCTCCTCTCAGG + Intergenic
935853056 2:107243900-107243922 TCCTGACTCCTGCTTCTACCTGG - Intergenic
935885458 2:107614641-107614663 CACTGACTCCTGGTTCTTTCTGG - Intergenic
936437535 2:112521268-112521290 CCGGAACTTCTGCTTCTCTCGGG + Intronic
936536037 2:113312009-113312031 CACAGACTACTGATTCTCTCAGG - Intergenic
937284456 2:120741439-120741461 CCCCCACCCCCTCTTCTCTCTGG + Intronic
937329326 2:121016008-121016030 CCCTGGCTTCTCCTTCTCTCAGG + Intergenic
941297173 2:163754096-163754118 CCCCAACTCCTACTTGCCTCAGG - Intergenic
941298308 2:163768812-163768834 ACGTGACTCCTGCTTCTCTCTGG - Intergenic
942684517 2:178517570-178517592 CCCTGCCTTTTGCTTCTCTCTGG + Intergenic
945751170 2:213785126-213785148 CACCCACTCCTACTGCTCTCAGG + Intronic
946179655 2:217941888-217941910 CCTTGACTCCTGCTCCTATCTGG + Intronic
946180986 2:217948751-217948773 CCCCTACTCCTGCCTCCTTCTGG - Intronic
946321134 2:218955197-218955219 CCCCCACTCCTTCTCCTCCCAGG - Intergenic
947524775 2:230871404-230871426 CCCCGTCTCTTGCTGCTCCCGGG + Intronic
948487447 2:238289724-238289746 CCCTGGCTCCTGCGTCTCTACGG - Intronic
948545415 2:238725148-238725170 CCCTGGCTCCTGATCCTCTCTGG - Intergenic
1169895272 20:10498479-10498501 CCCTGCCTCCTGCTTATTTCAGG + Intronic
1170585787 20:17732919-17732941 CCACGACTCCAGCTTCCCTGGGG + Intronic
1172581735 20:36053676-36053698 CCCCTCCTCCCTCTTCTCTCAGG - Intergenic
1172807871 20:37625830-37625852 CCCCGATTCCTGCTCCACCCTGG - Intergenic
1173211170 20:41033252-41033274 CACCAACTCCTGCTTTTCTTTGG + Intronic
1174251480 20:49223069-49223091 CCACGACCCCAGCATCTCTCTGG + Intronic
1175613442 20:60371758-60371780 CCCCAAATCCTGGTTCTTTCTGG + Intergenic
1175655481 20:60766155-60766177 CCTCGTCTCCAGCCTCTCTCTGG - Intergenic
1178276822 21:31246295-31246317 CCAGGACTCCGGCTTCTCCCAGG - Intronic
1179586522 21:42376953-42376975 CCCCTACTCCTCCTCCTCTTTGG - Intronic
1179647633 21:42785038-42785060 CCCCTACTCCTTGTTCTGTCCGG + Intergenic
1182452086 22:30427688-30427710 CACCTGCTCCTGCTTCTCTCTGG - Intronic
1182465722 22:30514881-30514903 CCCCTACTCCTGCTTTTGTAGGG - Intergenic
1183543076 22:38441113-38441135 CCCCTACTCCTCCTGCTCTCTGG - Intronic
1183974241 22:41501437-41501459 CCCCGACTCCTCATCCTCTGTGG - Intronic
1183984830 22:41563615-41563637 ACCCGACTCCTCCTTCTCCAGGG + Intronic
1184219346 22:43089344-43089366 CCCCGCCTCCAGCCCCTCTCCGG + Exonic
950096515 3:10333796-10333818 CCCTGACCCCTCATTCTCTCAGG - Intronic
950111595 3:10422151-10422173 CCCTGGCTCCTGCCTCTCTGGGG + Intronic
950189254 3:10965320-10965342 CACCCACTCCTCCTGCTCTCCGG - Intergenic
951550976 3:23874836-23874858 CCCCAACCCCTGCTTCTTTCAGG + Intronic
953870880 3:46626772-46626794 CCCCCAGTCCTGCTTTCCTCTGG - Intergenic
954442171 3:50527847-50527869 CCCCCACCCCTCCTTCTCTCAGG + Intergenic
955406217 3:58627269-58627291 CCCAGAACCCTGCCTCTCTCAGG + Exonic
956304123 3:67805340-67805362 ACCAGACTGCTGCCTCTCTCAGG - Intergenic
956324173 3:68032650-68032672 TTCCCACTCCTCCTTCTCTCTGG + Intronic
956731813 3:72203615-72203637 CTCTGGCTCCAGCTTCTCTCAGG - Intergenic
957054354 3:75432754-75432776 CCCTGCCTCCTGAATCTCTCCGG - Intergenic
961089514 3:124098293-124098315 CCCCGATGCCTGCTTCTGTTGGG + Intronic
961197366 3:125014204-125014226 CCGCTACCACTGCTTCTCTCAGG - Intronic
961300489 3:125918958-125918980 CCCTGTCTCCTGAATCTCTCCGG + Intergenic
961888019 3:130109119-130109141 CCCTGCCTCCTGAATCTCTCCGG - Intronic
962367766 3:134797159-134797181 CTCAGTCTCCTGCTTCCCTCAGG + Intronic
963948894 3:151177157-151177179 CCCTGACTTCTGCCTCTCTAGGG - Intronic
968611719 4:1560194-1560216 CCCCAACTCCAGCTTCACCCCGG + Intergenic
969816814 4:9693193-9693215 CCCTGCCTCCTGAATCTCTCCGG + Intergenic
970806827 4:20046333-20046355 CACGGATTCCTGCTTCTCGCTGG - Intergenic
972096843 4:35358450-35358472 CCCCGACACCAGGTTCTCTCAGG + Intergenic
981211424 4:142110629-142110651 TCAGGCCTCCTGCTTCTCTCAGG + Intronic
981337184 4:143581043-143581065 CCCCAGCTCCTGCTGCGCTCAGG + Intronic
982198006 4:152935768-152935790 CCCCAACACTTGCTTCTCCCTGG - Intergenic
982333515 4:154208758-154208780 CCCGGACTCTTCCTCCTCTCAGG + Intergenic
984466120 4:180101516-180101538 GTCCCGCTCCTGCTTCTCTCAGG - Intergenic
984700203 4:182814182-182814204 CCCCCACTCCTACTTCCATCTGG - Intergenic
986125253 5:4878391-4878413 CCCCATCTCCTACTTCTCCCTGG + Intergenic
987313286 5:16701019-16701041 CCCCGACTACCGCTGCTCTGTGG - Exonic
987694286 5:21308047-21308069 CCCTCCCTCCTGCTGCTCTCAGG + Intergenic
990490615 5:56299495-56299517 CCCAGACATCTGTTTCTCTCGGG + Intergenic
990501429 5:56400100-56400122 CCCCTACTGCTGTTTTTCTCAGG - Intergenic
990602053 5:57369072-57369094 CACTGACTTCTGATTCTCTCTGG + Intergenic
991583669 5:68181714-68181736 CCCCAACTTCAGCATCTCTCAGG + Intergenic
991745959 5:69741422-69741444 CCCTCCCTCCTGCTGCTCTCAGG - Intergenic
991751745 5:69813819-69813841 CCCTCCCTCCTGCTGCTCTCAGG + Intergenic
991797560 5:70321380-70321402 CCCTCCCTCCTGCTGCTCTCAGG - Intergenic
991825337 5:70616736-70616758 CCCTCCCTCCTGCTGCTCTCAGG - Intergenic
991831034 5:70688712-70688734 CCCTCCCTCCTGCTGCTCTCAGG + Intergenic
991889902 5:71320701-71320723 CCCTCCCTCCTGCTGCTCTCAGG - Intergenic
997296415 5:132771660-132771682 CCCCGGCTCCAGCTCCTCCCAGG + Intronic
997450122 5:133975867-133975889 CCCTGACGCCTGCTTCTCGGTGG - Exonic
999247636 5:150163689-150163711 CCCGGCTTCCTGCTGCTCTCTGG + Intergenic
1002758242 6:181089-181111 CTCCAACTCCTGCTTCTCTTGGG - Intergenic
1003418821 6:5937917-5937939 CACCGACTCCTGCCACTCTGAGG - Intergenic
1005337252 6:24809514-24809536 CCCCAACTCCTTGTTCTGTCTGG - Intronic
1005492678 6:26361086-26361108 CCCCCACCCCAGCTTCCCTCAGG + Intergenic
1005556619 6:26991887-26991909 CCCTCCCTCCTGCTGCTCTCAGG - Intergenic
1005859068 6:29887773-29887795 ACCCTCCTCCTGCTGCTCTCAGG + Intergenic
1005866623 6:29942575-29942597 ACCCTCCTCCTGCTACTCTCGGG + Exonic
1005875293 6:30006618-30006640 ACCCTCCTCCTGCTGCTCTCGGG + Intergenic
1006043312 6:31272028-31272050 GCCCTCCTCCTGCTGCTCTCGGG - Exonic
1006114046 6:31765910-31765932 CCCCGACTCATGCTTTCCTCCGG - Exonic
1006793457 6:36718006-36718028 CCCCAACTCCTGCTCCTCCCAGG + Exonic
1007952511 6:45884864-45884886 CCCCAACTCCTTCATCTGTCCGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009326290 6:62352327-62352349 CACTGATTCATGCTTCTCTCTGG + Intergenic
1010051708 6:71512137-71512159 TCCCTACTCCTGCTTCTTTCTGG - Intergenic
1012584306 6:100903996-100904018 TCCCAACTCCTGCATTTCTCTGG + Intergenic
1014997865 6:128174298-128174320 TCCCCACTCCTTCTTCTTTCTGG - Intronic
1017737673 6:157380094-157380116 CCCCGAGTCGTGCTTCTCCTCGG + Intergenic
1017877392 6:158536398-158536420 CCCCGCCTTCTGCCTCTCCCGGG + Intergenic
1018210935 6:161480987-161481009 CCGCGTCTCGTGCTTCCCTCAGG - Intronic
1018844813 6:167548295-167548317 CCATGACTCCTGCTTCTAGCGGG + Intergenic
1020400705 7:7773934-7773956 CCCTGGCTGCTGTTTCTCTCTGG + Intronic
1020660294 7:10973826-10973848 CCTCAATTCCTGCTGCTCTCAGG + Intergenic
1023418036 7:39950418-39950440 CCCGGATTCCTGCTTCCCTGGGG + Exonic
1024090900 7:45939090-45939112 CCCCGCCCCCTGCTGCTCTCAGG - Intergenic
1024426022 7:49227363-49227385 CCCAGTCTCCTCCTTCTCTCTGG + Intergenic
1026476189 7:70737744-70737766 CCCTGGCTCCTCCTCCTCTCTGG - Intronic
1028716779 7:93979957-93979979 CCCAGATTCCAGCTTCTCCCTGG + Intronic
1029896996 7:103993693-103993715 TCCCTGCCCCTGCTTCTCTCTGG + Intergenic
1031561585 7:123245090-123245112 CCTCGACTCTTGCTGCTCTATGG + Intergenic
1033319950 7:140330415-140330437 CCCCGCCACCTGCTTTACTCAGG - Intronic
1033543812 7:142381615-142381637 TCTAGACTCCTGTTTCTCTCTGG + Intergenic
1034430825 7:151040454-151040476 CCCCTACTCCTGCCTCCCTGCGG + Intronic
1035035845 7:155893239-155893261 CCCCCACAGCTGCTTCTCTTCGG + Intergenic
1035824099 8:2626554-2626576 CCCCATCTCCTGCTTATGTCTGG - Intergenic
1036113868 8:5936425-5936447 CCCTGAGTCCTGATTCCCTCGGG - Intergenic
1036622159 8:10431372-10431394 CCCTCACCCCTGCTTCTCACTGG + Intergenic
1041166857 8:55100685-55100707 CACCCACCCCCGCTTCTCTCTGG - Intergenic
1041310372 8:56510348-56510370 CCCCCACTCCTGACTCTCCCAGG + Intergenic
1042155403 8:65840836-65840858 CCCCGACTCCTTCGTTTCTGTGG - Intronic
1043631658 8:82342797-82342819 CCCAGACTCCTTCTTCTATTTGG - Intergenic
1048821134 8:138381852-138381874 CCCCGACACTGGCTTCTCTGTGG - Intronic
1049749657 8:144277170-144277192 CCCCGAGCCCCTCTTCTCTCCGG + Intronic
1049931104 9:457587-457609 CCCAGAATCCTGCTGCTCCCAGG - Intronic
1051686655 9:19665133-19665155 CCCTGTCTACTGCTTCTCACCGG - Intronic
1052626234 9:30980771-30980793 CCCCAGATCCTGCATCTCTCTGG + Intergenic
1053375985 9:37606823-37606845 CTCCTACTCCAGCCTCTCTCTGG - Intronic
1056793309 9:89639964-89639986 CACCTACCCCAGCTTCTCTCAGG - Intergenic
1059417126 9:114169030-114169052 CCCCTACTCCTGGTTCTACCAGG + Exonic
1060414528 9:123421033-123421055 GCCTGCCTCCTGCTTCTGTCTGG - Intronic
1060551981 9:124489986-124490008 TCCCCACTCCTCCCTCTCTCTGG + Intronic
1061874252 9:133536026-133536048 CCCCAATTCCATCTTCTCTCCGG + Intronic
1062145071 9:134984572-134984594 CCCTGACCTCTGCTTCTCTGTGG - Intergenic
1062330931 9:136044679-136044701 CCCCTCTTCTTGCTTCTCTCTGG + Intronic
1062547623 9:137070740-137070762 CCCCAGCTCCTGCTCCACTCTGG + Intergenic
1185829107 X:3281893-3281915 CCCAGATTCCTGTTTTTCTCTGG + Intronic
1186680681 X:11870542-11870564 CCCAGTCTCCTGCTTTTGTCTGG - Intergenic
1187115719 X:16348265-16348287 CCCCCAGACCTCCTTCTCTCAGG - Intergenic
1193067430 X:77274938-77274960 TCCCCACTCCTGCTGCCCTCAGG + Intergenic
1193698836 X:84739927-84739949 CCTCGACTCCTGCTACTTCCTGG - Intergenic
1193773728 X:85619289-85619311 CCCCCACTCCTGCTGACCTCAGG + Intergenic
1194366349 X:93018875-93018897 ACCCCACACCTGCTGCTCTCAGG + Intergenic
1195453486 X:105041953-105041975 CCCCATTTCTTGCTTCTCTCAGG - Intronic
1196754294 X:119144275-119144297 CCCGGTTTCCTGCTGCTCTCTGG + Intronic
1197183772 X:123563644-123563666 ACCTGACTCCAGCTTCTCTCTGG + Intergenic
1198786763 X:140297228-140297250 CCCCAAATTCTGGTTCTCTCTGG - Intergenic
1199966370 X:152824140-152824162 ACCCCACTCCTCCATCTCTCTGG + Intergenic
1200052585 X:153442863-153442885 CCCCTACTCCAGCTTCTGTAGGG + Intergenic
1200674574 Y:6135137-6135159 ACCCCACCCCTGCTGCTCTCAGG + Intergenic
1202162296 Y:21948045-21948067 CCTCCACCCCTGCTTCTCTTTGG - Intergenic
1202229060 Y:22638328-22638350 CCTCCACCCCTGCTTCTCTTTGG + Intergenic
1202314094 Y:23557837-23557859 CCTCCACCCCTGCTTCTCTTTGG - Intergenic
1202556708 Y:26112758-26112780 CCTCCACCCCTGCTTCTCTTTGG + Intergenic