ID: 1160599036

View in Genome Browser
Species Human (GRCh38)
Location 18:79998541-79998563
Sequence GGTGATCATCAGAGGCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 2, 1: 2, 2: 2, 3: 12, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160599032_1160599036 0 Left 1160599032 18:79998518-79998540 CCAGGGTACTGATCCAGAAACAT 0: 2
1: 1
2: 4
3: 7
4: 111
Right 1160599036 18:79998541-79998563 GGTGATCATCAGAGGCCTATAGG 0: 2
1: 2
2: 2
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160599036 Original CRISPR GGTGATCATCAGAGGCCTAT AGG Intronic
905879121 1:41452040-41452062 GATGATTTTCAGAGGCCTTTTGG - Intergenic
907336480 1:53702931-53702953 GGTGCTCAGCAGAGGCCTTTTGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912427326 1:109606145-109606167 GGTGACCATCAAAGGCATATAGG - Exonic
917583722 1:176403780-176403802 GTTGATGATCAGATGGCTATTGG + Intergenic
918326617 1:183417201-183417223 GGTGATCGATAGATGCCTATTGG - Intronic
924213512 1:241794883-241794905 GGTGAAAATCAGAGTCCTAAGGG - Intronic
1066375621 10:34855561-34855583 GGTGATCATGATAGGCTTATAGG + Intergenic
1066471372 10:35701383-35701405 GGGGATCAGCAGAGGCCCCTGGG - Intergenic
1069046147 10:63745625-63745647 GTTGATCATCAGATGGTTATAGG - Intergenic
1075993060 10:126854209-126854231 GTTGATCTTCAGAGCCCTCTTGG - Intergenic
1078402552 11:11040695-11040717 GGGAATCAATAGAGGCCTATTGG - Intergenic
1084680558 11:70663939-70663961 GGTGATCCCAAGAGGCCTGTAGG - Intronic
1086803328 11:91205644-91205666 GGAGATTATCAGATGCCTTTAGG + Intergenic
1088494929 11:110423168-110423190 GATGATCAGCAGAGACCTAGAGG + Intergenic
1089792521 11:120955095-120955117 GCTGATCTTCAGAGTCCTGTAGG + Intronic
1093226222 12:16487048-16487070 GCTGAGCATCAGATTCCTATAGG - Intronic
1099763214 12:86946759-86946781 GGTTCTCATCAGAGGCTTCTAGG - Intergenic
1103129568 12:118455811-118455833 GGTGGTCATTATATGCCTATTGG - Intergenic
1106193318 13:27473044-27473066 GGTTACCAGCAGAGGCCTTTGGG + Intergenic
1106360835 13:29029162-29029184 CGTTATAATCAGAGGCCTGTTGG - Intronic
1111597674 13:90432342-90432364 GGTGATCATTGGAGACCTATAGG - Intergenic
1115856406 14:37633809-37633831 TGGGATCAGCAGAGGCCTAGTGG + Intronic
1117196237 14:53342534-53342556 TGGGATCAGCAGAGGCCTCTGGG + Intergenic
1118719420 14:68583715-68583737 GGTCACCACCCGAGGCCTATGGG + Intronic
1122030389 14:98907656-98907678 GGTGACCAACAGGGGCCTAGCGG + Intergenic
1126635264 15:50773722-50773744 GGTGGTTACCAGAGGCCTACAGG - Intergenic
1127320009 15:57834841-57834863 GTTGAACATCAGATGACTATAGG - Intergenic
1130716562 15:86340791-86340813 GGGGATCATCAGAGGATTAGTGG - Intronic
1134842324 16:17411820-17411842 GTTGCTCATCAGAGGCCTTCAGG - Intronic
1141949027 16:87328913-87328935 TGTCGTCATCAGAGGCCTAAGGG - Exonic
1147390557 17:40106757-40106779 GGTGATCTGCAGAGGCCCAAAGG - Intergenic
1150299730 17:64038111-64038133 GGTGAGCATGAGTGGCCAATGGG + Intergenic
1150442391 17:65202112-65202134 GGTGGTCCTCAGAGGCCCAAGGG - Intronic
1151180293 17:72322471-72322493 TGTGATCATCAGAGGCACCTTGG + Intergenic
1152476070 17:80519020-80519042 GGTGACCCTCAGGGGCTTATGGG - Intergenic
1155830389 18:30509537-30509559 GGTGATCAGCACTGGCCTCTGGG + Intergenic
1160599036 18:79998541-79998563 GGTGATCATCAGAGGCCTATAGG + Intronic
1160602938 18:80028160-80028182 GGTGATCATCAGAGGCCTATAGG + Intronic
1164057187 19:21631716-21631738 TCTGATAAGCAGAGGCCTATGGG + Intergenic
1164336024 19:24322082-24322104 GGTGGTCAGAAGAGGCCCATTGG + Intergenic
1167666046 19:50823313-50823335 GGGGATGATCAGAGTCCTGTGGG + Intronic
925726408 2:6876472-6876494 TGTGATCATGAGAGGCATACAGG - Intronic
926178508 2:10618391-10618413 AGTGATCAGCAGAGGACTGTGGG - Intronic
930718252 2:54613554-54613576 GCTGATCATCTGATGCCTTTGGG + Intronic
932086833 2:68769958-68769980 GGGGGTCATCAGAGGCTTTTAGG + Intronic
937102808 2:119284495-119284517 GGTGATCCACTGAGGCCTCTTGG - Intergenic
940076174 2:149744346-149744368 GGTGATCATCACATGCATATAGG + Intergenic
941761126 2:169244765-169244787 GGTGATTATCACAGGTGTATTGG + Exonic
948357009 2:237386546-237386568 GATGATAATCAGAGTCTTATAGG + Intronic
1169282895 20:4281951-4281973 GGTGTTCATCAGAGGACTCATGG + Intergenic
1170269402 20:14507360-14507382 GGTGATCACCAGAGACCAGTGGG + Intronic
1173262892 20:41452164-41452186 GGTGGTCCTCAAAGGCCTTTCGG - Intronic
1177139958 21:17347147-17347169 AGTCATCATCAGAGGCCTCTTGG - Intergenic
1181908818 22:26221379-26221401 GGTTACCATCACAGGCCTATAGG + Intronic
1184353460 22:43961044-43961066 GAGGATCATCAGAGGCTTTTAGG + Intronic
950880310 3:16317771-16317793 GGTGGTCAGCAAAGGGCTATCGG - Intronic
951376528 3:21924835-21924857 GGTGGTCAACTGAGGCCCATTGG + Intronic
951807821 3:26665821-26665843 GGTGAACATCACATGCCTTTGGG - Intronic
964187268 3:153961636-153961658 GGTTATCATCAGAGCTCTAGAGG + Intergenic
964288630 3:155150456-155150478 TGTGATCATCAGAAGCTCATGGG - Intronic
965631713 3:170740096-170740118 ATTGATCATCAGGTGCCTATGGG - Intronic
966100223 3:176259986-176260008 GGTGGTTATCAGAGGCTTAGAGG - Intergenic
969554233 4:7895257-7895279 GAGGATCATCAGAGGCTTGTCGG + Intronic
970401290 4:15720115-15720137 GGTGACCAAAAGAGGCCAATGGG - Intronic
974559859 4:63503476-63503498 GGTGATCATCAGTGGCAGAGTGG - Intergenic
974794265 4:66728498-66728520 ATTGATCATCAGGGGCCTATGGG + Intergenic
978236296 4:106465091-106465113 AGTCTTCATCAGAGGACTATTGG - Intergenic
982056441 4:151554012-151554034 TGTGATCATAAGAGGGGTATAGG - Intronic
984750907 4:183273196-183273218 GGTGAGCATCACAGCCTTATTGG + Intronic
985215502 4:187649322-187649344 ACAGATCATCAGAGGCCTAGTGG + Intergenic
985979241 5:3448687-3448709 AGTGATCATTATAGGCATATGGG - Intergenic
988926788 5:35998264-35998286 GGTGATTATCAGAGACCTATTGG + Intergenic
993962375 5:94315323-94315345 GCTGAAAATCAGAGGCCTAGAGG + Intronic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
999702962 5:154244967-154244989 GCTGATCACCAGGGGCCTGTGGG + Intronic
1000100627 5:158012986-158013008 AGTGATCATCAAATGCCTCTTGG + Intergenic
1001098119 5:168791908-168791930 GGTGATGTTCAGAGGCCGGTGGG - Intronic
1004274926 6:14227573-14227595 GGTGGCCAGCAGAGGCCTCTTGG - Intergenic
1006515227 6:34541858-34541880 GGTGAGCCTCATAGGCCTATAGG + Intronic
1014043375 6:116855151-116855173 GGTGATCCTCAAAGACCTAGAGG + Intergenic
1018421629 6:163645076-163645098 GGAGAACATCAGAGGCCACTAGG - Intergenic
1024306232 7:47931869-47931891 GGTGAGCATCTGATGCATATGGG - Intronic
1027375575 7:77545687-77545709 GTTGAGAATCACAGGCCTATAGG + Intronic
1033244558 7:139707179-139707201 GGAGATGATCACAGGCCTAAGGG - Intronic
1037374875 8:18216962-18216984 GGTGATCATCAGAGACCGGTAGG - Exonic
1037606099 8:20438483-20438505 AGTGATAATAAGAGTCCTATTGG + Intergenic
1039772800 8:40704935-40704957 GGTGATGTTCAGAGTCCCATGGG + Intronic
1041516508 8:58705264-58705286 TGTGTTGATCAGAGTCCTATAGG - Intergenic
1043111466 8:76188755-76188777 AACAATCATCAGAGGCCTATAGG + Intergenic
1043180126 8:77078080-77078102 GGAAATAATCAGAGGCTTATTGG - Intergenic
1053245593 9:36532168-36532190 GGGGATCATCAGAGGACTAAAGG + Intergenic
1055081868 9:72275554-72275576 GGTGTTCCTCAGAGGCCCAAAGG - Intergenic
1055828430 9:80354256-80354278 TGTGAACATCAGAGGCAAATGGG - Intergenic
1058042819 9:100322984-100323006 GGTGATAAGCAAAGGTCTATGGG + Intronic
1061215011 9:129216652-129216674 GCTGAGCATCAGTGGCCTCTTGG + Intergenic
1186413854 X:9366385-9366407 GGTGATAAGCAGAGTCCTCTAGG + Intergenic
1187285884 X:17903226-17903248 GGTGGACATCAGAGTCCCATGGG + Intergenic
1190107202 X:47569282-47569304 GGTCAACATCAGAGGCATAGTGG + Intronic
1192661031 X:73043154-73043176 GCTAATCATCAGAGGCCTATAGG + Intergenic
1193294975 X:79823205-79823227 GGTGATCATCAGAGACCTATAGG - Intergenic
1193640615 X:84006363-84006385 GGTGATCAGCAGAGACATATAGG + Intergenic
1195017621 X:100794749-100794771 GGTGATCATCAGAGACCTATAGG + Intergenic
1197635589 X:128911409-128911431 GGAGAATATCAGAGGTCTATTGG + Intergenic
1198162768 X:134023998-134024020 GGTGATCATCAAAGGCTTCCAGG - Intergenic
1200036151 X:153332632-153332654 GGTGATCATCAGTGGTGGATTGG + Intergenic