ID: 1160601946

View in Genome Browser
Species Human (GRCh38)
Location 18:80020464-80020486
Sequence GCAACTGCTCAGAGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 6, 2: 12, 3: 44, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160601943_1160601946 4 Left 1160601943 18:80020437-80020459 CCTCATGGCTAACTCAACCATGC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG 0: 1
1: 6
2: 12
3: 44
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160601946 Original CRISPR GCAACTGCTCAGAGGCAAGC TGG Intronic
901643195 1:10703419-10703441 GGAGCTGCTGAGGGGCAAGCAGG - Intronic
903026737 1:20434757-20434779 GCAAAGGCTCAGAGGTAAGAAGG + Intergenic
903259186 1:22122086-22122108 GCAACTCCTCAGAGCCCAGTGGG - Intronic
903376401 1:22869135-22869157 ACAGCTGCTCAGAGCCCAGCTGG + Intronic
904501550 1:30915619-30915641 GCACCTGCTCAGAGGCACACAGG - Intergenic
904874324 1:33642488-33642510 GCAAGTGCTCAGAAGGAGGCAGG + Intronic
905261830 1:36724802-36724824 GCATCAGCCCAGAGGCAACCTGG - Intergenic
906294561 1:44641493-44641515 GCCAGTACTCAGAGGCAAGATGG - Intronic
907265237 1:53255343-53255365 ACAACTCCTGTGAGGCAAGCAGG + Intronic
907524295 1:55045194-55045216 GCAGCTGCTCAGAGGAGAGTAGG + Intronic
908392382 1:63695490-63695512 GCACCTGCCCAGAGGAAAGCCGG + Intergenic
909079735 1:71095692-71095714 GGAAGTGCTCAGAGTCTAGCTGG + Intergenic
910355055 1:86343544-86343566 GCCAATGCTCGGAGGCAGGCAGG - Intergenic
910990176 1:93047786-93047808 CCCATCGCTCAGAGGCAAGCTGG + Intergenic
912756061 1:112325659-112325681 GCAGCTGCTCAGAGGCAGCGTGG - Intergenic
914688974 1:150008906-150008928 GGAGGTGCTCTGAGGCAAGCTGG + Intronic
914922821 1:151859139-151859161 GCTAAGGGTCAGAGGCAAGCTGG + Intergenic
915403265 1:155639845-155639867 GCAACTGCTTGGAGGCAGGCTGG + Intergenic
916115729 1:161483650-161483672 GCTACTGCTCAGAGGCATGCTGG + Intergenic
919866682 1:201788187-201788209 GCAACAACTCTGAGGCAGGCAGG + Intronic
920123831 1:203677908-203677930 GCCTCTGCTCAGGAGCAAGCCGG - Intronic
921082184 1:211750222-211750244 GCAAAGGCTCAGAGGCAAGAAGG - Intronic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
921887657 1:220322632-220322654 GCAAATGCTCAGAGGCAGAAAGG - Intergenic
922336632 1:224623588-224623610 TCATCTGCTCAGAGGCAGTCAGG - Intronic
922685705 1:227637447-227637469 GCCAATGCTCAGAGGCAGGCAGG + Intronic
923471163 1:234292259-234292281 GCCACTGCTGAGAGGCCAGATGG - Intronic
924711575 1:246533852-246533874 GCAACTGCTCAGAGGCATACTGG - Intergenic
1064604394 10:17023638-17023660 GCAACTACTGACAAGCAAGCTGG + Intronic
1065132243 10:22633806-22633828 GCAACTGGGCATAAGCAAGCGGG + Intronic
1066124474 10:32326629-32326651 GAAACTTCTCAGAGGCTAGAAGG + Intronic
1067430131 10:46237313-46237335 GGGATTGCTCAGAGGCAAGAGGG - Intergenic
1068303729 10:55177513-55177535 GCAACTGCCCAGAGGCAGGCCGG - Intronic
1069183188 10:65389190-65389212 GCAATTGCTCAAAGAAAAGCTGG - Intergenic
1072403182 10:95126224-95126246 GCAATATCTCAGAGGCATGCTGG + Intergenic
1072426611 10:95335720-95335742 GCAACTTCTCAGAAGCAACCAGG - Intronic
1074822070 10:117187228-117187250 GCAACTGCACCGAGGCAAGAAGG - Intergenic
1074972511 10:118550719-118550741 GCAACTGGGCAGAGGCAGACAGG + Intergenic
1075650775 10:124127453-124127475 CCAACAGCTCAGAGGCACACTGG - Intergenic
1076007040 10:126956126-126956148 GCAACTGCACAGTGGCAGCCTGG - Intronic
1076212740 10:128661879-128661901 GCAAAAGCCCAGAGGCTAGCTGG - Intergenic
1077310865 11:1888549-1888571 ACAAGTGCTCAGGGGCAGGCAGG - Intronic
1078172380 11:8938078-8938100 GGACCTGGTCAGTGGCAAGCGGG + Exonic
1078443809 11:11389211-11389233 CCAAGTCTTCAGAGGCAAGCAGG - Intronic
1079074429 11:17375011-17375033 GTAACTGCTCAGAGGCAAGCTGG - Exonic
1081446141 11:43133283-43133305 CCTACTGCTCACAGGCAAGCAGG + Intergenic
1082082812 11:48025413-48025435 CCTACTGCTCAGAGGCCAGCAGG - Intronic
1084899881 11:72301711-72301733 GCAAGGGCCCAGAGGCTAGCTGG - Intronic
1085060122 11:73438158-73438180 GCAAATACTCTGTGGCAAGCAGG + Intronic
1087133881 11:94694860-94694882 GAAACAGCTCAGAAACAAGCCGG + Intergenic
1088953191 11:114590743-114590765 GCAATTGCTCAGAGGCATGCTGG - Intronic
1089331313 11:117690866-117690888 GCAGCTGCTCTGATGGAAGCAGG - Intronic
1090755091 11:129783602-129783624 GCAACTGCTCAAAGGCAAGCTGG + Intergenic
1090917192 11:131175951-131175973 GCAAATGCTCAGATAGAAGCAGG - Intergenic
1091256119 11:134187535-134187557 GCAAAAGCTCAGAGGCCAGAAGG - Intronic
1091316007 11:134614538-134614560 CCAGCTGCTCAGTGGCAAGGTGG + Intergenic
1092000408 12:5027101-5027123 GCTACTGCTCAGAGAAAAGGAGG + Intergenic
1093990043 12:25579861-25579883 AAAACTGCTCAGAGGCTCGCTGG - Intronic
1097281019 12:57845710-57845732 GAAACTGGTCAGAGGCAGCCGGG + Intronic
1100172731 12:91994026-91994048 TCAACTGTTCAAAGGGAAGCAGG + Intronic
1101587830 12:106100371-106100393 GCAAATGCTCAGAGGAGAGAAGG - Intronic
1102189567 12:110976777-110976799 GCAAAGGCTCAGAGGCAGGGTGG + Intergenic
1102473304 12:113172560-113172582 GCAGCTGCTCAGAGCAAAGATGG + Exonic
1103794696 12:123495227-123495249 ACAACAGCACAGAGGAAAGCAGG + Intronic
1104043475 12:125145551-125145573 CCAGCTGCTCAGAGGCCTGCTGG - Intergenic
1104828712 12:131733518-131733540 TCCACTGCTCAGAGGCAAGGAGG - Intronic
1106095140 13:26636922-26636944 CCCAGTGCTCAGAGGCATGCTGG - Intronic
1107190863 13:37584010-37584032 GCATCTGCTCTGAGGCCAGATGG - Exonic
1108034033 13:46268751-46268773 GCAAGTTCTGAGAGGCAAGAAGG + Intronic
1112844017 13:103615737-103615759 GCAACTGATCAGAAGGTAGCTGG + Intergenic
1114269494 14:21092225-21092247 CCAACGGCTCATAGGCCAGCAGG + Exonic
1115330742 14:32194812-32194834 GCAATTGCTTAAAGGCAAGGGGG - Intergenic
1115890564 14:38022974-38022996 GCAGCAGTTCAGAGGCAAGATGG + Intronic
1118805604 14:69234087-69234109 GCAACTGGTGATAGGCAAGCTGG - Intronic
1121016333 14:90551576-90551598 GCCATTGATCAGAGGGAAGCAGG + Intronic
1122488180 14:102095438-102095460 GCATCTGCTCTGAGTCAGGCAGG + Intronic
1123768784 15:23508593-23508615 GCCACTGCTCAGAGGCAGGCTGG + Intergenic
1124376844 15:29133930-29133952 GCAAAGGCTCAGAGGGAAGAAGG - Intronic
1125298017 15:38223435-38223457 ACAGCTGCTCAGAGTCAACCTGG - Intergenic
1125742694 15:41977955-41977977 GCAACTGCATGAAGGCAAGCAGG - Intergenic
1125959101 15:43813876-43813898 CCTACTGCTTAGAGGCCAGCAGG - Intronic
1126313389 15:47341499-47341521 ACAATTGCTCAGTGGCAAGATGG - Intronic
1127857731 15:62966559-62966581 GAAGGTGCTCAGAGGCAGGCTGG - Intergenic
1127900325 15:63336294-63336316 GCAGCTGCTTAGACACAAGCCGG + Intronic
1128235572 15:66065081-66065103 GTCACAGCTCAGAGGCAAGAGGG + Intronic
1129090859 15:73148927-73148949 GGAACTACTCAGATGGAAGCAGG + Intronic
1130959771 15:88652115-88652137 GCAGCTCCTGAAAGGCAAGCTGG + Exonic
1133054999 16:3141492-3141514 GCAGGTCCTCAGAGCCAAGCAGG - Exonic
1134227075 16:12399530-12399552 GCATCTCTTCAGAGGCAGGCTGG + Intronic
1136187746 16:28597956-28597978 GCGTGAGCTCAGAGGCAAGCGGG + Intergenic
1136316656 16:29458382-29458404 GCATGAGCTCAGAGGCAAGTAGG - Intergenic
1136431232 16:30197724-30197746 GCATGAGCTCAGAGGCAAGTAGG - Intronic
1139962260 16:70724784-70724806 GCTTCTGCTGAGAGGGAAGCAGG + Intronic
1140573939 16:76141256-76141278 GCAAGTGACCAGAAGCAAGCAGG + Intergenic
1140999962 16:80298852-80298874 GTGACAGCTCAGAGGCAAGAGGG - Intergenic
1141039030 16:80655694-80655716 GCAACACCTCTGAGCCAAGCAGG + Intronic
1141222613 16:82085233-82085255 TCAGCTGCTCAGTGGCAAGATGG + Intronic
1141701142 16:85642713-85642735 GCAACTGCTCAGGGGAACGGTGG - Intronic
1144905672 17:18638460-18638482 GCAACCCCGCAGAGGAAAGCTGG + Intronic
1146059745 17:29598179-29598201 GCCACAGCTCAGAGGCCAACAGG + Intronic
1146262734 17:31432305-31432327 GCAGCAGCTCAGAGGGAGGCGGG - Intronic
1147530917 17:41276193-41276215 GGAACTGATCAGCAGCAAGCAGG - Exonic
1148655245 17:49278315-49278337 GCAACTCCTCAGGGGAATGCTGG + Intergenic
1148849732 17:50548753-50548775 GCAACGGGTCAGAGGGAGGCTGG - Intronic
1149740435 17:59040478-59040500 GCTACTGCTGACAGGCAGGCTGG + Intronic
1151681460 17:75624922-75624944 GCAGCAGCTCGGAGGCAGGCAGG - Intergenic
1152750326 17:82059596-82059618 GCAGCTGCTGAGAGGGAGGCTGG - Intronic
1155225077 18:23722289-23722311 GAAACAGCTCAGAGGGAAGCAGG - Intronic
1156078979 18:33312625-33312647 GCAACAGATCAAAGGCAAGGTGG - Intronic
1157333043 18:46717140-46717162 GCAACTGCTCAGAGAGCAGGGGG - Intronic
1157920260 18:51707062-51707084 GCCAATGCTCAGAGGCACACAGG - Intergenic
1158873572 18:61711574-61711596 GCAACTGCCCTGAGGCATCCAGG - Intergenic
1159045517 18:63366425-63366447 GAAACTGCTCAGAACCCAGCGGG - Intronic
1159355676 18:67335411-67335433 GCCACTGCCCAGAGGCAGGGAGG - Intergenic
1160064037 18:75558328-75558350 GCACCTGGTCAAAGGCAGGCTGG + Intergenic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1160807609 19:999458-999480 GCATTTTCTCAGTGGCAAGCAGG + Intergenic
1161542404 19:4859980-4860002 GGAGCTGATCAGAGGCATGCTGG + Exonic
1161582621 19:5089005-5089027 GCCAGTGCTCAGAGGCAGGAAGG + Intronic
1163378562 19:16949284-16949306 GCATGCGCTCAGAGCCAAGCCGG + Intronic
1163637481 19:18444063-18444085 ACAGCTGCTCAGAGCCAAGGGGG - Exonic
1164090763 19:21949787-21949809 AAAACTGCTCAGAGGCAGGCTGG - Intronic
1164109903 19:22146482-22146504 AAAACTGGTAAGAGGCAAGCTGG - Intergenic
1164194875 19:22947612-22947634 AAAACTGCTCAGAGGCACGCTGG - Intergenic
1164254519 19:23515750-23515772 GCAACTGCCCTGAGGCATCCAGG + Intergenic
1165261388 19:34622121-34622143 GTAACTGCTCAGAGGCAAGCTGG + Intronic
1166426994 19:42687895-42687917 GCAACTGCTCAGAGGCATGCTGG + Intronic
1166864476 19:45827687-45827709 GTACCTGATCAGAGGCAGGCAGG - Intronic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
1168407739 19:56119802-56119824 GGGACTGCGCAGAGGCAGGCAGG + Intronic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
926238758 2:11069248-11069270 GCCATTGGTCAGGGGCAAGCTGG - Intergenic
928278127 2:29920817-29920839 CCAACTGCACGGAGGCGAGCAGG + Exonic
928953791 2:36840246-36840268 TCAACTGATCAGAGGCCAGTGGG + Intergenic
929393635 2:41498152-41498174 GCAACTGGTTAGAGGCATGATGG - Intergenic
929420169 2:41782397-41782419 GCAATGGCTCGGAGGCAAGAAGG - Intergenic
931463356 2:62466839-62466861 TCAACTGCTCAGCTGCATGCGGG + Intergenic
932978536 2:76634331-76634353 GCAACTGCCCAGAGCAAAGGTGG + Intergenic
933703649 2:85273943-85273965 GCTCCTGGTCAGAGGCCAGCAGG + Intronic
934756388 2:96827601-96827623 GCAGCTGCTCACAGGCCACCCGG + Intronic
936102577 2:109595928-109595950 ACAGATGCTGAGAGGCAAGCAGG - Intronic
940989637 2:160084697-160084719 GCAACTGCTCGGAGGCATGCTGG + Intergenic
942658979 2:178244167-178244189 GCAAAGGCTCTGAGGCAAGAAGG - Intronic
943338940 2:186653681-186653703 GCAACTTCACAGAGGTATGCAGG - Intronic
944399468 2:199308762-199308784 GCACCGGCTCAGGGGGAAGCTGG + Exonic
945828208 2:214750485-214750507 ACAGCTGCTCAGAGACAAGGAGG - Intronic
945989719 2:216385205-216385227 GCAACATCTCAGAGGGATGCTGG + Intergenic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
1170134111 20:13054230-13054252 AAGACTGCTGAGAGGCAAGCAGG + Intronic
1170652613 20:18256662-18256684 CCCACTGCTCAGAGATAAGCAGG - Intergenic
1171069044 20:22048461-22048483 GCTACAGCTCTGAGGCAAGAGGG + Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171823167 20:29874085-29874107 TCAACAGATCAGAGGCGAGCGGG - Intergenic
1172128878 20:32642674-32642696 GCAGCTGGTCAGAGGCGGGCAGG + Intergenic
1172185685 20:33029753-33029775 GTAAGAGCTCAGAGCCAAGCTGG + Intergenic
1172438090 20:34944395-34944417 GAAACAGCTCAGGGGCAAGGTGG + Intronic
1172670362 20:36630762-36630784 GCAGCAGCTCAGAGGGAGGCAGG + Intronic
1173089417 20:39955946-39955968 CCATCTGCTGAAAGGCAAGCAGG + Intergenic
1173228942 20:41179236-41179258 GCAACTGCTCAGAAGCACAGCGG + Exonic
1174335738 20:49859147-49859169 GCCACTGCTGAGACCCAAGCTGG + Intronic
1177674907 21:24284661-24284683 GCCACCCCTCAGAGGCAGGCAGG + Intergenic
1178819223 21:35960067-35960089 GCAAAGGCTCTGAGGCAAGATGG - Intronic
1179143026 21:38743968-38743990 GGAACTGACCAGAGGCACGCTGG + Intergenic
1179902375 21:44400863-44400885 GCACCTCCTCAGAGGCTTGCTGG + Intronic
1180230155 21:46422232-46422254 GCAGGTGCTCAGAGGCACCCAGG - Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181398543 22:22637636-22637658 GCAGCTCCCCAGAGGGAAGCAGG + Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1181768408 22:25108744-25108766 ACAAGTGCCCAGAGGCAAGTAGG - Intronic
1184417444 22:44360509-44360531 GCAAAGGCTCAGAGGCAGGAAGG + Intergenic
1185109252 22:48891755-48891777 GTGACTGATCAGAGACAAGCTGG - Intergenic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
949416902 3:3824985-3825007 TCAACTGATCAAAAGCAAGCAGG - Intronic
949689218 3:6615381-6615403 GTGTCTACTCAGAGGCAAGCTGG - Intergenic
949991160 3:9580356-9580378 GCAACTGCTTGGAGGCAAAAGGG + Intergenic
952851963 3:37736970-37736992 GTTACTGCTCAGAGGTAAGGGGG + Exonic
953234849 3:41097111-41097133 CAAACTGCTCAGAGTCAAACAGG + Intergenic
960381972 3:116974022-116974044 GGAAATACTCAGAGGGAAGCTGG - Intronic
960578030 3:119246254-119246276 GCACCAGCTCAGAGCCTAGCTGG + Intergenic
961056224 3:123790867-123790889 GCAACTTCACGGAGGAAAGCAGG + Intronic
961452124 3:127007019-127007041 GCAACTGCCGTGAGCCAAGCAGG + Intronic
961528825 3:127526948-127526970 GCAACTGCTCAGGGGCAGATGGG - Intergenic
961810290 3:129518218-129518240 GCCACAGCTGAGAGGAAAGCTGG - Intronic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
962488400 3:135866858-135866880 GCAGATACTCAGAGGCAGGCAGG + Intergenic
965197585 3:165621435-165621457 GAGACTGCTCAGGGGCAAGCTGG + Intergenic
966120004 3:176510696-176510718 GCAATGGCTCAGAGACATGCTGG + Intergenic
967303888 3:188042300-188042322 CTGACTGCTCAGAGACAAGCAGG + Intergenic
967392573 3:188971684-188971706 GCAGCTGCTGAGAGGCACCCAGG - Intronic
968172898 3:196524613-196524635 GCAATGGCTCAAAGGCATGCTGG - Intergenic
968698757 4:2044902-2044924 GCACCTGCTCAGAGGCTGGGAGG + Intergenic
968968672 4:3782215-3782237 GCAGCTGCTCAGGGGCCAGTGGG - Intergenic
969499875 4:7546224-7546246 GCAACAGCTCAGAGGCATCCAGG + Intronic
970918399 4:21363591-21363613 TCAAATTCTCAGTGGCAAGCTGG + Intronic
972702156 4:41504444-41504466 GGAACTGCTCAGATGCAAAAAGG - Intronic
973564816 4:52173869-52173891 GCAGCTGCTTAGTGGCAAACTGG + Intergenic
974611976 4:64229316-64229338 GCAAGTGCCCAGAAGCAGGCTGG + Intergenic
975414212 4:74088936-74088958 GCAACTGCCCTGAGGCATTCAGG - Intergenic
976398368 4:84582284-84582306 ACCACTGCTCAGAGACTAGCTGG + Intergenic
976921886 4:90452496-90452518 GCAACTGCCAAGAGGCAGGCTGG + Intronic
978888147 4:113790624-113790646 GGAACTTCTCAGTGGGAAGCTGG - Intergenic
981128795 4:141134848-141134870 GCAACTGCTCAGAACCTAGCCGG - Intronic
984407551 4:179352562-179352584 GAAATTGCTCAGAGGAAACCTGG - Intergenic
985507385 5:291323-291345 GCAGATGCTCAGAGCCATGCAGG - Intronic
985703262 5:1386231-1386253 GAACCGGCTCAGAGGCCAGCAGG - Intergenic
985740587 5:1613812-1613834 GCAGATGCTCAGAGCCATGCAGG + Intergenic
985920942 5:2973071-2973093 ACAACTGCTAAGAGAGAAGCCGG + Intergenic
985921750 5:2983005-2983027 GCAACTGCCCACAGGCTAGGTGG - Intergenic
985997335 5:3604273-3604295 GCAGCTGCTCTGTGGCCAGCAGG + Intergenic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
991166277 5:63567684-63567706 GCAACTGCTCAGAGGCAGGGTGG - Intergenic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
992197906 5:74357817-74357839 GCCACTGCTCAGGGGTAAGCAGG - Intergenic
992671892 5:79069646-79069668 GCGCCTGCTCCGAGGCCAGCGGG + Exonic
994774892 5:104028491-104028513 GCAACTCCTCAGAGGCAGACTGG - Intergenic
995417021 5:111923649-111923671 GCAACTGCCCAGAGGCAGGCTGG + Intronic
995715743 5:115080559-115080581 GCAACATTTCAGAGGCATGCTGG + Intergenic
996410660 5:123155466-123155488 ACAACTGCCCAGAGGCATTCGGG - Intronic
999197502 5:149792375-149792397 GCAGCTCCCCAGAGGCAAGAAGG + Intronic
999248636 5:150168332-150168354 GCATCTGCCCCGAGGCAAGCTGG - Intronic
1000095180 5:157965410-157965432 ACCAGTGCTCAGAGGCTAGCAGG + Intergenic
1001398197 5:171431505-171431527 GCAACTACACAGAGGCAACGAGG - Intronic
1001425052 5:171617472-171617494 GCAGCTGCTCAGAGGCATCTGGG + Intergenic
1001723104 5:173872833-173872855 GTGACAGCTCAGAGGCAAGGAGG - Intergenic
1003192199 6:3884151-3884173 GCAGCTGCTCAGATGCACACAGG + Intergenic
1004141895 6:13025896-13025918 GCAACTGCTCAGAATGAAGTTGG + Intronic
1005490618 6:26343998-26344020 GCCACTGACCAGAGGCAAGATGG - Intergenic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1009242195 6:61196867-61196889 GCAACTGCCTGGAGGCAGGCTGG + Intergenic
1009626304 6:66142180-66142202 GCAACTGCCCAGAGACAGGCTGG + Intergenic
1010573822 6:77508936-77508958 GCAATGGCTCAGAGGCATGCTGG + Intergenic
1011700910 6:89953831-89953853 TCAACTGATCAAAGGCAGGCAGG + Intronic
1012418178 6:99032613-99032635 GCAGCTGCTGAGTGGCAAGAAGG - Intergenic
1012978073 6:105801513-105801535 GAAACTTCACAGAGGGAAGCAGG + Intergenic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1016292593 6:142540655-142540677 GCCAATGCTAAGAGGCAGGCAGG - Intergenic
1017574091 6:155782287-155782309 GTAACTGATCAGAAGCTAGCAGG - Intergenic
1019526685 7:1483554-1483576 CCAAGTGCTCAGAGACACGCGGG + Intronic
1019768707 7:2870150-2870172 GCTACAGCTCAGAGGCGAGGCGG + Intergenic
1020763355 7:12293214-12293236 GCAACTGCCCAGAGGTAGGCTGG - Intergenic
1022613037 7:31896162-31896184 GCAACTCCTTAGTGGCAGGCAGG + Intronic
1023629081 7:42145575-42145597 GAAACTGGTCTCAGGCAAGCAGG + Intronic
1024141304 7:46465804-46465826 GCAACTGTTTGGAGGAAAGCTGG + Intergenic
1026541427 7:71282985-71283007 GGATCTGCTCAGAGCCAAGGTGG + Intronic
1026946272 7:74318195-74318217 GCAAATGCTCAGAGGCAGAAAGG + Intronic
1027243873 7:76352464-76352486 ACCCCTGCTCAGAGGAAAGCTGG + Intronic
1028251393 7:88543252-88543274 GCAATGGCTCAGAGGCATGCTGG + Intergenic
1028444394 7:90903890-90903912 GCATTTGCTCAGACGCAAGGAGG + Intronic
1032398641 7:131608446-131608468 GCAACTGCCCAGGGGCAGTCAGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034231301 7:149530686-149530708 GCAACTGCTCAGAAGCAGGCTGG - Intergenic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1035092900 7:156329281-156329303 GCATTTGCTGAGAGGCAAGGTGG - Intergenic
1035635465 8:1140489-1140511 GCACCTGCTCAGAGGCCTCCTGG + Intergenic
1035702684 8:1648668-1648690 GCAGCTGCTCAGAGACCCGCAGG + Intronic
1035775187 8:2182377-2182399 CCAAATGCTCAGAGGCCACCTGG - Intergenic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1037804419 8:22051067-22051089 CCAGGCGCTCAGAGGCAAGCAGG - Intronic
1038554497 8:28497809-28497831 GCAACTGTGAAGAGGAAAGCAGG - Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1038854508 8:31316740-31316762 GCATATGCTCAGAGAAAAGCGGG + Intergenic
1039010642 8:33089385-33089407 ACAACTGCTATGAGGCAAGCAGG + Intergenic
1040463135 8:47669419-47669441 GCTGCAGCTCAGAGGCAGGCTGG - Intronic
1040466112 8:47696890-47696912 GCATTTGCTCAGAGGAAAGCTGG - Intronic
1040536879 8:48318395-48318417 GCAGCTGCACTTAGGCAAGCTGG + Intergenic
1041582466 8:59477426-59477448 GCAACTGGGCAGAGGCCATCAGG + Intergenic
1041829077 8:62132467-62132489 GCACCTGGTCAGGGGCATGCTGG - Intergenic
1042158322 8:65867343-65867365 ACCAATGCTCAGAGGCAGGCAGG - Intergenic
1046214898 8:111131340-111131362 GGAACTGCTGAGAGCCAAGGTGG + Intergenic
1047209823 8:122832359-122832381 GCCAATGCTCAGAGGCAGGCAGG + Intronic
1048545389 8:135381992-135382014 GAAAATGCTCAGAGGCATTCTGG - Intergenic
1049653373 8:143787039-143787061 GAAACTGCTCAGAAGCAGGATGG + Intergenic
1049749909 8:144278167-144278189 GCCACTGGGCAGAGGCAGGCGGG + Intronic
1050703023 9:8362724-8362746 GCATCTTCTCAGAGGAAAACTGG - Intronic
1052025316 9:23567527-23567549 GTGACTGCTCAGATGCAAGAGGG - Intergenic
1053079448 9:35162211-35162233 GCACCTGCTGAGAGGAAAGAGGG + Exonic
1053749552 9:41237509-41237531 TCAACAGATCAGAGGCGAGCGGG + Intergenic
1054254996 9:62802389-62802411 TCAACAGATCAGAGGCGAGCCGG + Intergenic
1054336313 9:63813216-63813238 TCAACAGATCAGAGGCGAGCCGG - Intergenic
1054773513 9:69105293-69105315 GCCACTGCTCAGAGAGAAGGTGG + Intergenic
1055235742 9:74120715-74120737 TCAACTGCTGTGAGGCAGGCAGG + Intergenic
1055603746 9:77947133-77947155 CCAACTCCCCAGAGGCCAGCTGG + Intronic
1056032162 9:82564317-82564339 GCAAAGGCTCAGAGGCAGGAGGG - Intergenic
1056084909 9:83137820-83137842 GTAAATGCTCAGAGGCAGGAGGG + Intergenic
1056725119 9:89107514-89107536 GCACATGCACACAGGCAAGCTGG + Intronic
1057379110 9:94553312-94553334 GCAACTGCTCCCAGCCAGGCTGG - Intergenic
1060540090 9:124423538-124423560 GCAAATGCTCTGAGGAAAACAGG + Intergenic
1061593350 9:131613167-131613189 CCCACTGCACAGAGGAAAGCGGG + Intronic
1061886731 9:133594858-133594880 GCAAAGGCCCAGAGGCAGGCAGG + Intergenic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1062247214 9:135575341-135575363 GTGACTGCTCAGAGGCCAACGGG + Intergenic
1062451408 9:136617254-136617276 GCAACAGATCAGAGACAGGCAGG - Intergenic
1062466652 9:136684585-136684607 GCCATTGCTCAGGGGCAAGATGG + Intronic
1203376242 Un_KI270442v1:380634-380656 TCAACAGATCAGAGGCGAGCAGG - Intergenic
1185513743 X:682773-682795 GCAACTTCTGAGATGCAAGCAGG + Intergenic
1186184052 X:7002763-7002785 GGAACTCATCAGAGGGAAGCCGG + Intergenic
1187305706 X:18093528-18093550 GCATCTGCTCTGAGCCAAGAGGG - Intergenic
1188765828 X:34089418-34089440 GCAACTGCCCGGAGGCATACTGG - Intergenic
1189462063 X:41250890-41250912 ACAACTGCTCACAGCCCAGCTGG + Intergenic
1190196396 X:48323046-48323068 GTAACGGATCAGAGGCCAGCTGG - Intergenic
1192140532 X:68644119-68644141 GCAACTGTGCACAGGCAAGCAGG - Intergenic
1192178842 X:68902887-68902909 CCTACTGCACAGAGCCAAGCAGG - Intergenic
1192584076 X:72306468-72306490 GCGGCTTCTCAGAGGTAAGCCGG - Exonic
1193348145 X:80428379-80428401 GCAACTTCTTAGAGGCAGGCTGG + Intronic
1193560453 X:83011135-83011157 GTAACTGCTTGGAGGCATGCTGG + Intergenic
1193864876 X:86719612-86719634 GCAACTGTTCACAGGGCAGCAGG + Intronic
1194123740 X:89989852-89989874 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1195708714 X:107757353-107757375 GGAACTGCTCTGAGGGAGGCAGG + Intronic
1195884409 X:109624624-109624646 GCAGCCCCTCGGAGGCAAGCTGG + Exonic
1197097690 X:122614808-122614830 GCAACTGCTTGGAGGCAGGTGGG - Intergenic
1199673483 X:150165815-150165837 GCAGGTGGTCAGAGGCAATCTGG - Intergenic
1200393522 X:155968539-155968561 GCAACTGCTCAGGAGGAAACAGG - Intergenic
1200476626 Y:3647473-3647495 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1201065804 Y:10092945-10092967 TCAACAGATCAGAGGCAAGCGGG + Intergenic
1201337248 Y:12894145-12894167 GCAACTGCTCAGAGGCAGGCTGG - Intergenic
1201958209 Y:19649176-19649198 ACAACTGCTTGGAGGCAAGCTGG + Intergenic
1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG + Intergenic