ID: 1160603139

View in Genome Browser
Species Human (GRCh38)
Location 18:80029715-80029737
Sequence TGGAGTTTAAGCAGCACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160603139_1160603148 27 Left 1160603139 18:80029715-80029737 CCCCTAGTGCTGCTTAAACTCCA 0: 1
1: 1
2: 2
3: 5
4: 107
Right 1160603148 18:80029765-80029787 TCCTCAAGAAATAATAACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 266
1160603139_1160603142 -8 Left 1160603139 18:80029715-80029737 CCCCTAGTGCTGCTTAAACTCCA 0: 1
1: 1
2: 2
3: 5
4: 107
Right 1160603142 18:80029730-80029752 AAACTCCAATCCACCCCTTTTGG 0: 1
1: 0
2: 2
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160603139 Original CRISPR TGGAGTTTAAGCAGCACTAG GGG (reversed) Intronic
900967281 1:5967451-5967473 TGGAGTTTAGAAAGCTCTAGTGG - Intronic
903285443 1:22273987-22274009 TGGGCTTTAAGCAGCATTGGAGG + Intergenic
903308303 1:22430467-22430489 TGTAGTTTCAGCTACACTAGAGG + Intergenic
904079139 1:27861086-27861108 TTGAGTGTAAGCTCCACTAGGGG + Intergenic
919585540 1:199434548-199434570 TGGAGATGAAGGAGCAATAGTGG - Intergenic
921286278 1:213612250-213612272 TGGAGATTATGTAGCACAAGTGG - Intergenic
922388114 1:225108568-225108590 TGGAGTTCAAACAGCTCTATAGG - Intronic
923728177 1:236524997-236525019 TCGACTTTAAGCAGAACTAAAGG - Intronic
1063235729 10:4113629-4113651 TGCAGTTAAAGCAGTACTCGGGG + Intergenic
1065009303 10:21407163-21407185 TGGAGTTTAAGCCTCACAGGAGG - Intergenic
1067090952 10:43265750-43265772 TGGACTCTAAGCGGCTCTAGGGG - Intronic
1068852483 10:61759886-61759908 TGGAGCTCAAAAAGCACTAGAGG + Intronic
1073906071 10:108281122-108281144 TGGAATTTAAGTAGCACTTCTGG - Intergenic
1077707566 11:4502673-4502695 AGGAGTTTAGGCAGAACAAGAGG - Intergenic
1088739546 11:112755929-112755951 TGGAGTTAACACAGCCCTAGAGG + Intergenic
1093587222 12:20853861-20853883 TGCAGTGGAAGCAGCACTAAAGG - Intronic
1093613075 12:21186514-21186536 AGCAGTTTCAGCATCACTAGTGG - Intronic
1093789401 12:23230232-23230254 TGGACTTTGAGCAGTTCTAGGGG - Intergenic
1096960606 12:55573078-55573100 TGGGGTTGAAGGATCACTAGAGG + Intergenic
1106410749 13:29509866-29509888 ATGAGTTTAAGGAGCACTAAGGG - Exonic
1117175520 14:53142349-53142371 TGCAGTTAAACCAGCAGTAGTGG - Intronic
1117610883 14:57482201-57482223 TGGAGTTTATGATGCACTGGCGG - Intronic
1121186538 14:91976850-91976872 TGGAATTTAAGCAGTATTAAAGG + Intronic
1123798651 15:23798679-23798701 TGTAGTTTAAGGAGCACATGGGG + Intergenic
1123975014 15:25545143-25545165 GGGAGTTTAATCAGCATTACTGG - Intergenic
1124345911 15:28921476-28921498 TGGAGTTCCAGCTGCTCTAGAGG + Intronic
1124441875 15:29691361-29691383 TGGATTTGAAGCAGGAATAGTGG + Intergenic
1128968656 15:72086680-72086702 TGGGGTGTAAGCTGCAATAGGGG + Intronic
1138141099 16:54569142-54569164 TGGAGTTTCAGAAGCTTTAGTGG - Intergenic
1146582132 17:34047947-34047969 TGGAGTTTAAGCATTATTTGAGG - Intronic
1203174641 17_KI270729v1_random:115-137 TGGAATTGAATCAGCACGAGTGG - Intergenic
1156334687 18:36158934-36158956 TGGGGTTTAAGTACCACTATGGG - Intronic
1158929866 18:62313644-62313666 TGGAGATTAAGCAGAGCAAGGGG + Intergenic
1159245868 18:65804371-65804393 CAGAGTTTAAGAAGTACTAGAGG + Intronic
1160138041 18:76290928-76290950 TGGAGTTCAAGCAACTCTATAGG - Intergenic
1160603139 18:80029715-80029737 TGGAGTTTAAGCAGCACTAGGGG - Intronic
928081833 2:28318914-28318936 TGGAGTTTGGGCAGCCCTACAGG - Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
929870064 2:45751767-45751789 TGGAGTTAGAACAGCACTGGGGG - Intronic
931675483 2:64691724-64691746 TGCAGTTAAAGCAGTACTTGAGG - Intronic
932084423 2:68745708-68745730 TTTAGTTACAGCAGCACTAGTGG - Intronic
934710452 2:96510786-96510808 TGGAGTTCCAGCAGCACTTTTGG - Intergenic
937796994 2:126035616-126035638 GAGGGTTTAAGAAGCACTAGAGG - Intergenic
938704233 2:133907083-133907105 TGGAGTCTAAGAAGAACTACAGG + Intergenic
939575634 2:143891893-143891915 TGGAGGCTAAAGAGCACTAGAGG + Intergenic
943988259 2:194652157-194652179 TGGAGTTTCAGTATCACCAGTGG + Intergenic
948035657 2:234856418-234856440 TGGATTATAAGCAACTCTAGAGG + Intergenic
1171304905 20:24096818-24096840 TGGATTTTAAGGAGCAAGAGTGG - Intergenic
1174290088 20:49502168-49502190 TGGAGCTTAAGCAGCCATAACGG + Intergenic
1175567413 20:59991413-59991435 TGCAGATGAAGCAGAACTAGAGG - Intronic
1177110475 21:17021414-17021436 TGGAGTTTAATTAGCAGTATGGG - Intergenic
1178743692 21:35226961-35226983 GGGAGTTTAAGGAGGACTTGGGG - Intronic
949452165 3:4197837-4197859 TGGAGTTGAAGCAGCGATAGTGG - Intronic
952841573 3:37651188-37651210 TGGAAATTCAGCAGCACTGGAGG + Intronic
956547546 3:70421394-70421416 TGGAGCATAAGAACCACTAGAGG - Intergenic
956725638 3:72154573-72154595 TGGAGCTTCAGCAGCTCTACTGG - Intergenic
957061096 3:75481920-75481942 TGGAGTGTAGGCAGGACTCGTGG + Intergenic
957174627 3:76790423-76790445 TGTAGTTCAATTAGCACTAGTGG - Intronic
957218662 3:77353960-77353982 TGGAGTTGAAGGAGCAGTGGTGG - Intronic
958845089 3:99256837-99256859 TGGAGTTTACACAGCTATAGGGG + Intergenic
961084083 3:124051701-124051723 TGGAGTTCAAACAGCGCTAGGGG + Intergenic
964881900 3:161432301-161432323 TGAAGATGAGGCAGCACTAGGGG + Intergenic
965377047 3:167937832-167937854 GGCAGCTAAAGCAGCACTAGAGG + Intergenic
965439272 3:168692518-168692540 TGGAGTTAAAGCAGAATAAGTGG + Intergenic
970516093 4:16831803-16831825 TGGAGTATCAGCAGAAGTAGTGG + Intronic
974439909 4:61902597-61902619 TGGAGTTTAGGCAGCTGGAGAGG - Intronic
975661985 4:76697340-76697362 TGGAAATTAAGCAGCCCTGGTGG + Intronic
983585166 4:169346581-169346603 TGGGGTTTAATCAGCATCAGTGG + Intergenic
984872986 4:184343783-184343805 TGGAGTTTCAACAGCAGTGGGGG - Intergenic
987311009 5:16681121-16681143 TAGTGTTTAAGCCGTACTAGAGG - Intronic
987734693 5:21825371-21825393 TGGAGTTTAAGAAGAAAAAGTGG - Intronic
988827478 5:34952633-34952655 AGGAGTTCAAGCAGAACAAGAGG + Intronic
988927033 5:36000154-36000176 TGGGGTGTAAGCAGCACTAGGGG - Intergenic
992906544 5:81351886-81351908 AGGAGCTTAAACAGCACTATAGG + Intronic
993864762 5:93179112-93179134 TGTAGTCTAAGCACCACTAATGG + Intergenic
993938423 5:94030541-94030563 TGGAGTTGTAGCAGCAGAAGTGG - Intronic
995600188 5:113787825-113787847 AGGAGTTTGGGCTGCACTAGAGG + Intergenic
995922386 5:117329763-117329785 TCGAGTCTAAGCAGGACCAGAGG + Intergenic
995948181 5:117676127-117676149 AGGAGTTTAAAAAGCATTAGTGG - Intergenic
996352770 5:122563922-122563944 TGGATTTCAAGCAGAACCAGAGG + Intergenic
1000664526 5:163979071-163979093 AGGAGTTTGAGCAGCAGCAGGGG - Intergenic
1001918081 5:175578280-175578302 TAGAGTGAAAGCAGCCCTAGAGG + Intergenic
1003761641 6:9185152-9185174 TGGAGACCCAGCAGCACTAGAGG - Intergenic
1015951891 6:138561630-138561652 TCAAGTGTATGCAGCACTAGGGG + Intronic
1018258338 6:161944333-161944355 TGGAGTTGAAAGAGCACTACAGG - Intronic
1018486140 6:164242927-164242949 AGGAGTTTACGCAGCACGGGAGG - Intergenic
1020750240 7:12131614-12131636 TGGAGTTTGATCAGCAATTGTGG + Intergenic
1021010452 7:15457897-15457919 TCAATTTTAAGCATCACTAGTGG - Intronic
1021086881 7:16431305-16431327 CAGATTTTAAGCAGCACTAAAGG + Intergenic
1021299248 7:18951628-18951650 TGGAGATTAATCAGCATTACTGG - Intronic
1022443062 7:30449531-30449553 TGGAGTTTGAGCAGCCCTCTTGG + Intronic
1022864586 7:34404750-34404772 TAGGGTTTTAGCAGCTCTAGTGG - Intergenic
1024920648 7:54550371-54550393 TGGAAATGAAGCACCACTAGGGG - Intronic
1028361989 7:89979094-89979116 TGGAATGTAAGCAGAAGTAGTGG - Intergenic
1028674485 7:93442931-93442953 TGGACTTTCAGCAGCCCTGGGGG + Intronic
1032620516 7:133526064-133526086 TGGAGCCTCAGCAGCACTATAGG - Intronic
1038201965 8:25421388-25421410 TGGTGGTTAGACAGCACTAGGGG - Intronic
1038222818 8:25626976-25626998 TGGAGCTTAAGGAACACAAGTGG + Intergenic
1039939065 8:42073394-42073416 TGGAGTTTGAGCAGCTCAAGAGG - Intergenic
1041104318 8:54426412-54426434 TGGACTTTAAACAGTACTTGTGG + Intergenic
1041359046 8:57030901-57030923 TGGAATTTCAGCACCAGTAGTGG - Intergenic
1045241699 8:100408294-100408316 TGGAGCTCAAGCAGCTATAGTGG + Intronic
1047742783 8:127820189-127820211 GGGAGTTTAATCAGCAAGAGTGG + Intergenic
1047778304 8:128091572-128091594 TAGAGTCTAAGCAGCACTTCTGG - Intergenic
1054973819 9:71119948-71119970 GGGAGTTTGAACAGCACTTGGGG + Intronic
1058700004 9:107592060-107592082 GGGAGTTTTAGCAGCAGGAGAGG + Intergenic
1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG + Intergenic
1186724653 X:12344368-12344390 TGGAATTTGAGCAGTACTGGAGG - Intronic
1189951867 X:46240631-46240653 TGCAACTAAAGCAGCACTAGAGG + Intergenic
1190366773 X:49702262-49702284 TGGTGTTCAAGCAGCAGTGGTGG - Intergenic
1191140893 X:57115578-57115600 TGGAGTTTAGGTAACACTGGCGG + Intergenic
1193268411 X:79500567-79500589 AGGAGTTTAAACAACTCTAGAGG + Intergenic
1193640811 X:84007954-84007976 TGGAGTGTAAGCAGCACTAGGGG - Intergenic
1195017939 X:100796999-100797021 CGTAGTATAAGCAGCACTAGGGG - Intergenic
1198677937 X:139150825-139150847 TGGAGTCAAAGCAGAATTAGGGG - Intronic
1199529130 X:148827141-148827163 TGGAGTTTCAGCTGTATTAGCGG + Intronic