ID: 1160603559

View in Genome Browser
Species Human (GRCh38)
Location 18:80032901-80032923
Sequence GGGAACAATCAGATGGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160603559 Original CRISPR GGGAACAATCAGATGGGCTA GGG (reversed) Intronic
906613862 1:47221972-47221994 GCAAACAGTCAGCTGGGCTAGGG - Intronic
910147470 1:84099005-84099027 GGGTAGAATGAAATGGGCTAAGG + Intronic
915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG + Intronic
915920186 1:159970352-159970374 AGGAATATTCAGAGGGGCTATGG + Intergenic
916259830 1:162830455-162830477 GGCAACAATCAGATGGCATATGG + Intronic
916632978 1:166637058-166637080 GGGAATAGGCAGAGGGGCTATGG - Intergenic
916703539 1:167322807-167322829 GGAAACAAAGAGATGGGCTCTGG + Intronic
919810486 1:201405983-201406005 GGTGACATACAGATGGGCTAAGG - Exonic
921223714 1:212995822-212995844 GGGAACAAACAGAGGGGAAAAGG + Intronic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
921802193 1:219414147-219414169 GGGAAAAATCGAAAGGGCTAAGG - Intergenic
1064302020 10:14131377-14131399 GGGCACAGTGAGTTGGGCTAAGG - Intronic
1067051571 10:43024613-43024635 GGGAAGACTCAGAGGGGCTGGGG - Intergenic
1072538231 10:96379204-96379226 GGGAACAATCAGAGGGGGAAGGG - Intronic
1076239747 10:128895540-128895562 GGCAACTAACAGGTGGGCTATGG + Intergenic
1076248701 10:128967490-128967512 AGGGACAATGAGAGGGGCTACGG + Intergenic
1079427416 11:20356813-20356835 AGGAACAACCAGATGGGCAGAGG - Intergenic
1080294576 11:30711953-30711975 AGGAACAACTAGATGAGCTATGG - Intergenic
1081525086 11:43922443-43922465 GGGAACAAACAGGTGGCCTGTGG - Intergenic
1085982111 11:81737441-81737463 TGAAACAATCAGATGGGATGGGG + Intergenic
1086159982 11:83711242-83711264 AGGGACAATCACATGGGATAGGG + Intronic
1086731554 11:90256600-90256622 GGGATCAGTCAGAGGGGTTAGGG + Intergenic
1089550969 11:119277330-119277352 GGGAACAAACAGGTGGCCCATGG - Intronic
1091670205 12:2447081-2447103 GGGGATAAGGAGATGGGCTAAGG + Intronic
1092031657 12:5291275-5291297 GGGAAAATTAAGATGGGCTTGGG + Intergenic
1092208580 12:6631833-6631855 GGGAACAATGAGAAGGGCAGGGG + Intronic
1092727898 12:11501904-11501926 GGGAACAATGACATGGGGGATGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1094479978 12:30874071-30874093 GGGGACAATCAGACTGTCTATGG - Intergenic
1097241275 12:57576974-57576996 GGGAAAAATATGATGGGGTAGGG + Intronic
1099640891 12:85282078-85282100 GGGAAGCATCAGAGAGGCTAAGG - Intronic
1102708731 12:114906257-114906279 AGGATCAATAAGATGGGCTGAGG + Intergenic
1106459579 13:29957199-29957221 GGCAACACTCAGAAGGGCCAGGG + Intergenic
1106890695 13:34242396-34242418 GGGAAGGATCAGACTGGCTATGG - Intergenic
1107764374 13:43718365-43718387 GGGAACTACCAGATGGGAGAGGG + Intronic
1110131152 13:72012572-72012594 GGGAACTACTAGAGGGGCTAGGG + Intergenic
1113117199 13:106886108-106886130 GGGAAGAAACAGAAGAGCTAAGG + Intergenic
1117306371 14:54479025-54479047 GGTAACAATCACATGGGCTAAGG + Intronic
1120578259 14:86211397-86211419 GTGAATAATCAGAAGTGCTAAGG + Intergenic
1120729317 14:87984201-87984223 GGGAACACTGGGATGGGCAAAGG + Intronic
1122398726 14:101454222-101454244 GGGAACAAAGAGATGAGCAATGG - Intergenic
1124559478 15:30758485-30758507 GGGAACAAAAAGGTGGTCTAGGG + Intronic
1124671772 15:31647233-31647255 GGGAACAAAAAGGTGGTCTAGGG - Intronic
1125916978 15:43496461-43496483 GGGAAGAATAAGCTGGGCTAGGG - Intronic
1128236941 15:66074106-66074128 GGGAAGGAGAAGATGGGCTAGGG - Intronic
1128297853 15:66540181-66540203 GTGAAAATTCAGATGGTCTATGG - Exonic
1129113673 15:73352930-73352952 GGGAACACACAGTTGGGCAAGGG + Intronic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1138320184 16:56105094-56105116 GGGAAAAATCAGAGGGGATTTGG - Intergenic
1139173936 16:64663932-64663954 GGGAAGAATCTGATGGCTTAGGG - Intergenic
1141400840 16:83745492-83745514 GGGAACACTCGGAGGGGCTCTGG + Intronic
1143767346 17:9146370-9146392 GAGAACAATGAGATGAGCTCAGG - Intronic
1143931025 17:10425182-10425204 GGGAACAATCAGATGTCCATCGG + Intergenic
1145355796 17:22148586-22148608 GGGAAGAAACACATGGGCTCAGG - Intergenic
1155718258 18:28973918-28973940 GGGTACAGTCAGATGGGAGATGG + Intergenic
1157010374 18:43641129-43641151 GAGAAAAATCAGATGGGCTGTGG + Intergenic
1157724938 18:49957203-49957225 GGGAACATTGAGAGGGGCTCAGG - Intronic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1160603559 18:80032901-80032923 GGGAACAATCAGATGGGCTAGGG - Intronic
1165931659 19:39363039-39363061 GGCACCAGTCAGAGGGGCTAGGG - Intronic
1165968280 19:39603351-39603373 GGGAAGAACTGGATGGGCTAGGG - Intronic
1168259607 19:55186059-55186081 GTGAACCAGCAGATGGGCTGGGG + Intronic
925613766 2:5725850-5725872 GGGAACAATCACGTCAGCTAGGG + Intergenic
932128428 2:69166405-69166427 GGGAAAAATGAGATGGAATATGG - Intronic
932185667 2:69693467-69693489 GGGCTCAAGCAGATGGGCTTTGG + Intronic
938582932 2:132663671-132663693 TGAATCAATCAGATGGGCTATGG - Intronic
939571522 2:143845927-143845949 GGGCACCATCTGATAGGCTAAGG + Intergenic
1171851155 20:30309085-30309107 GTGAACAATCAGTTGAGATAAGG + Intergenic
1172151882 20:32796575-32796597 GGGAACATCAAGATGGGCAAGGG - Intronic
1172358020 20:34293109-34293131 AGGAAGAATGAGATGGGGTATGG - Intronic
1173109860 20:40176490-40176512 GGGAAGAATCAGATGGTCTAAGG + Intergenic
1173324180 20:42017531-42017553 GGGAGCAGTCAGATGTGCTCAGG - Intergenic
1173933594 20:46842117-46842139 GGAAACAACCAAAAGGGCTATGG + Intergenic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
1180609066 22:17084333-17084355 GGGGACAATAAAATGGGATATGG + Intergenic
1184462268 22:44645924-44645946 CGGAACCATCAGATGAGCTGTGG - Intergenic
950886140 3:16364582-16364604 GGTCACAATGAGATGGGCTTAGG + Intronic
952627157 3:35419753-35419775 CGGGACACTCAGATGGCCTATGG + Intergenic
958114900 3:89203007-89203029 GTGAAAAACCAGATGGGATAAGG + Intronic
960531043 3:118765072-118765094 GGAAACAACCATATGGGCCAAGG + Intergenic
966653905 3:182331657-182331679 AGGTACAAGCAGATGGGCAAAGG - Intergenic
968945466 4:3661295-3661317 GGGGACAACCAGACGGGCTCTGG - Intergenic
969510130 4:7612899-7612921 GGGAACAAGAAGAAGGGCTGGGG + Intronic
969643078 4:8410906-8410928 GTGAACTAGCAGATGGGCTGTGG + Intronic
971416879 4:26439837-26439859 GGGAACTTGCAGATGGGCTGAGG + Intergenic
978038385 4:104025950-104025972 AGGAACAATGAGGTGAGCTAAGG + Intergenic
978138695 4:105293799-105293821 GGGGACAATCAGGTTGCCTAAGG + Intergenic
984802856 4:183730704-183730726 AGGAAGAAGCAGATGAGCTACGG + Intergenic
990059700 5:51632186-51632208 AGCAACAATCAGATAGGCTATGG - Intergenic
990977091 5:61569714-61569736 GGGAAAAATCTAAAGGGCTATGG - Intergenic
994020525 5:95018890-95018912 GGCCACAATCAGATGGGTAAGGG - Intronic
995947690 5:117669634-117669656 GGGAACACTCAGATGAACTGGGG - Intergenic
998511861 5:142720408-142720430 GGGACCAGTCAGAGGGGCTGGGG + Intergenic
999778012 5:154826223-154826245 GTGAACAATCAGATGTGATGGGG + Intronic
1000205971 5:159058909-159058931 CTGAACAGTCAGAGGGGCTATGG + Intronic
1003428157 6:6012116-6012138 AGGAAAAATCAGATGGCCCATGG - Intergenic
1004530308 6:16448346-16448368 GAGAAGAATCAGAGGGGCGAGGG - Intronic
1006220134 6:32482736-32482758 TGGAACAATCAGAAGGTCAAGGG - Intergenic
1006229434 6:32570489-32570511 TGGAACAATCAGAAGGCCAAGGG - Intronic
1006498201 6:34439382-34439404 GGGAACAATCATAATGGCTAAGG + Intergenic
1015071298 6:129096647-129096669 GGGGTCAATCAGATGGTCTCAGG + Intronic
1015670698 6:135686624-135686646 GGGAACTGTCAGAGGGTCTAGGG - Intergenic
1016059265 6:139611818-139611840 GATAACAAGCAGATGGGCCAGGG + Intergenic
1019627441 7:2025264-2025286 GAGAACAATCAAAAGAGCTAGGG + Intronic
1019852904 7:3577194-3577216 GGGAATAAAAAGGTGGGCTATGG - Intronic
1020174556 7:5871876-5871898 GGGAACCATCAGGTTGCCTAAGG - Intergenic
1021481603 7:21123902-21123924 GGGAACAAGGAGAGAGGCTATGG + Intergenic
1022550779 7:31237172-31237194 AGGCACAATCAAATGGGCTTAGG + Intergenic
1024756904 7:52544162-52544184 GAGAACATTCACATGGGCAAGGG - Intergenic
1029874256 7:103732264-103732286 GGGAACAATCAGATTGCCCATGG + Intronic
1033663373 7:143418961-143418983 GGGAACTGGGAGATGGGCTAAGG + Intergenic
1035763945 8:2090624-2090646 GGGGACTATCAGAGGGTCTAGGG - Intronic
1039800138 8:40947142-40947164 AGGAACAAACAGATGAGCTATGG + Intergenic
1040550426 8:48433030-48433052 TGGCACATTCAGAGGGGCTATGG + Intergenic
1045607702 8:103795964-103795986 TGGTGCAATAAGATGGGCTAGGG - Intronic
1045950051 8:107841240-107841262 GCAACAAATCAGATGGGCTATGG - Intergenic
1046803089 8:118450241-118450263 GGGAATAAGCAGATGTGCTCAGG + Intronic
1047015000 8:120714648-120714670 TTGAACTAACAGATGGGCTATGG + Intronic
1050092724 9:2031730-2031752 GGGAACTATCTGAGGGGCTGGGG - Intronic
1053608761 9:39688172-39688194 TGGTGGAATCAGATGGGCTATGG - Intergenic
1053866606 9:42444538-42444560 TGGTGGAATCAGATGGGCTATGG - Intergenic
1054244763 9:62654226-62654248 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054558890 9:66688769-66688791 TGGTGGAATCAGATGGGCTATGG + Intergenic
1055683404 9:78742715-78742737 GGAAATAATAAGTTGGGCTAAGG + Intergenic
1060371735 9:123079853-123079875 GGGAAAAATAAGATAGGATAAGG - Intronic
1061504760 9:131025530-131025552 GGGAGCAAGCAGAGGGGCTCAGG + Intronic
1062345121 9:136110961-136110983 GGGAGGAATCAGAGGGGCTCTGG - Intergenic
1190763344 X:53454771-53454793 GGGAACCATTAGATGGGAGAGGG - Intergenic
1192434194 X:71132599-71132621 GGGAAGAATAAAATGGGCCAAGG + Intronic
1195129159 X:101837714-101837736 AGGAACAATCACAGGGGCCAAGG - Intronic
1195177081 X:102322116-102322138 GGGAACAATCACAGGGGCCAAGG + Intronic
1195181783 X:102364977-102364999 GGGAACAATCACAGGGGCCAAGG - Intronic
1195200967 X:102549850-102549872 GGGAGCAATCACAGGGGCCAAGG + Intergenic
1195376460 X:104232725-104232747 GGGAACAAACAGCTGGGAGATGG + Intergenic
1196021053 X:110991387-110991409 GGGGACAATAACATGGGCTTTGG + Intronic
1196643267 X:118088850-118088872 AGGAAGAAGCAGATGGGCTAGGG + Intronic
1198562983 X:137871422-137871444 GGGAACAAAGGGATGGGCCAGGG - Intergenic
1199818247 X:151419252-151419274 AGGAACAATGAGATGAACTATGG + Intergenic
1200032751 X:153309678-153309700 GGGAACATTGTGTTGGGCTAAGG + Intergenic