ID: 1160605116

View in Genome Browser
Species Human (GRCh38)
Location 18:80044428-80044450
Sequence ACATTCACAGGCCTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160605108_1160605116 9 Left 1160605108 18:80044396-80044418 CCCATGGCACTTGCCTCCAGGGC 0: 1
1: 0
2: 3
3: 17
4: 204
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605111_1160605116 -4 Left 1160605111 18:80044409-80044431 CCTCCAGGGCCGGCAATCCACAT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605109_1160605116 8 Left 1160605109 18:80044397-80044419 CCATGGCACTTGCCTCCAGGGCC 0: 1
1: 0
2: 3
3: 21
4: 328
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605104_1160605116 20 Left 1160605104 18:80044385-80044407 CCTGCATGATCCCCATGGCACTT 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605101_1160605116 29 Left 1160605101 18:80044376-80044398 CCCGAGTAGCCTGCATGATCCCC 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605112_1160605116 -7 Left 1160605112 18:80044412-80044434 CCAGGGCCGGCAATCCACATTCA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605106_1160605116 10 Left 1160605106 18:80044395-80044417 CCCCATGGCACTTGCCTCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 233
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245
1160605102_1160605116 28 Left 1160605102 18:80044377-80044399 CCGAGTAGCCTGCATGATCCCCA 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160605116 Original CRISPR ACATTCACAGGCCTGTGCTG TGG Intronic
900265099 1:1753342-1753364 ACACCCTCAGGCCTCTGCTGGGG + Intronic
900627737 1:3617012-3617034 AGACACACAGGCCTGGGCTGCGG + Intergenic
900794036 1:4697301-4697323 CCATTGCCAGCCCTGTGCTGTGG - Intronic
901179312 1:7330283-7330305 ACTATTACAAGCCTGTGCTGGGG - Intronic
901223342 1:7596517-7596539 CCACTCACAGCCCTGTGCTGTGG + Intronic
901648538 1:10729332-10729354 ACATTCACAGGCTGGCACTGCGG + Intronic
902234759 1:15050298-15050320 GCGTTCACAGCTCTGTGCTGAGG + Intronic
902303941 1:15523069-15523091 ATCCTCACAGGCCTGTGATGAGG + Intronic
905913268 1:41668379-41668401 ACTTCCACAGTCCTTTGCTGTGG - Intronic
906657610 1:47560069-47560091 CCACTCACAGGCATTTGCTGTGG - Intergenic
907167773 1:52429879-52429901 ACATACACAGGCCGGCACTGTGG - Intronic
908865338 1:68542347-68542369 TGATTCACAGGCCTGAGGTGGGG - Intergenic
909466176 1:75976648-75976670 AAATGCACAGGTCTGTGATGTGG - Intergenic
909855813 1:80529642-80529664 ACATTCACAGAGCACTGCTGAGG - Intergenic
909950725 1:81717151-81717173 ACATTCCCAAGCCTTTGCTTTGG - Intronic
911051744 1:93677312-93677334 ACATTCCCAGTTGTGTGCTGTGG + Intronic
912489719 1:110055440-110055462 ACATCAAAAGGCCTGTCCTGAGG - Intronic
916480372 1:165209191-165209213 ACATCAACAGCCCTGTTCTGAGG + Intronic
917066745 1:171103775-171103797 ACATTCACAGGACCATGCAGAGG + Exonic
917214039 1:172659429-172659451 GGAGACACAGGCCTGTGCTGTGG - Exonic
917444063 1:175091931-175091953 AAAGCCACAGGCCTCTGCTGTGG + Intronic
918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG + Intergenic
920827398 1:209434781-209434803 ACTCCCACAGGACTGTGCTGTGG + Intergenic
920945590 1:210525350-210525372 ACATTGACATGACTGTGATGGGG - Intronic
921066617 1:211627498-211627520 AAACTCACAGGACTGTTCTGGGG + Intergenic
921133927 1:212243277-212243299 ACAGTCACAGGCCAGATCTGGGG + Intergenic
923689229 1:236176552-236176574 CCCTGCACAGCCCTGTGCTGGGG - Intronic
924323106 1:242869305-242869327 ACAATCACAGGCATGAGCTGAGG + Intergenic
1064337553 10:14457595-14457617 ACAGCCACAGGCCTGGGCTCTGG + Intronic
1066682968 10:37953138-37953160 ACATTCACAGGCTTTCTCTGTGG + Exonic
1067165617 10:43864359-43864381 ACATGGGCAGGGCTGTGCTGTGG + Intergenic
1067397036 10:45930638-45930660 ACATACAAATGGCTGTGCTGAGG + Intergenic
1067865352 10:49899739-49899761 ACATACAAATGGCTGTGCTGAGG + Intronic
1069643086 10:69968992-69969014 TGTGTCACAGGCCTGTGCTGAGG - Intergenic
1070620174 10:78003620-78003642 ACATTCAAAGAGCTGTGGTGAGG + Intronic
1072050376 10:91698296-91698318 AGAGTCCCAGGCCTCTGCTGAGG + Intergenic
1075655723 10:124159844-124159866 ACACTCACAGTGCAGTGCTGGGG - Intergenic
1075718591 10:124571776-124571798 AGAGACACAGGCCTTTGCTGTGG + Intronic
1078359692 11:10658687-10658709 TCAGTCCCAGGTCTGTGCTGTGG + Intronic
1080446900 11:32345862-32345884 AGATTCACAGGGCTGTTATGAGG - Intergenic
1082096800 11:48137650-48137672 ACAGGCAGAGGCCTGTGCAGAGG + Intronic
1083310650 11:61781887-61781909 ACAGTCACATGACTGGGCTGAGG - Intronic
1083530987 11:63421692-63421714 ACATTCAAAGCAGTGTGCTGAGG + Intergenic
1083593396 11:63908004-63908026 ACATTCCCAGATCTGTGCCGGGG - Intronic
1083662256 11:64256860-64256882 TCATTCATTGGCCAGTGCTGGGG + Intronic
1083675289 11:64321732-64321754 ACCTGCCCAGCCCTGTGCTGGGG + Exonic
1086213371 11:84348013-84348035 ACATTCACAAGCTTGTTATGAGG + Intronic
1088268661 11:108011380-108011402 CCATTCACAGGTCTGTGCTGTGG - Intronic
1089525459 11:119094249-119094271 TCATTCATAGGTCTGCGCTGGGG - Exonic
1091590422 12:1839481-1839503 AGGTTCACTGCCCTGTGCTGCGG - Intronic
1091658171 12:2361018-2361040 ACATACACAAGACTGTTCTGAGG - Intronic
1092841527 12:12547139-12547161 ACAATAACAGGCCAGTGCAGTGG + Intronic
1095676258 12:44922403-44922425 ACATTCACAGGGATGAGGTGGGG - Intergenic
1097145339 12:56935960-56935982 TCAGGCCCAGGCCTGTGCTGGGG - Intergenic
1097680883 12:62647845-62647867 AAAGTCCCAGGCCTGTTCTGTGG + Exonic
1100185427 12:92133927-92133949 ACATTTACAGGCTTGTGATGAGG + Intronic
1101267001 12:103099476-103099498 ACATTCAGAGGCCAGGACTGGGG + Intergenic
1101312944 12:103600317-103600339 TCAAGCACAGGCCTTTGCTGTGG - Intronic
1102738044 12:115180604-115180626 ACATGCACAGGTCTGAGCTCAGG + Intergenic
1103905650 12:124326130-124326152 GCATTCACAGCCCAGTGTTGGGG + Intronic
1106406822 13:29481653-29481675 AGATTCACAAGCCTCTTCTGGGG - Intronic
1108673232 13:52712626-52712648 ACATGCTCAGGCCTGTGGAGGGG + Intronic
1109814033 13:67555862-67555884 ACCTTCACAGCTCTGTGTTGAGG + Intergenic
1112509758 13:99998484-99998506 AGACTCACAGGGCTGAGCTGAGG - Intergenic
1113251676 13:108460114-108460136 ACCTTCACAGGCATGCTCTGAGG + Intergenic
1115920612 14:38368209-38368231 CCATCCACAGGACTCTGCTGAGG + Intergenic
1118311600 14:64697619-64697641 ACAGCCACAGGCCTGGGATGAGG + Intergenic
1120651503 14:87139388-87139410 AAATTCAGTGTCCTGTGCTGTGG + Intergenic
1121558217 14:94854553-94854575 AAACTTAGAGGCCTGTGCTGAGG + Intergenic
1122173587 14:99898972-99898994 ACATTCACAGGACAGGGCAGAGG - Intronic
1122407928 14:101511405-101511427 ACATTTACAGTCTTGTGATGGGG + Intergenic
1122793467 14:104194157-104194179 ACATCCACACTCCTGAGCTGAGG - Intergenic
1124191002 15:27576220-27576242 ACTCTCTCAGGACTGTGCTGGGG - Intergenic
1124231599 15:27951201-27951223 ACTTTCTCTAGCCTGTGCTGTGG - Intronic
1124482554 15:30090403-30090425 ACAGTCACAGGACTGCCCTGGGG - Intronic
1124544097 15:30611469-30611491 ACAGTCACAGGACTGCCCTGCGG - Intronic
1125342661 15:38689912-38689934 GCATTCACAGTCCAGTGCAGAGG + Intergenic
1126827486 15:52566444-52566466 AATTTAAAAGGCCTGTGCTGTGG - Intronic
1127762048 15:62149035-62149057 ACATTCCCAGGACTGTGCTGTGG + Intergenic
1127898754 15:63325659-63325681 ACTTTCACAGTCCTGTCCTCTGG - Exonic
1130373889 15:83310867-83310889 ACCTTCATAGGCATGTGCTGTGG - Intergenic
1130651138 15:85762787-85762809 AAATCCTCAGGCCTGTGCTCTGG + Intronic
1131383406 15:91982856-91982878 TAATTCACAGGCCTGGGCTTGGG - Intronic
1132638129 16:963340-963362 ACACACACTGGCCTGAGCTGTGG - Intronic
1133670412 16:8013349-8013371 ACAATCACAGGGGTGGGCTGGGG - Intergenic
1134628699 16:15741393-15741415 ACCTCCACAGGCCTGTGGTGAGG + Intronic
1134775749 16:16852006-16852028 AGCTTCACAGGGCTGTGCGGAGG - Intergenic
1135036829 16:19085825-19085847 TCAACCACAGGCCTGGGCTGTGG - Intergenic
1136624420 16:31453298-31453320 ACACACACAGGCTGGTGCTGTGG - Intergenic
1137518699 16:49173235-49173257 ACATTCCCAGCCTTGTGGTGAGG - Intergenic
1138077516 16:54057314-54057336 ACATTCTCAGCCCTTGGCTGTGG + Intronic
1139127494 16:64096938-64096960 ACATGCTGAGGCCTGTGCTGGGG + Intergenic
1140906284 16:79412132-79412154 AGATTCACAGGCCTGTGACTGGG + Intergenic
1141754293 16:85981077-85981099 ACATTCACAGTCCTGGAGTGGGG - Intergenic
1142000453 16:87661342-87661364 ACATTCACAGACGGGTTCTGGGG + Intronic
1142032557 16:87845808-87845830 GCAGCCACAGCCCTGTGCTGGGG - Intronic
1143094439 17:4470043-4470065 ACATTCACAGGCTTATGGTTAGG + Intronic
1143819684 17:9550250-9550272 ACAGTCAGTGGCCAGTGCTGGGG + Intronic
1144495928 17:15744775-15744797 ACATTCCCATGACTATGCTGTGG - Intronic
1144576983 17:16435577-16435599 ACCCTCAGAGGCCTGTTCTGAGG + Intronic
1144597471 17:16583160-16583182 ATATTCTCTAGCCTGTGCTGAGG + Intergenic
1144679613 17:17184272-17184294 ACACTCACAGGCCTCTGATGAGG + Intronic
1145077983 17:19870838-19870860 ACACCCACAGGCTTGTGTTGGGG - Intergenic
1146676076 17:34774704-34774726 ACCTGGAGAGGCCTGTGCTGAGG + Intergenic
1146893149 17:36521645-36521667 AAATTCACAGTGCTGTGTTGTGG - Intronic
1152947032 17:83203554-83203576 ACCTTGACTGGCCTGTGCCGGGG + Intergenic
1153485344 18:5592574-5592596 ACATACCCAGGACTGTGCAGAGG + Intronic
1153625839 18:7021273-7021295 ACCTTCACAGTCCTGTCCTGTGG + Intronic
1153728834 18:7986542-7986564 TCATTCACCGGCCTTGGCTGGGG - Intronic
1155500186 18:26479796-26479818 AGATTGGCAGGACTGTGCTGTGG + Intronic
1156295090 18:35782187-35782209 ACATTCACAGCCATGGGGTGGGG - Intergenic
1156348112 18:36276573-36276595 AAACTCACAGGGCTGTTCTGGGG - Intergenic
1157113158 18:44840049-44840071 CCATGCACAGGCCTCTTCTGGGG - Intronic
1157298688 18:46464254-46464276 ACATTCACAGGACTGGCCGGGGG - Intergenic
1158216025 18:55101803-55101825 ACATTCACACCCCTGTTCTGAGG - Intergenic
1159764692 18:72474184-72474206 ACACTCAAAGCCCTTTGCTGAGG + Intergenic
1160557728 18:79736793-79736815 ACGTGCACAGGCGTGTGGTGGGG + Intronic
1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG + Intronic
1161168793 19:2802668-2802690 ACACTCACAGGTCTCTGCTCTGG - Intronic
1161481692 19:4513876-4513898 ACATTCATCGGGCTGTGGTGTGG + Intronic
1162725817 19:12689278-12689300 CCCTTCCCAGGTCTGTGCTGAGG - Exonic
1163420275 19:17210270-17210292 ACAGACACAGGCATGAGCTGGGG - Intronic
1166736689 19:45090131-45090153 ACATTCCCGTGCCTGTGCTCCGG + Exonic
1167496813 19:49824290-49824312 ACATTCACAGTCCAGAGGTGTGG - Intronic
926546107 2:14242270-14242292 ATATACACATGCCTGTGCTTGGG - Intergenic
926582364 2:14644785-14644807 AGGTTCATAGGCCAGTGCTGAGG + Intronic
931565981 2:63615945-63615967 ATATTCTCAGGCTTGAGCTGGGG + Intronic
934052362 2:88221317-88221339 TCATGCACAGGCCTGTGTGGTGG - Intergenic
936641985 2:114323627-114323649 AGTTTCACAGGACTGTGCTTAGG + Intergenic
937011856 2:118570007-118570029 AAATCCACAAGCCTGTGCTGTGG + Intergenic
937125831 2:119474503-119474525 ACTTACACCGGCCTGAGCTGGGG - Intronic
937908700 2:127065005-127065027 ACGTTCTCAGGCCGGGGCTGGGG + Intronic
938243192 2:129758821-129758843 ACACTCACAGCACTCTGCTGGGG - Intergenic
938288837 2:130138865-130138887 ACATGGACATGGCTGTGCTGTGG + Intergenic
942548757 2:177092425-177092447 ACAGTAACAGGCCGGTGCGGTGG - Intergenic
943800300 2:192049365-192049387 ACATTCATAAGACTGTGGTGAGG + Intronic
944361083 2:198857568-198857590 ACATTTACAGGACTCTGCTTGGG - Intergenic
946021213 2:216641534-216641556 ACTTTCACAGGGCTGTAGTGAGG + Intronic
947516243 2:230807420-230807442 TCATTCAAAGGCCTGGGGTGGGG - Intronic
949021778 2:241744844-241744866 ACGTTCACAGCCCTGGGCTTGGG - Exonic
1169527579 20:6446882-6446904 ACAAACACAGACTTGTGCTGAGG + Intergenic
1171176550 20:23054388-23054410 AGATTCACCGGCCTGTGGTAAGG + Intergenic
1171309801 20:24136972-24136994 ATATTCACATGCCTGTGGTGGGG + Intergenic
1171466142 20:25329191-25329213 TCATCCACAGGCCTGGGGTGGGG + Intronic
1174361594 20:50032176-50032198 ACATTCACAGGCCTGGGAATGGG + Intergenic
1174362077 20:50035160-50035182 ACATTCACAGGCCTGGGAATGGG + Intergenic
1174409126 20:50322181-50322203 ACAAGCACCAGCCTGTGCTGCGG - Intergenic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175788479 20:61726525-61726547 ACATTCCCAGGCATGTGGTATGG + Intronic
1176431455 21:6578813-6578835 TCATGCACAGACCTGGGCTGTGG + Intergenic
1179554442 21:42163327-42163349 AGACTCACAGGGCTGTGCAGGGG + Intergenic
1179706849 21:43186275-43186297 TCATGCACAGACCTGGGCTGTGG + Intergenic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1183336292 22:37248794-37248816 AAATTCGAAGGCCTGTGGTGAGG - Intergenic
1183406637 22:37633430-37633452 TCATTCATTGGCCTCTGCTGGGG + Exonic
1183492707 22:38125095-38125117 ACATACACACACCTGTGCAGGGG - Intronic
1185042614 22:48513093-48513115 ACATAAACAGGCCTGTGCCTGGG - Intronic
950223216 3:11212515-11212537 CCCTACACAGTCCTGTGCTGTGG + Intronic
952871203 3:37902827-37902849 ACAGCCACAGGCCTGTGTTGAGG - Intronic
953880054 3:46686822-46686844 GAAGTCACAGGCCTGTCCTGTGG - Intronic
953999001 3:47541621-47541643 ACATTCACAGGGCAGGACTGGGG - Intergenic
954153714 3:48673150-48673172 GCATTCAGAGGCCAGGGCTGGGG + Intergenic
954248311 3:49349064-49349086 ACACACACAGTCATGTGCTGGGG + Intergenic
954338001 3:49931152-49931174 TCAGTCACAGGCCAGTGTTGTGG - Intergenic
955275070 3:57539540-57539562 ACCTCCACAGGCCTTTCCTGTGG + Intronic
955533208 3:59895933-59895955 GCATTCCCAGGCCAGTGCAGAGG - Intronic
955978629 3:64501948-64501970 TGATTCATAGGTCTGTGCTGGGG + Intergenic
958453601 3:94303324-94303346 ACAGTCACCTGCCTGTGGTGAGG + Intergenic
958455485 3:94325994-94326016 ATATTCACATGTGTGTGCTGAGG - Intergenic
958992572 3:100864253-100864275 ACATTCAAAGGGCAGTGGTGTGG + Intronic
961764281 3:129196511-129196533 ATTTTCAAAGGCCTGTGGTGAGG + Intergenic
962056331 3:131875663-131875685 ACACACCCAGGCCTGTCCTGGGG + Intronic
962236535 3:133711929-133711951 ATCTGCACAGGCCTGTGTTGGGG - Intergenic
966959687 3:184922744-184922766 ACATCCACTGGCCTGTTCTCTGG - Intronic
967023098 3:185540021-185540043 ATATTCTCAGAACTGTGCTGGGG + Intronic
968707988 4:2092218-2092240 TGACCCACAGGCCTGTGCTGAGG - Intronic
968772508 4:2516698-2516720 ACTTTCACAGGCCTGGCCTGGGG - Intronic
968933764 4:3598400-3598422 ACTTTCACAAGCCTGTGGTGTGG + Intergenic
970475606 4:16419161-16419183 TCCTTCACAGGGCTGTTCTGAGG + Intergenic
970650283 4:18170203-18170225 ACAATGCCAGGCCTGTGCTGAGG + Intergenic
972291918 4:37697518-37697540 ACCTTCACAGGCTTGGGTTGTGG + Intergenic
974398089 4:61366361-61366383 ACATCCTGATGCCTGTGCTGAGG + Intronic
975268163 4:72395834-72395856 ATATACACACGCATGTGCTGTGG + Intronic
975640585 4:76496166-76496188 TCACTCACACACCTGTGCTGTGG - Intronic
980110480 4:128631628-128631650 ACATTAAAAGGCCGGTGCAGTGG + Intergenic
980824753 4:138059939-138059961 AAATTCACATGCATGGGCTGGGG - Intergenic
984656314 4:182322429-182322451 ACCTTCCCAGGTCTGGGCTGTGG + Intronic
985610899 5:888021-888043 CCTTTGAGAGGCCTGTGCTGAGG - Intronic
985665211 5:1178579-1178601 ACACACACAGGCCTGAGCTCCGG - Intergenic
986023134 5:3823356-3823378 ACCTTCTGAGGGCTGTGCTGAGG + Intergenic
986042842 5:4010596-4010618 CCTCTCACAGCCCTGTGCTGTGG - Intergenic
986051845 5:4097474-4097496 ACATTCCAAGCCGTGTGCTGGGG + Intergenic
986491569 5:8296510-8296532 ACATACACAGCCCTGTGCTTAGG + Intergenic
988412764 5:30908490-30908512 ACTTTCTCAGTACTGTGCTGTGG - Intergenic
990394924 5:55367554-55367576 ACATTCACAGGCTTATGCCAGGG - Intronic
991601347 5:68354465-68354487 ACCTTCACATCCCTCTGCTGTGG + Intergenic
993097608 5:83498155-83498177 ACTTTGACAGGCCTATACTGTGG + Intronic
993244823 5:85437417-85437439 ACATACTGAGGCCTGTCCTGGGG + Intergenic
993554780 5:89322618-89322640 ACATTCACAGACGTGTACTTTGG - Intergenic
993962156 5:94312024-94312046 ACTTTCAAAGGTCTATGCTGTGG + Intronic
994469412 5:100183633-100183655 ATATTCACATACCTGTGCAGGGG + Intergenic
995042249 5:107602328-107602350 ACATTAACAGGCCTGTTTCGAGG - Intronic
998897215 5:146812434-146812456 ACTTTCCCAGGCCTCTTCTGAGG + Intronic
999288145 5:150406550-150406572 ATATTCACAATACTGTGCTGTGG - Intronic
999393389 5:151211100-151211122 ACATACAGATGCCTGTGTTGGGG - Intronic
999689383 5:154133786-154133808 CCTTTCACATCCCTGTGCTGGGG - Intronic
999856133 5:155596240-155596262 ACATTCACAGACCTGCTGTGTGG + Intergenic
999894778 5:156019875-156019897 GCATTTAAAGCCCTGTGCTGTGG + Intronic
1001120929 5:168979258-168979280 AATATCACAGGCCTGTGTTGGGG + Intronic
1001844537 5:174910308-174910330 ACATTCAGAAGCCTGGGCTGGGG - Intergenic
1001954947 5:175842722-175842744 AGAGGCGCAGGCCTGTGCTGGGG - Intronic
1002650928 5:180693084-180693106 GCATTGCCAGGGCTGTGCTGAGG - Intergenic
1002702768 5:181137768-181137790 ACACTCTCAGGCCTGTGGAGGGG + Intergenic
1003429113 6:6022725-6022747 ACAAGGACAGGGCTGTGCTGGGG + Intergenic
1004505451 6:16243430-16243452 ACATTCAGAGGTCTGGGCTGGGG + Intronic
1005378294 6:25207631-25207653 ACATCCACTGTGCTGTGCTGTGG - Intergenic
1006560889 6:34911195-34911217 AGGTTCACAGGTCTTTGCTGTGG - Intronic
1006897307 6:37479376-37479398 GTATTCTCAGGCCTGTGCTCAGG - Intronic
1007131231 6:39476030-39476052 ACATACTCGGGCCTGTGGTGGGG + Intronic
1007897637 6:45378453-45378475 ACATCCACACGCCTGTACTGCGG - Intronic
1008416834 6:51250804-51250826 ACATACACAGCTCAGTGCTGTGG + Intergenic
1010318654 6:74480571-74480593 ACATTCACAGTCTTGTGCTTGGG + Intergenic
1011050094 6:83137378-83137400 ATGTTCACAGTCCTCTGCTGGGG + Exonic
1012349958 6:98237911-98237933 ACAATCATAGGCCTGTTCTCAGG - Intergenic
1015572033 6:134632009-134632031 ACTTTCACAGGACTGTGCTAGGG + Intergenic
1015660575 6:135569872-135569894 ACTTTCTCAGAACTGTGCTGTGG + Intergenic
1017564691 6:155670754-155670776 ACATTCACATGCCTGTGTTCTGG - Intergenic
1017764167 6:157593356-157593378 CCATTCTCGTGCCTGTGCTGGGG - Intronic
1021970942 7:25965404-25965426 ACATTCACTGTGCTTTGCTGAGG - Intergenic
1022515482 7:30972399-30972421 GCACTCATAGGTCTGTGCTGGGG + Intronic
1029550999 7:101237095-101237117 CCTTTCCCAGCCCTGTGCTGTGG - Intronic
1033446994 7:141431923-141431945 ACATGCACAGGCCTTTCCTTGGG + Intronic
1034682223 7:152937542-152937564 CCAATCACAGGACAGTGCTGTGG + Intergenic
1035334058 7:158114298-158114320 AGATTCCCAGGCCTGACCTGTGG - Intronic
1035924252 8:3710504-3710526 ACATTCAGAGGGCTGGGCTTAGG + Intronic
1035958643 8:4112326-4112348 ACGGACACAGGCCTGTGATGAGG + Intronic
1036207395 8:6815290-6815312 ACAGTGCCAGGCCTGTGCTCAGG + Intronic
1037241409 8:16783022-16783044 ACAATCGCAGGGCTGTGGTGAGG - Intergenic
1037546956 8:19933133-19933155 ACATTCACAGCACTGTGTAGAGG + Intronic
1037981451 8:23257421-23257443 ACATTCACAGTCATGGTCTGTGG - Intronic
1038335200 8:26640517-26640539 ACATTCACAGGAGGGTGCTGTGG - Intronic
1038586057 8:28790237-28790259 ACCACCACAAGCCTGTGCTGAGG - Intronic
1039834865 8:41248135-41248157 ACATCTACATACCTGTGCTGGGG - Intergenic
1045188378 8:99860178-99860200 ACTTTCACAGACCTGTCCTATGG - Intronic
1048628923 8:136219015-136219037 ACCCTCCCAGGCCTTTGCTGGGG + Intergenic
1048882560 8:138882875-138882897 ACATATACAGGCCCTTGCTGAGG + Intronic
1049399481 8:142418566-142418588 GCATTCACATGCCTGCGGTGGGG - Intergenic
1049478486 8:142807877-142807899 ACCTTCCCAGGCCTGGGCTGAGG - Intergenic
1049654397 8:143791422-143791444 ACAGTCACCGGACTTTGCTGAGG - Exonic
1050108463 9:2190180-2190202 ACCTTCACAGGACTATTCTGGGG - Intronic
1050266424 9:3895277-3895299 AAATTTACAGGCCTGGCCTGGGG + Intronic
1052387509 9:27839205-27839227 ACATGCACAGATCTGTGCTCTGG - Intergenic
1053116462 9:35508362-35508384 ACATTCACAGGCATGTGTGGAGG - Intronic
1054456380 9:65433416-65433438 ACTTTCACAAGCCTGTGGTGTGG - Intergenic
1055211994 9:73807013-73807035 ACATTCAGGGTCCTGTGCTTGGG - Intergenic
1057199614 9:93133229-93133251 ACAGTCCTAGGCCGGTGCTGTGG - Intronic
1057755718 9:97833516-97833538 CCCCTCACAGGACTGTGCTGAGG - Intergenic
1059471476 9:114507991-114508013 GCATTCACTGGCCAGAGCTGGGG - Intergenic
1060199082 9:121641355-121641377 ACATTTACTGGCCTTTCCTGAGG - Intronic
1061442119 9:130612699-130612721 ACATCCACAGTCCAGTGCTCTGG - Intronic
1061653255 9:132068130-132068152 ACAACAACGGGCCTGTGCTGGGG + Intronic
1062378256 9:136274681-136274703 ACATTCTCTGGCCTGTCCTCGGG + Intergenic
1187946150 X:24427969-24427991 ATATGCACAGGCCTGTGCCCAGG - Intergenic
1188224962 X:27586062-27586084 ACATGCAAAGGCCTGTGGAGAGG - Intergenic
1192008585 X:67242977-67242999 GCTTTCACAGGCTTGTGTTGAGG - Intergenic
1192090165 X:68146308-68146330 TCATTCACTTGCCTGTCCTGTGG + Intronic
1192171563 X:68858780-68858802 ATATTCACAGGCCAGGGCAGTGG + Intergenic
1192847448 X:74921193-74921215 TGATTCACAGGCCTCTGCTAGGG - Intronic
1193687171 X:84591804-84591826 ACAGTCACTGTCCTGTGCTGTGG - Intergenic
1196889995 X:120282560-120282582 TCATGCCCAGCCCTGTGCTGGGG + Intronic
1197807554 X:130412211-130412233 ACATTCACAGCCGGGTGCGGTGG - Intronic
1199417414 X:147601122-147601144 ATACTCACAGGCCTGGGCTCAGG + Intergenic
1199708590 X:150451885-150451907 ACAAAGACAGGCCTGTGCTGAGG - Intronic
1199910478 X:152281469-152281491 AGTTTCACAGGCTTGTGGTGAGG - Intronic
1200748171 Y:6921011-6921033 AAACTCACAGTGCTGTGCTGTGG + Intronic
1201537027 Y:15060827-15060849 AGATTCCCAGGCCTGTGTGGTGG + Intergenic