ID: 1160605473

View in Genome Browser
Species Human (GRCh38)
Location 18:80046557-80046579
Sequence GAGCCCAGCTCCAGGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 225}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160605473_1160605492 16 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605492 18:80046596-80046618 GGGCTGGCACGTGGCGCCGGGGG 0: 1
1: 0
2: 2
3: 10
4: 189
1160605473_1160605483 -4 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605483 18:80046576-80046598 GCTCCGTCCCTGGGGCTGCTGGG 0: 1
1: 1
2: 5
3: 25
4: 278
1160605473_1160605491 15 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605491 18:80046595-80046617 TGGGCTGGCACGTGGCGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 138
1160605473_1160605490 14 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605490 18:80046594-80046616 CTGGGCTGGCACGTGGCGCCGGG 0: 1
1: 0
2: 2
3: 19
4: 231
1160605473_1160605482 -5 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605482 18:80046575-80046597 GGCTCCGTCCCTGGGGCTGCTGG 0: 1
1: 1
2: 7
3: 63
4: 601
1160605473_1160605495 30 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605495 18:80046610-80046632 CGCCGGGGGCTCCATCCCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 199
1160605473_1160605488 7 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605488 18:80046587-80046609 GGGGCTGCTGGGCTGGCACGTGG 0: 1
1: 0
2: 5
3: 69
4: 1306
1160605473_1160605485 0 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605485 18:80046580-80046602 CGTCCCTGGGGCTGCTGGGCTGG 0: 1
1: 0
2: 2
3: 51
4: 497
1160605473_1160605489 13 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605489 18:80046593-80046615 GCTGGGCTGGCACGTGGCGCCGG 0: 1
1: 0
2: 3
3: 21
4: 285
1160605473_1160605494 29 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605494 18:80046609-80046631 GCGCCGGGGGCTCCATCCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 168
1160605473_1160605493 28 Left 1160605473 18:80046557-80046579 CCCAACCCCCTGGAGCTGGGCTC 0: 1
1: 0
2: 4
3: 33
4: 225
Right 1160605493 18:80046608-80046630 GGCGCCGGGGGCTCCATCCCTGG 0: 1
1: 0
2: 0
3: 27
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160605473 Original CRISPR GAGCCCAGCTCCAGGGGGTT GGG (reversed) Intronic
900159295 1:1215952-1215974 GAGCCCAGCTCCTGGGGATGTGG - Intergenic
900365955 1:2312080-2312102 GACCCCAGCTCTTGGGGGCTTGG - Intergenic
900614673 1:3560048-3560070 GAGCCCATCTCCTGGGAGTCGGG + Intronic
900763045 1:4485762-4485784 GAGCCCACCACCAGGGGATTTGG - Intergenic
900831211 1:4967074-4967096 GAGACCAGCTCCAGGATGGTTGG - Intergenic
901021933 1:6260355-6260377 GATCGGAGCCCCAGGGGGTTGGG - Intronic
901327775 1:8379270-8379292 GAGCCCAGCTCCATGGGGCTGGG + Intronic
901400244 1:9010776-9010798 GAGCCAAGATCCAGGAGGTCTGG - Intronic
901654132 1:10759694-10759716 GAGCCCAGCCCCAGAGGGAGGGG + Intronic
901828615 1:11878822-11878844 AAGCCCAGCTCAAGGGTGTGCGG + Intergenic
902378456 1:16041500-16041522 GGGCCCAGCTCCAGGTGGAGGGG - Intergenic
902635591 1:17733175-17733197 TAGCCCTGCTCCAGGGTGCTGGG + Intergenic
903248937 1:22038182-22038204 GAGGCCAGCTCCAGTGGGTGTGG + Intergenic
903811342 1:26036555-26036577 CAGCCCAGGTCCAGGGTGTCAGG + Intergenic
903879153 1:26497011-26497033 CTGCCCAGCTGCAGGGAGTTTGG + Intergenic
904388644 1:30164328-30164350 GAGCCCCCCTACAGGGGGCTTGG - Intergenic
910758857 1:90716807-90716829 GAGCCCAGCTGCTGGGGGGGCGG + Exonic
917369162 1:174270137-174270159 GAGCAGAGTCCCAGGGGGTTAGG + Intronic
920051746 1:203168547-203168569 GAGGCCAGGAGCAGGGGGTTGGG - Intronic
923090509 1:230736982-230737004 GATTCCAGCTCCAGGGTGGTTGG - Intergenic
923156465 1:231283629-231283651 GAGAACAGCTCCTGGGAGTTGGG + Intergenic
924768303 1:247054459-247054481 GAGCTCAGCTCCAGTAGGATAGG + Intronic
1064410107 10:15097438-15097460 GAGGCCAGCCCCGGGGGGATCGG + Exonic
1064913251 10:20426995-20427017 GGTCCCAGCACCAGAGGGTTAGG - Intergenic
1066460346 10:35607847-35607869 GAGGCCGGCTCCCGGGGGTCGGG - Exonic
1067143214 10:43673501-43673523 CAGCACAGCACCAGGGGGTGGGG - Intergenic
1069992456 10:72323814-72323836 GAGGCCTGCCCTAGGGGGTTAGG + Intergenic
1071399503 10:85255829-85255851 GAGCTGAGCTCCAAGGGGCTGGG + Intergenic
1071504173 10:86222793-86222815 GAGCCCAGCTGAAGGGGGGCAGG + Intronic
1071610971 10:87031071-87031093 GAGCCCACCACTGGGGGGTTCGG + Intergenic
1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG + Intergenic
1075745563 10:124724922-124724944 GTGCCCAGCTGCTGGGGGCTGGG + Intronic
1076581847 10:131517194-131517216 GGGCCCAGCAGCAGGGGCTTGGG - Intergenic
1077327595 11:1970461-1970483 GAGGGCAGCTGCAGGGGGCTGGG - Intronic
1077356301 11:2120492-2120514 GAGCCCAGGTCCAGGGGTGGGGG + Intergenic
1077505207 11:2926939-2926961 GAGCCCAGGACCAGGGGGTGGGG - Intergenic
1078013668 11:7593690-7593712 GTTACCAGCTCCAGGGGATTTGG - Intronic
1078045054 11:7906070-7906092 GAGCCCAGCGCCAGGGAGTGAGG + Intergenic
1080851474 11:36073844-36073866 CAGCCCAGCTCCAGAGGACTAGG - Intronic
1081570201 11:44286082-44286104 GAGCCCAGCTCCAGGGCCTGGGG - Intronic
1082089302 11:48076190-48076212 CACACCAGCTCCTGGGGGTTAGG - Intronic
1083679193 11:64343495-64343517 GAGTCCAGCTCCTGGGGGTGAGG - Exonic
1084150551 11:67286105-67286127 GAGCCCGGGTGCTGGGGGTTGGG - Exonic
1084698219 11:70768903-70768925 GAGACCCACTCCAGGGGGGTGGG + Intronic
1085301828 11:75463117-75463139 GAGCACAGCCCCAGGGGGGGAGG - Intronic
1087827168 11:102778676-102778698 AAGCCCAGGTCCAGGTGGGTAGG + Exonic
1089384456 11:118058759-118058781 GAGCCCAGCTCGGGGGGCCTGGG + Intergenic
1090657017 11:128854052-128854074 GAGCCCAGGTGCAGGTGGATGGG - Intronic
1090660253 11:128877037-128877059 GAGCGCACCTCCAGAGGGCTGGG - Intergenic
1091228751 11:133974293-133974315 CAGCCCAGCTCAAGGGAGTGAGG + Intergenic
1202810577 11_KI270721v1_random:25641-25663 GAGGGCAGCTGCAGGGGGCTGGG - Intergenic
1092932430 12:13328925-13328947 GAACTCTGCTCTAGGGGGTTGGG + Intergenic
1092996134 12:13952700-13952722 ATGCCCAGCTCCTGGGGGATTGG - Intronic
1094501708 12:31027198-31027220 GAGCCCGGCACCAGGGAGTGAGG - Intergenic
1095089218 12:38088235-38088257 GAGACCAGCTCTGGGGAGTTTGG + Intergenic
1095980866 12:47974030-47974052 CAGCCCTGCTCCAGGCGGTTTGG + Intronic
1097249060 12:57622428-57622450 GAGCCCAGCACCTGGGGGAGCGG - Intronic
1098371700 12:69767409-69767431 CTGCTCAGCTCCAGGGGGATGGG + Intronic
1100117914 12:91331151-91331173 GATGGCAGCTGCAGGGGGTTCGG + Intergenic
1100635052 12:96427339-96427361 GTGTGCAGCTCCAGGGGGTTGGG + Intergenic
1101837747 12:108307030-108307052 CAGGCCAGCTCCAGGGGCTGGGG - Intronic
1103912382 12:124359653-124359675 CAGCCCAGTTCCAGAGAGTTGGG + Intronic
1103913813 12:124365801-124365823 GGGCCCAGGTCCAGGGAGTGAGG - Intronic
1108727923 13:53201667-53201689 GCGCGCAGCTCCTGGTGGTTGGG - Intergenic
1112596560 13:100813159-100813181 AAGCCATGCTCAAGGGGGTTTGG + Intergenic
1113782286 13:112983538-112983560 GTGCCCAGCACCACGGGCTTTGG - Intronic
1114775453 14:25475759-25475781 GACCCCATCACCAGGGTGTTGGG - Intergenic
1116060106 14:39912772-39912794 GAGCCCAGCTCATGGTGGTGGGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120136769 14:80878697-80878719 TAGCTCAGGCCCAGGGGGTTGGG - Intronic
1121104554 14:91271949-91271971 GAGCTCTGCACCAGGGGGTTTGG - Exonic
1121414146 14:93767459-93767481 GAGCCCAGAACCAGGGAGTGGGG + Intronic
1121996331 14:98606383-98606405 CAGCCCAGCTCCAGGCTGTTGGG - Intergenic
1122338145 14:101007242-101007264 GAGCCCAGCAGCAATGGGTTGGG - Intergenic
1124137575 15:27048458-27048480 GAGGTCAGCTCCTGGGGCTTTGG - Intronic
1124971897 15:34496314-34496336 GTGCCCAGCTCCTGGGGGGCTGG - Intergenic
1125538000 15:40453794-40453816 GAGACAGGCTGCAGGGGGTTGGG - Intronic
1125723294 15:41855395-41855417 TAGCCCAGCTGCAGGCAGTTCGG - Exonic
1127916767 15:63461273-63461295 GGGCCCAGCCCCAGCGGGTCAGG + Intergenic
1128005741 15:64238804-64238826 CAGCCCAGATCCAGGGGGTTGGG - Intronic
1129470805 15:75752358-75752380 GAGCCCAGAGCCAGGAGGATGGG + Intergenic
1129680187 15:77654491-77654513 GAGCCCAGCTGGTGGGGATTGGG + Intronic
1130077755 15:80704386-80704408 GAGCCCAGCTCCAGGCAGCCAGG - Intronic
1131075637 15:89493458-89493480 GAGTCCAGCTCCAGTTGGCTTGG - Intronic
1132652830 16:1029248-1029270 GTGCTCAGCGCCGGGGGGTTGGG - Intergenic
1132939311 16:2499094-2499116 GAGCCAAGCGCCAGGGGCTGGGG - Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1133565968 16:6993733-6993755 CAGCCCAGCTCCATGGGCATGGG + Intronic
1135487739 16:22880641-22880663 GAGCCCATCTCCATGGGGGGAGG - Intronic
1136574973 16:31117926-31117948 GAGCTCAGGGCCAGGGGGTGGGG + Intronic
1138497381 16:57416574-57416596 GACCCCAGCTCCAGGGCGAGGGG + Intergenic
1139391654 16:66609389-66609411 GTGCTCAGCTCCAGGGGCTCAGG + Intronic
1139949240 16:70661122-70661144 GATCCCAGCTGCAGGGGGACAGG - Intergenic
1140897317 16:79335971-79335993 GAGCCCAGCTTCTGGGGATGTGG + Intergenic
1141164752 16:81652962-81652984 GACACAAGCTCCAGGGGGGTAGG - Intronic
1141426308 16:83946706-83946728 TCACCCAGCTCCAGGGGGTGGGG - Intronic
1141577635 16:84974792-84974814 GAGCAAACCTGCAGGGGGTTTGG - Intronic
1142033474 16:87850000-87850022 GAGGCGAGCTCCAGGGGCTGGGG - Intronic
1142035897 16:87862026-87862048 GATCCCAGCTGTGGGGGGTTGGG + Intronic
1142234046 16:88913087-88913109 CAGCCCAGATCCAGGGGGCAGGG - Intronic
1142640280 17:1281416-1281438 GAGGACAGCTCCTGGGGGTTCGG - Intronic
1143757731 17:9079216-9079238 GAACCCTGCTCCAGGGTGGTGGG + Intronic
1146139435 17:30352472-30352494 GATCTCAGCTACTGGGGGTTGGG - Intergenic
1146474764 17:33153900-33153922 GATCCGAGCTCCTGCGGGTTTGG + Intronic
1148851972 17:50559948-50559970 GAGGTCAGGTCCAGCGGGTTAGG + Intergenic
1151325983 17:73379970-73379992 GGGCTCAGCTCCAGGGGGGAGGG + Intronic
1151542603 17:74772256-74772278 GAGCCCAGCTGCAGGGGTAAGGG - Exonic
1151769822 17:76153291-76153313 CACCCCAGCCCAAGGGGGTTTGG - Intronic
1152554490 17:81046112-81046134 ACGCCCAGCTGCAGGGGGTAAGG + Intronic
1152587835 17:81197012-81197034 GACCCCAGCTCCAGGGGCCCCGG + Exonic
1152609778 17:81309867-81309889 GGGCCCTGCTCCGGGGGGTTGGG + Intergenic
1152798210 17:82318158-82318180 GTGCCCAGCTTCAGGGGCTGAGG + Intergenic
1157291318 18:46411925-46411947 GAGCCCAGCTCCCTGGAGTGGGG + Intronic
1158539940 18:58344206-58344228 AAGCCCTGCTCAAGGGGATTTGG + Intronic
1160570708 18:79815847-79815869 CAGCTCAGCTCCAGGGCGGTGGG - Intergenic
1160605473 18:80046557-80046579 GAGCCCAGCTCCAGGGGGTTGGG - Intronic
1161241945 19:3227687-3227709 GAGCCCACCTCCATGGCGATGGG - Intronic
1162088265 19:8261530-8261552 GTGCCCAGCTCAAGAGTGTTAGG + Intronic
1162806341 19:13139662-13139684 GGGCCCAGCTCCTGGGGGCTGGG + Exonic
1162949495 19:14062103-14062125 GAGAGCAGGTCCAGCGGGTTTGG + Intergenic
1163168961 19:15517511-15517533 GATCCCTGCTCCAGGTGGCTGGG - Intronic
1163645691 19:18487864-18487886 GAGCACAGCTCCTGAGTGTTCGG - Intronic
1163678302 19:18666446-18666468 CACCCCAGCTCCAGGGGAATGGG - Intronic
1163761228 19:19137804-19137826 TAGCCCAGCCCCTGGGGGTCAGG - Intronic
1165156510 19:33792126-33792148 GAGGCCCTCTCCAGGGGGGTCGG - Intergenic
1165942275 19:39420897-39420919 GAGCCCAGCTCCCGGGTCCTAGG - Intronic
1166293314 19:41877200-41877222 GAGCCCATCTCCGGGGGGCTGGG + Exonic
1166996823 19:46723363-46723385 GAGCCCAGCTGCCTGGGGCTTGG - Intronic
1168501990 19:56900590-56900612 GAGCAAACCTCCAGGGTGTTTGG - Intergenic
926422850 2:12716594-12716616 GAGCCCAGCTGCGGGCGGCTGGG - Intergenic
927366145 2:22299012-22299034 GACCCCAGCCCAAGGGAGTTGGG + Intergenic
928176499 2:29037608-29037630 GAGCCCAGCTCCCTGGGGCTGGG + Intronic
929532326 2:42761026-42761048 TTGCCCAGCTCCAGGGGCTGGGG - Intergenic
929812289 2:45200872-45200894 CAGCCCTGCTGCTGGGGGTTGGG - Intergenic
930327925 2:49943703-49943725 GAGCCGAGCTCAGGTGGGTTAGG - Exonic
932419910 2:71595596-71595618 GAGCCCTGCACCAGGCTGTTCGG - Intronic
934558339 2:95299252-95299274 GGGCCCAGCACCAGGAGGTGTGG - Intronic
934857141 2:97736608-97736630 TGCCGCAGCTCCAGGGGGTTGGG + Intronic
938728840 2:134130268-134130290 GAGCCCACCGCCAGGGTGTGGGG - Intronic
939898927 2:147827042-147827064 GAGCCCAGCGCCAGGTGGGCCGG - Intergenic
942088762 2:172467533-172467555 GAGCCAAGGTCCAGGGGGCAAGG + Exonic
942783373 2:179672119-179672141 GACCACAGCTCCAGTGGGTCTGG + Intronic
946191817 2:218011515-218011537 CAGCCCAGCCCCAGGGGGATGGG - Intergenic
947863667 2:233380778-233380800 GAGCCGCTCTCCTGGGGGTTTGG + Intronic
948066342 2:235083664-235083686 GAGCAGAGCTCCAGTGGGTGGGG - Intergenic
948353908 2:237362012-237362034 GGGCCCAGCTCCTGGCGGTCGGG + Intronic
1168835604 20:875342-875364 GAGCCCAGATCCATGGGGGCTGG - Intronic
1168914886 20:1477459-1477481 GATCCCAGCTCCTGGGACTTAGG - Intronic
1169255135 20:4091416-4091438 GATCCCAGCTGCAGGAGGTCGGG + Intergenic
1171185205 20:23120006-23120028 GAGCCCAGCTCTAGGAGATGTGG - Intergenic
1171482374 20:25463640-25463662 CACCGCAGCTCCTGGGGGTTTGG + Intronic
1172220780 20:33273378-33273400 GAGCCCAGCCCCATGGAGTGGGG - Intergenic
1174910453 20:54602381-54602403 GAGCCCTGCTCCAGGTGATGTGG - Intronic
1175607154 20:60320629-60320651 GTGCCCAGCACCAGAGGGTCTGG - Intergenic
1175777861 20:61664239-61664261 CAGCACAGCTCCAGGAGGGTGGG - Intronic
1175915312 20:62423303-62423325 GTGCCCAGCTCCTGGGGCTGTGG + Intronic
1176106767 20:63393278-63393300 GGGCCCAGCTCCTGGGGCCTGGG + Intergenic
1178995331 21:37394003-37394025 CAGCCCAGATTCAGGGGGTTCGG + Intronic
1179520735 21:41942771-41942793 GAGGCCAGCCCCTGGGGGGTAGG - Intronic
1179988715 21:44934776-44934798 CAGCCCAGCTCCCTGGGGGTTGG - Exonic
1180023319 21:45143173-45143195 GAGCACAGTGCCAGGAGGTTAGG - Intronic
1180038814 21:45265318-45265340 GAGCCCAGCTCTAGAGGCGTGGG + Exonic
1180154959 21:45973229-45973251 GGGCCCAGCTCTAGGGGCTGCGG + Intergenic
1181437253 22:22918082-22918104 GTGAGCAGCTGCAGGGGGTTGGG + Intergenic
1182102954 22:27670634-27670656 CTGCCCAGAGCCAGGGGGTTGGG + Intergenic
1183301289 22:37060376-37060398 CACCCCAGGTCCAGGGGCTTTGG - Intronic
1183544346 22:38447606-38447628 GAGAGGAGCTGCAGGGGGTTGGG + Intronic
1183606430 22:38869077-38869099 CAGCCCAGCTCCCAGGGATTGGG + Intronic
1185028052 22:48426723-48426745 GTGGCCATCTCCAGGGGGTGGGG + Intergenic
1185388115 22:50545815-50545837 GGGCCCAGCTTCAGGGGGCTTGG - Intergenic
951491198 3:23272113-23272135 GAGCCCACCGCCAGGGGGCTCGG + Intronic
952752143 3:36833318-36833340 GGGCCTGGCTCCAGGGGGCTTGG - Exonic
956898877 3:73692990-73693012 AAGCCCAGCTCCTGAGGGTGAGG - Intergenic
958151035 3:89695673-89695695 AAGCCAAGCTGCAGGGGGCTGGG - Intergenic
959975544 3:112454694-112454716 GAGACCAGCTCCAGGAAATTGGG + Intergenic
960076916 3:113496681-113496703 GAGTCCAGCTTCAGGTGGATGGG + Intronic
961475367 3:127142589-127142611 GGGCCTGGCTCCAGGGGGATAGG + Intergenic
961550420 3:127667766-127667788 CAGCCCAGCTCCAGGGGCTGCGG + Intronic
962391765 3:134978229-134978251 GAGCCCAACTACAGTGGCTTAGG - Intronic
962874537 3:139525716-139525738 CAGCCCATCACCAAGGGGTTAGG + Intronic
963733694 3:148995084-148995106 GATCCCAGCTACTTGGGGTTGGG + Intronic
966383621 3:179369695-179369717 AACCCCAGATCCAGGGGGTTGGG + Intronic
968522434 4:1040018-1040040 AAGCCCAGGTCCAGGGAGGTGGG + Intergenic
968546334 4:1200814-1200836 AAGCCCAGCTCCTGGAGGTGGGG + Intronic
968909901 4:3472454-3472476 GAGCCCAGCTGCCGGGGCCTAGG + Intronic
969646930 4:8436061-8436083 AAGCCCACATCCAGGGGGTGGGG + Intronic
969873548 4:10119467-10119489 GAGCCCAGCAGCTGGGAGTTTGG - Intergenic
971385170 4:26135490-26135512 AAACCGAGCTCCAGTGGGTTGGG + Intergenic
974199747 4:58622906-58622928 GAGCCCAAGTCCACGGGGGTTGG + Intergenic
974715901 4:65669236-65669258 GAGGCCCGTTCCAGGGGGATGGG - Intronic
982360747 4:154516294-154516316 GAGCAAAGCTCCAAGGGGGTGGG + Intergenic
984701111 4:182819396-182819418 GAGCCCAGCTTCTGCGGGTCAGG + Intergenic
985345814 4:189002654-189002676 GAGCCCACCTCCAGGGCCTTGGG - Intergenic
989113648 5:37930926-37930948 GAGCCCAGCTCCTGGAGCCTAGG + Intergenic
991523932 5:67534734-67534756 GAGCCCAGCTCCAGAAGATAAGG + Intergenic
991630359 5:68650512-68650534 GACCCCAGCAGCAGGGGGTCAGG + Intergenic
992013607 5:72555015-72555037 GAGCACAGATCCAGGGGCTGAGG + Intergenic
996877876 5:128259892-128259914 GAGATCAGCTGCAGGGGCTTTGG + Intronic
998130256 5:139648240-139648262 GAGCCGAGGTGGAGGGGGTTGGG + Intronic
998250315 5:140548031-140548053 GAGCCTAGCTTCCGGGTGTTTGG + Intronic
998366606 5:141636620-141636642 GTGTCCAGCTCCTGGGGGTGGGG + Exonic
999288220 5:150406875-150406897 GAGCCCTGCCCCAGGGGGTAAGG - Exonic
1001634252 5:173198381-173198403 GAGCCCAGTGCCAAGGGGGTGGG + Intergenic
1001771892 5:174303011-174303033 GAGCTCATCTGCAGGGCGTTGGG - Intergenic
1002353614 5:178604767-178604789 CAGCCCAGTTCCGAGGGGTTGGG + Intronic
1002701585 5:181128581-181128603 AAGGCCAGCTCCAGGGGGCCTGG + Intergenic
1002810478 6:623226-623248 GAATCCAGCTCCAGGGGCTTGGG - Intronic
1004129465 6:12905114-12905136 AAGCCAGGCTCCATGGGGTTGGG - Intronic
1005693252 6:28327758-28327780 CAGCCCACATTCAGGGGGTTGGG - Intronic
1007258140 6:40542785-40542807 GAGCCCATCCCCAGAGGGCTGGG + Intronic
1007623493 6:43229159-43229181 GAGCGCAGCTGCCGGGGGTCGGG + Intronic
1008560564 6:52720704-52720726 CAGCCAAGCTCCAGGGGCTTGGG + Intergenic
1011868549 6:91862384-91862406 GAGTCCAGTGGCAGGGGGTTGGG + Intergenic
1017684661 6:156899627-156899649 TAGTCCAGCTCCAGGAAGTTTGG - Intronic
1018714522 6:166521381-166521403 GACCCCTGCTCCAGTGGGTCTGG + Intronic
1018752811 6:166822061-166822083 GAGGCCAGCTCCAGGAGGGATGG - Intronic
1019052599 6:169194719-169194741 GAGCCCAGCTGCAGGGGAGAGGG - Intergenic
1019126629 6:169845152-169845174 GAGCCAAGCTCCAGGAGGGCAGG - Intergenic
1019321356 7:416907-416929 GAGGCCATCTCCAGGGTTTTTGG + Intergenic
1019334578 7:476934-476956 GAGCCCAGCACCGTGGGGATGGG - Intergenic
1019450401 7:1094831-1094853 GAGCCCAGCACCACGGTGCTGGG - Intronic
1023999881 7:45183218-45183240 AAGCCCTGGGCCAGGGGGTTGGG - Exonic
1024275183 7:47671541-47671563 GTGCCCAGCCCCGGGGGGTTAGG - Intergenic
1024607416 7:51033957-51033979 GAGCCCAGCTCCAGGCGCTTGGG + Intronic
1027631566 7:80612072-80612094 CAGCCCAGCTCCTGGGTGATGGG + Intronic
1032439642 7:131932629-131932651 AAACCCAGATCCAGGAGGTTAGG + Intergenic
1035033346 7:155878899-155878921 GCCCCCAGCTCCAGAGAGTTGGG - Intergenic
1035752897 8:2008402-2008424 GAGCCCTGCTCCTGGGGGGCAGG + Intergenic
1036048950 8:5174360-5174382 GAGGCCTGATCCAGGGGGTCGGG - Intergenic
1036296617 8:7542990-7543012 GAGCCCAACTCCAGTAGGTGGGG + Intergenic
1036325949 8:7778029-7778051 GAGCCCAACTCCAGTAGGTGGGG - Intergenic
1038443867 8:27589555-27589577 GAGGGCAGCTCCAGGGGAGTGGG - Intergenic
1040016678 8:42705969-42705991 GATGCCAGCTCCAGGAAGTTGGG - Intronic
1045504363 8:102768226-102768248 GAGCCAAGCTCCAGGGTGACAGG + Intergenic
1045684195 8:104694270-104694292 GAACCCAGATCCTGGGGGTGGGG - Intronic
1047508967 8:125501740-125501762 GAGCCCTGCCACAGGGGGTGGGG + Intergenic
1047516147 8:125556532-125556554 GAGCTCAGCCCCAGGGTGCTGGG - Intergenic
1048377342 8:133834175-133834197 GGGGCCAGCTCCAGGAGGTGCGG + Intergenic
1048475990 8:134742772-134742794 TAGCCCAGCTCCAGAAGGTCTGG - Intergenic
1049009687 8:139879203-139879225 GAGCCCAGGTCATGGGGGGTGGG + Intronic
1049266004 8:141668245-141668267 GAGCCGAGCTCCCGTGGGTTAGG + Intergenic
1051173820 9:14345029-14345051 AAGCCCAGCTCCAGGGGTTCTGG + Intronic
1052840479 9:33288524-33288546 GGGCCCAGCTCCTGGGGGCTGGG + Intergenic
1053196930 9:36126803-36126825 GAGCCCAGCCTCAGGGCATTAGG + Intergenic
1055980475 9:81995375-81995397 CACAACAGCTCCAGGGGGTTCGG - Intergenic
1057122477 9:92588605-92588627 GAGCCCATATCCTGGGGGTTAGG - Intronic
1057907158 9:98992194-98992216 GAGCCCACTGCCAGGGGGCTCGG + Intronic
1061059775 9:128244646-128244668 GAGCCTGGAGCCAGGGGGTTGGG - Intronic
1061144364 9:128788494-128788516 GGGCCCAGCTGCTGGGGGCTGGG + Intronic
1061278532 9:129583681-129583703 GAGACCAGCTCCTGGGGGTTGGG - Intergenic
1061589935 9:131591681-131591703 GAGCTGAGCCCCAGGGCGTTGGG - Intronic
1062003726 9:134229173-134229195 GGGCCCAGCTCCTGGGCGATGGG + Intergenic
1062043342 9:134414242-134414264 GAGCCCAGCTCCAGGCACCTGGG + Intronic
1062158115 9:135065407-135065429 GAGCCCAGGTCCAGGGATGTGGG - Intergenic
1062581399 9:137230698-137230720 GAGCCCCACTCCAGGAGGGTTGG + Intergenic
1062642960 9:137530905-137530927 GAGCCCAGCACCAGGAGATTGGG - Intronic
1190014881 X:46818353-46818375 CAGCCCAGCACTAGGGGGTAAGG + Intergenic
1190385293 X:49878671-49878693 GACCCCAGCTCCGGGGGGGCCGG - Intergenic
1195263106 X:103153518-103153540 GAGCCCAACTTCAGGAGTTTGGG + Intergenic
1196761252 X:119202769-119202791 GAGCACAGTTCCTGTGGGTTGGG + Intergenic
1198647422 X:138824320-138824342 GAGCCCAGTTGCAGAGGTTTAGG + Intronic
1200097236 X:153670037-153670059 GAGGCCAGCCCCAGGGGGAGGGG + Exonic
1201900690 Y:19044168-19044190 GAGGGCAGCCCCAGGGGGTCAGG - Intergenic