ID: 1160611204

View in Genome Browser
Species Human (GRCh38)
Location 18:80086793-80086815
Sequence TAGGAGAAGCAGGATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 0, 2: 6, 3: 93, 4: 1051}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160611204 Original CRISPR TAGGAGAAGCAGGATGGGGA GGG (reversed) Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901105382 1:6751857-6751879 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
901164318 1:7206929-7206951 TAGAAGAAGCAGGCCGGGGGTGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903501892 1:23805033-23805055 GATGAGAATGAGGATGGGGAAGG - Intronic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
903978313 1:27166703-27166725 TGGGAGAAGCAGGTTTGGGGAGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904136335 1:28315472-28315494 GAGGAGAAGCAGTATGGCGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904581678 1:31548476-31548498 GAGGAGAAGAGGGATGGGGGTGG + Intergenic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905843158 1:41202712-41202734 TAGGAGTAATATGATGGGGAGGG + Intronic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906994625 1:50778668-50778690 GAAGAGAAGGAGGAAGGGGAGGG + Intronic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907184509 1:52599624-52599646 AAGAAGGAGCAGGATGGGCAGGG + Intergenic
907242768 1:53089957-53089979 GAGGAGCAGCAGGAGGGGCAGGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
907865752 1:58397659-58397681 CAGAAGGAGCAGGCTGGGGAAGG - Intronic
907990982 1:59582556-59582578 TAGGAGAAGGAGTAGAGGGAAGG - Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
909012865 1:70354273-70354295 TACCAGAAGCAGGATTGGCAAGG - Exonic
909142559 1:71887235-71887257 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
909354097 1:74687180-74687202 TAGGAGAAGCCGGATGGTGTAGG - Intergenic
909603068 1:77480922-77480944 GAGGAGAAGCAGGATAGGGCAGG + Intronic
909919223 1:81359760-81359782 TAAGAGAAACAGGTTGGGGGTGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
910713176 1:90202902-90202924 CAGCAGAAGAATGATGGGGAAGG + Intergenic
910974127 1:92887836-92887858 TAGGAGAAGCAGGCTTTGAATGG + Intronic
911175297 1:94811870-94811892 CAGGAAAGGCAAGATGGGGAAGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912548710 1:110470140-110470162 TAGGGGAAGAAGGAAGGGAAGGG - Intergenic
912932369 1:113976016-113976038 AAGGAGGTGCAGGATGGAGATGG + Exonic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
913326046 1:117629833-117629855 TAGAAAAAGCAGGAAGGGGGAGG - Intergenic
913373791 1:118129641-118129663 GAAGAGAAGGAGGATGGGCAGGG - Intronic
914058050 1:144183173-144183195 GAGGAGGAGGAGGAGGGGGAAGG - Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914824973 1:151133456-151133478 CAGGAGGAGTGGGATGGGGACGG + Exonic
914846121 1:151284290-151284312 TCGGGAAAGCAAGATGGGGAGGG + Intronic
915035781 1:152922955-152922977 TAGGAGTAGCAGGACAGAGAAGG + Intergenic
915049706 1:153055714-153055736 GAGGAGGAGGAGGATGGTGATGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915213916 1:154327978-154328000 TGGGAGAAGGAGGCTGGGGGAGG + Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797698 1:158754284-158754306 TAGGAGAGGCAGGCTTTGGAAGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915989523 1:160499731-160499753 TAGGAGGAGCTGAATAGGGAAGG + Intronic
916295215 1:163211684-163211706 TATGAGAAGTAGGATGGAGTTGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916755437 1:167765216-167765238 TAGGAGAAACAGGTTGGCCATGG + Intronic
916859454 1:168787123-168787145 TAGGAAAAGCAGGGCGGGGATGG + Intergenic
917034304 1:170730172-170730194 GGGGAGGAGAAGGATGGGGAGGG - Intronic
917237065 1:172905453-172905475 TAGGAAAAGTAGGATAGAGAAGG + Intergenic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
917779047 1:178371665-178371687 TAGCTAAAGCAGGAAGGGGAAGG + Intronic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918009386 1:180572451-180572473 GAGGAGGAGCAGGTTTGGGACGG - Intergenic
918656808 1:187037009-187037031 TATGAGAAGGGGGATGGGGGAGG + Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919654405 1:200183382-200183404 TAAAAGAAGCAGGCTGGGCATGG + Intergenic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920850279 1:209623756-209623778 GAGGAGGAGCAGGAGGGAGAGGG + Intronic
921343769 1:214160555-214160577 AAGGAGAAGAAGTATGGGTAGGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921843993 1:219859940-219859962 TTGGAGAAGAAAGGTGGGGATGG - Intronic
921921286 1:220672916-220672938 GAGGAGAAGGAGGAGGGGAAAGG + Intergenic
921949820 1:220917635-220917657 TAGGAGCATTGGGATGGGGAAGG + Intergenic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922572185 1:226640695-226640717 AAGGAGAAGGCGGATGGGTACGG + Intronic
922919826 1:229293156-229293178 TAGGAGACGAGGTATGGGGATGG + Intronic
922925021 1:229341497-229341519 CAGGCGAGGGAGGATGGGGAGGG + Intronic
922931366 1:229392394-229392416 TAAGGGAAGCAGGAAAGGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923219818 1:231882934-231882956 TAGGAGAAGAAGGAATGGGTGGG + Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923482382 1:234397324-234397346 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
923688235 1:236169141-236169163 TGGGAGGTGCGGGATGGGGAAGG - Intronic
924150437 1:241124101-241124123 AAGAAGAACCAGGATGGGCATGG + Intronic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1063295678 10:4803253-4803275 GAGGAGCACCAGGAAGGGGAAGG + Intronic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1063696495 10:8340510-8340532 TAGAAGAACCAGGATGGGATGGG - Intergenic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1065455536 10:25903129-25903151 TTTGAGTAGCAGGATTGGGAGGG - Intergenic
1065753585 10:28910653-28910675 GAGGAGAAGAAGGGTTGGGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067473369 10:46551350-46551372 TAGGCCAAGGAGGATGGGGGTGG - Intronic
1067571709 10:47376621-47376643 GGGGAGAAGGAGGATGGGGTGGG - Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068636157 10:59350495-59350517 TAGGAGAGTCATGCTGGGGAGGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070332596 10:75429110-75429132 AAGGAGAAGGAGGAGGGGAAAGG - Intergenic
1070405350 10:76089734-76089756 TAGGTGATGAAAGATGGGGAGGG - Intronic
1070456684 10:76624125-76624147 AAGGAGGAGCAGGCTTGGGAAGG + Intergenic
1070530734 10:77335142-77335164 GAGGAGGAGGAAGATGGGGAAGG - Intronic
1070747924 10:78946040-78946062 TGAGAGAAGCAGGATAGGGGAGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071827786 10:89342423-89342445 AAGGAGCAGGAGGATGGGGGAGG - Intronic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072640453 10:97207352-97207374 TGGGAGATGAAGGATGGGCAGGG - Intronic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073546523 10:104353945-104353967 TAGGAGAGGGACAATGGGGAGGG - Intronic
1073757809 10:106599388-106599410 GAGGAGGAGAAGGAAGGGGAGGG + Intronic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1073863187 10:107770710-107770732 TAGGCAAAGCAGCATGGGGGAGG - Intergenic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074363792 10:112842282-112842304 TGGGGGAAGCAGGGTGGGGCAGG - Intergenic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1074691138 10:116005094-116005116 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1075445214 10:122508300-122508322 TGGGAGAAGCAGGAAGGTGTGGG + Intronic
1075922726 10:126226321-126226343 GAGGAGAAGCCGGGTGGGCATGG + Intronic
1076004816 10:126940024-126940046 GAGGAGAAGCAAGAAGGAGAAGG + Intronic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1076809429 10:132878940-132878962 TAGGAGGAGCAGGACAAGGAGGG + Intronic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077150764 11:1072166-1072188 AAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1077290023 11:1784812-1784834 TGGGAGAAGCGGGGTTGGGAAGG - Intergenic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077392581 11:2306941-2306963 GAGGAGAAGGAGGAGGGAGAAGG + Intronic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077554056 11:3217606-3217628 CAGGTGCAGCAGGGTGGGGAGGG + Intergenic
1078280778 11:9898945-9898967 GAGGAAAATCAAGATGGGGAAGG + Intronic
1078686336 11:13535631-13535653 TAGGAGATGGGGGGTGGGGAGGG - Intergenic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080434100 11:32223996-32224018 CAGGACAATCAGGATGGTGAGGG - Intergenic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080908041 11:36566511-36566533 AAGGAGCAGGAGGATGGGGGGGG + Intronic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081994520 11:47355047-47355069 GAGGCGAAGCGGGATGTGGAGGG + Exonic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082762064 11:57136792-57136814 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1082832939 11:57632938-57632960 TGAGAGAAGCAGGATGGTAAAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083298124 11:61726154-61726176 TTGGCAAAGCAGGATGGGGCAGG + Intronic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1083799562 11:65038670-65038692 GAGGAGGAAGAGGATGGGGAAGG + Exonic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084104873 11:66974975-66974997 GAGGAGAAGGAGGAGGGGGGAGG + Intergenic
1084120401 11:67065871-67065893 GAGGAGAAGCAGGGCGGGGGAGG - Intronic
1084264771 11:67999252-67999274 TACAAGGAGCAGGATGGGCAGGG - Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084576306 11:69990145-69990167 TAGGAGAGGCAGGGCGGGGTGGG - Intergenic
1084601185 11:70146878-70146900 TAGAAAAAGCAGGCAGGGGAAGG - Intronic
1084735775 11:71104362-71104384 TCAGAGATGCAGGATGGGGGGGG - Intronic
1085409623 11:76283412-76283434 GAGGAGAAGGGGGAAGGGGAGGG + Intergenic
1085745809 11:79113242-79113264 GAGGAGAAGCAAGAGAGGGAAGG + Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1088130599 11:106484628-106484650 GAGGAGAATGAGGATGGTGATGG - Intergenic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1090391777 11:126393466-126393488 CAGGAGGAGGGGGATGGGGACGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091344957 11:134846209-134846231 GAGGTGCAGCAGGCTGGGGAGGG + Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091603092 12:1929806-1929828 GAGGAGGAGGAGGAAGGGGAAGG + Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091929183 12:4381106-4381128 TTGGAGAAGCAGCCTAGGGAAGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092166821 12:6347726-6347748 GAGGGGAAGCAAGATGGGTAAGG - Exonic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092281726 12:7102516-7102538 GAGGAGAAGCTGGATGGGAGGGG - Intronic
1092349848 12:7747263-7747285 TAGTAGGAGCAGGATGGAGTGGG - Intronic
1092614632 12:10205579-10205601 TAGGAAAAACAGGAAAGGGAAGG + Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092830379 12:12438927-12438949 TAGGGGAAGCTGCATGGGGCAGG - Intronic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093847477 12:23990570-23990592 TAGGAGAAGGAAGAATGGGAAGG - Intergenic
1094056118 12:26271422-26271444 TAAGATAAGTAGGATTGGGAAGG + Intronic
1094172421 12:27507662-27507684 TGGGAGAGGTGGGATGGGGATGG - Intergenic
1094224708 12:28032014-28032036 GAGGAAAAGCAGGCTGGGCACGG - Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095196880 12:39329591-39329613 GAGGAGAAGCAAGAGAGGGAGGG + Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1095724964 12:45441588-45441610 TAGGAGAATGAGGTTGGGGTGGG + Intergenic
1096504110 12:52082017-52082039 CCGGGGAAGCAGGATGGGAAGGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096591444 12:52662573-52662595 TAGGTGAATGAGGGTGGGGAGGG - Intergenic
1096596954 12:52701880-52701902 CAGGAGAAGCAGGCAGGGCATGG - Intronic
1096629434 12:52916314-52916336 TAGGAGCAGGAAGATAGGGATGG + Intronic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097153631 12:56996965-56996987 TAAGTGAAGGCGGATGGGGATGG + Intergenic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097793029 12:63834659-63834681 TAAGAGAAGCAGGACAGGCATGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098059316 12:66543157-66543179 TGGGGGAAGAAGGCTGGGGACGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098876502 12:75871616-75871638 CAGGAGGAGCAGGTTGGGAAGGG - Intergenic
1099050808 12:77779789-77779811 TAGGAGAAGCAGGAGAGGCCTGG + Intergenic
1099064910 12:77963911-77963933 GAGGAGAAGAAGGAAGGAGAAGG - Intronic
1099148041 12:79072905-79072927 TAGGTGAAGGAGTAAGGGGAAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099601104 12:84738826-84738848 TAGGAGAAGCAGTAAAGCGAAGG - Intergenic
1099959179 12:89380408-89380430 GAGGAGAAGGGGGAGGGGGAAGG - Intergenic
1100344540 12:93714917-93714939 GAGGAGAAGGAGGTTGGGAATGG + Intronic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100963590 12:99989235-99989257 TAGAATCAGCAGGATGGTGATGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101944997 12:109129928-109129950 TTGGTGCAGCAGGAAGGGGAAGG + Intronic
1102095507 12:110237427-110237449 TAGGCGAAGGAGGCTGGGCATGG - Intergenic
1102156910 12:110737599-110737621 TAGGAAAATCAGGATGGGAGAGG - Intronic
1102252215 12:111394963-111394985 TGGGAGATGGAGGATGGGGGTGG + Intergenic
1102599407 12:114017822-114017844 GAGGGGAAGCAGGATAGGAAAGG - Intergenic
1102655632 12:114480356-114480378 GAGGAGGAGGAGGAAGGGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103788196 12:123449427-123449449 GAGGCGAAGCAGGATTGGGCAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1103896587 12:124277570-124277592 CAGGAGAAGCCCGACGGGGAGGG - Intronic
1103902493 12:124310607-124310629 TGTGAGGAGCAGGATGGGGTGGG + Intronic
1104515294 12:129419490-129419512 TAGCAGAAGGAGGATGGTAAGGG + Intronic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106243029 13:27925271-27925293 GAGGAGGAGGAGGAAGGGGAGGG - Exonic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107449450 13:40495452-40495474 GAGGAGGAGCAGGATAAGGATGG - Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1107662212 13:42650424-42650446 GAAGAGGAGGAGGATGGGGAAGG + Intergenic
1108152958 13:47555577-47555599 TTGGAGAAGCAGCATGGTGCAGG - Intergenic
1108411582 13:50153815-50153837 TAGGATTAAGAGGATGGGGAGGG + Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1110484850 13:76026724-76026746 TAGGAGAAGCAGTCTGGAGAGGG - Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110519229 13:76455827-76455849 GAAGAGAAGCAGGAGAGGGAGGG + Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111951802 13:94713594-94713616 TGGGAGGAGGAGGATTGGGAGGG - Intergenic
1112072916 13:95874676-95874698 GAGGAGGAGAAGGAAGGGGATGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112781620 13:102906932-102906954 TAGAGGAAGATGGATGGGGAAGG - Intergenic
1112838435 13:103545997-103546019 TAGCAGAAACACCATGGGGAGGG - Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113851171 13:113419039-113419061 AAGGAGAAGAAGGAAGGGAAGGG - Intergenic
1114204754 14:20558499-20558521 GAGGAAAAGCAGGGAGGGGAGGG - Intronic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114669521 14:24401408-24401430 TTGGAGAAGGAGGACAGGGAAGG + Intronic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116664071 14:47752303-47752325 TAAAAGAACCAGGTTGGGGATGG - Intergenic
1117025801 14:51618723-51618745 TAGGAGAAACAGGTTTGGGTGGG + Intronic
1117340613 14:54788467-54788489 CAGGAGGAGGAGGGTGGGGATGG - Intronic
1117722801 14:58643818-58643840 TGGGAGAGGAAGGATGGGGAAGG + Intronic
1118263018 14:64265826-64265848 TAAAAGAAGCAGGATGGTGCAGG + Intronic
1118299896 14:64605926-64605948 CAGGAGAGGGAAGATGGGGATGG + Intergenic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1118886439 14:69870715-69870737 TAGTGGAAGCAGGACGGGCAAGG - Intronic
1119422940 14:74518360-74518382 GATGAGAAGCAGGCTGGGGCCGG - Intronic
1119733326 14:76964970-76964992 TGGGAGTAGCAGGCTGGGGGAGG + Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119812191 14:77531475-77531497 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1120234645 14:81876357-81876379 TAGGACCATGAGGATGGGGAAGG + Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120993393 14:90397645-90397667 GCGGAGAAGCGGGGTGGGGAGGG - Intronic
1121073096 14:91043020-91043042 TGGGAGAAGCCGGATTGGAATGG - Intronic
1121087105 14:91155018-91155040 GACTAGAAGCAGGCTGGGGAGGG - Intronic
1121170975 14:91854403-91854425 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122353805 14:101111958-101111980 TCGGCGAAGGAGGAAGGGGAAGG - Intergenic
1122533249 14:102443848-102443870 TAGGACAAGCACGATGTGAAAGG - Intronic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122647940 14:103207404-103207426 GAGGAGAGGGAGGAAGGGGAGGG - Intergenic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1122885598 14:104709048-104709070 CAGGAGATGCAGGATGGGTCGGG - Intronic
1123022661 14:105408952-105408974 GAGGAGCAGGAGGAGGGGGAGGG - Intronic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1124252768 15:28117754-28117776 TAGGATGAGAAGGATGGGCAGGG - Intronic
1124696578 15:31869358-31869380 GAGGAGGAGGAGGATGGTGAAGG + Intronic
1124816784 15:33001703-33001725 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1125429192 15:39579366-39579388 TAGAAGGAGAAGGAAGGGGAGGG + Intergenic
1125466729 15:39960604-39960626 TATGAGGAACAGGATGGGGCGGG + Intronic
1125684656 15:41556796-41556818 TAGGAGGAGGAGGAGGGGAAGGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126120170 15:45244512-45244534 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126525429 15:49648996-49649018 TAGGAGTAACAGAATGGGAAAGG + Exonic
1126705648 15:51402657-51402679 TAGGAGAAGGATGAGGGAGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127281528 15:57497367-57497389 TAGGGGGAGCAGGGTGGGGCGGG + Intronic
1127373593 15:58362341-58362363 TAGGAGAAGATGGAAGGGAAAGG + Intronic
1128157579 15:65401569-65401591 CAGAAGGAACAGGATGGGGACGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128759476 15:70206106-70206128 TCAGAGAGGAAGGATGGGGAAGG + Intergenic
1128788177 15:70413485-70413507 TAGATGAAGCAGGAGAGGGAGGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129534406 15:76300336-76300358 GAGAAGTAGCAGTATGGGGAAGG - Intronic
1130151510 15:81315138-81315160 TAGCAGAGGCGGGATGGGCAGGG - Intronic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130686123 15:86039400-86039422 TAAGATATGGAGGATGGGGATGG - Intergenic
1130744357 15:86635256-86635278 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1131011144 15:89019507-89019529 TGGGTGAAGTAGGAAGGGGAAGG - Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1132467215 16:82899-82921 GAGAAGAGGCAGGATGGAGACGG + Intronic
1132520199 16:383763-383785 GAGGAGAGGCGGGGTGGGGATGG + Intronic
1132906893 16:2287085-2287107 TAGGAGAAGGGTGATGGGGCGGG - Intronic
1132920947 16:2392266-2392288 GAGGAGAAGCTGGTAGGGGAGGG - Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134657306 16:15956803-15956825 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1134770602 16:16806044-16806066 AAGGAGAAGGGGGAAGGGGAAGG - Intergenic
1135002732 16:18790420-18790442 TAGGAGAAGGACGAGGGTGAGGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135543643 16:23351479-23351501 CAGGAACAGGAGGATGGGGAAGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136849718 16:33603189-33603211 GAGGAGAGGAAGGATGGGAAGGG - Intergenic
1137004107 16:35256081-35256103 CAGGAGATTCAGGACGGGGAGGG - Intergenic
1137033249 16:35544182-35544204 TGGGAGATTCAGGATGGAGATGG - Intergenic
1137807282 16:51319351-51319373 TGGAAGAAGCAGGACAGGGAAGG - Intergenic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1137859301 16:51830413-51830435 GAGGAGGGGGAGGATGGGGAGGG - Intergenic
1138181652 16:54944737-54944759 TCGGGGGAGCAGGGTGGGGAAGG - Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140854695 16:78967807-78967829 TAGGAGAGGCAGGATGGGAGAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141053911 16:80798407-80798429 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141703586 16:85653211-85653233 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141703617 16:85653283-85653305 TAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142978009 17:3656641-3656663 TGGGAGAAGCTGGGTGGTGAGGG - Intronic
1143162367 17:4879980-4880002 TAGGAGAAGGAGGCTAGGGAGGG - Intronic
1143287323 17:5800057-5800079 GAGGAGAAGGAGGAAGGAGAGGG - Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143542597 17:7578536-7578558 GAGGAGCAGCAGGAGGGGGGAGG + Exonic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144580441 17:16456083-16456105 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
1144580453 17:16456128-16456150 TAGGAGGAGGAGGAAGAGGAGGG + Intronic
1144898794 17:18564187-18564209 GGGGAGAAGTAGGATTGGGAAGG - Intergenic
1145133581 17:20381536-20381558 GGGGAGAAGTAGGATTGGGAAGG + Intergenic
1145221930 17:21096604-21096626 TAGGATAAGTTGGGTGGGGAAGG + Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146453959 17:32995273-32995295 GGTGTGAAGCAGGATGGGGAAGG + Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146548028 17:33755939-33755961 GATGATAAGCAGGGTGGGGAAGG + Intronic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1146907328 17:36626132-36626154 TAGCAGAGGCAGGATGGGTCCGG - Intergenic
1147158782 17:38559033-38559055 TAGCAGAGACAGGCTGGGGAGGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148253562 17:46107804-46107826 TAGTTGAAGCAGGTTTGGGATGG - Intronic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1149684836 17:58529360-58529382 GAGGAGAAGAGGGGTGGGGAAGG - Intronic
1150121909 17:62610724-62610746 TAAGAGAGGCAGGAGGGTGAGGG + Intronic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150628598 17:66859816-66859838 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151380750 17:73724220-73724242 TAGGAGAGGGAGGCTGGAGAGGG + Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152315949 17:79580273-79580295 GAGGAGGAGGAGGATGGGGGGGG - Intergenic
1152410550 17:80120538-80120560 GAGGTGAAGTGGGATGGGGACGG - Intergenic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152601926 17:81267400-81267422 TAAAAGAAGAAGGAGGGGGAGGG - Intronic
1153399408 18:4666911-4666933 TAGGCAAAGCAGCATGGGGGAGG - Intergenic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1153680643 18:7497352-7497374 GAGGAGAAGGAGGAAGGGGGAGG + Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1157589683 18:48828908-48828930 GAGGAGGAGCAGGCGGGGGAAGG - Intronic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158621743 18:59038617-59038639 GAGGAGAAGCAGGGTCTGGAGGG + Intergenic
1158639542 18:59191871-59191893 TAAGAGAAGCAGGATAAGAAAGG - Intergenic
1159517671 18:69478395-69478417 AAGGAGGAGAAGGAAGGGGAGGG - Intronic
1159812965 18:73038987-73039009 TGGGAGAAGAGGGATGGGGGAGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695326 19:481207-481229 GATGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1161042834 19:2119118-2119140 GAGGATAAGCAGGATGGGCAGGG + Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161370618 19:3908896-3908918 GGGGAGGAGGAGGATGGGGAGGG - Intronic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161633086 19:5369197-5369219 TAGGAGCCACAGGATGGGGAGGG - Intergenic
1161837035 19:6654796-6654818 GAGGAGGAGGAGGATGGAGAGGG - Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1161879411 19:6937426-6937448 TGGGAGGAGGGGGATGGGGAGGG - Intronic
1162065182 19:8121182-8121204 GAGGAGAGGGAGGGTGGGGACGG - Intronic
1162113469 19:8413752-8413774 TCTGAGAAGGAGGTTGGGGAAGG - Intronic
1162818114 19:13208158-13208180 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163398168 19:17076053-17076075 AAGGAGAAAGTGGATGGGGATGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1163809104 19:19419310-19419332 TACGAGATGCAGGAAGGGGCTGG - Intronic
1164292689 19:23881819-23881841 TAAGAGAAGGAGGAAGAGGAGGG + Intergenic
1164502510 19:28831646-28831668 TAGGAGAATCTGGAAGGGGGAGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164760971 19:30727978-30728000 CAGGAGGAAAAGGATGGGGAAGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165788702 19:38477891-38477913 TGGGAGGTGCAGGGTGGGGAGGG + Intronic
1165848055 19:38831649-38831671 TAGCAGATGTAGGACGGGGAGGG - Intronic
1165887080 19:39085763-39085785 GAGGAGAAGAGGGATGGAGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166381959 19:42359294-42359316 TGGGAGTCCCAGGATGGGGATGG - Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166550728 19:43664397-43664419 CAGGAGAGGAAGGGTGGGGAAGG - Intronic
1166598563 19:44072877-44072899 TTTGAGAATCAGGCTGGGGAAGG - Intronic
1166944697 19:46389854-46389876 GAGGGGCAGGAGGATGGGGATGG - Intronic
1167058997 19:47131576-47131598 TCGGAGAGGCTGGAGGGGGACGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167686528 19:50960082-50960104 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167686544 19:50960118-50960140 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1167805646 19:51782195-51782217 TAGGAGGAGGAGGAGGGGAAGGG + Intronic
1167980750 19:53272986-53273008 TAGGAGAAGGAGGACATGGAAGG + Intergenic
1168067942 19:53930100-53930122 TAGGAGGAGAGTGATGGGGAGGG + Intronic
1168076983 19:53985986-53986008 GAGGAAGAGCAAGATGGGGAGGG + Exonic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168608174 19:57776442-57776464 TGGGAGGAGGAGGATGGGCAAGG + Intronic
1168609816 19:57790173-57790195 TGGGAGAAGGAGGATGGGCAAGG + Intronic
1168694327 19:58396210-58396232 GAGGAGGAGGAGGAAGGGGACGG + Exonic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926309012 2:11661016-11661038 GAGTAGAAGCAGGAGAGGGAAGG - Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926696162 2:15771316-15771338 GAGGAGACCCAGGGTGGGGACGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927732604 2:25487836-25487858 GAGGAGAGGCAGGATGTGAAAGG + Intronic
928105838 2:28470082-28470104 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928214814 2:29352436-29352458 TAGGAGAGCAAGGTTGGGGAGGG - Intronic
928268836 2:29836094-29836116 TGCAGGAAGCAGGATGGGGAAGG - Intronic
928424381 2:31166045-31166067 GAGGAGGAGCAGCATGGGAAAGG - Intergenic
929535821 2:42783620-42783642 TGGAAGAGGAAGGATGGGGAAGG + Intronic
929551741 2:42897681-42897703 TAGGCCAAGCAGGATGGAGGAGG - Intergenic
929714167 2:44293634-44293656 TGAGAGAAGCAGGCTGGGTAAGG + Intronic
929978601 2:46658036-46658058 TGGGAGGACCAGGCTGGGGAAGG + Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930920123 2:56743076-56743098 TATGAGAGACAGGATGGGGGAGG + Intergenic
931205343 2:60140846-60140868 GAGGAGGAGAAGGAGGGGGAGGG - Intergenic
931295753 2:60923534-60923556 AAGGAGAAGCAAGTTTGGGAGGG - Exonic
931902759 2:66807550-66807572 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
932196574 2:69788945-69788967 TGGGACAAACTGGATGGGGAGGG + Intronic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932467879 2:71935061-71935083 GAGGAGGGGCAGGTTGGGGATGG + Intergenic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932692099 2:73921717-73921739 TAGGGGTGGAAGGATGGGGAAGG - Intergenic
932729424 2:74207898-74207920 GAGGAGGAGGGGGATGGGGAGGG - Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933197861 2:79412786-79412808 AAGGAGAAACTGGATGGTGAAGG + Intronic
933215832 2:79629094-79629116 TAGGGGAAGCAATAAGGGGAAGG - Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
933699350 2:85243612-85243634 CAGGAGGAGAAGGCTGGGGATGG + Intronic
934110242 2:88735507-88735529 TAGGAGCAGCATGATGGGACTGG + Intronic
934674800 2:96241981-96242003 TAAGAGAAGGAGGCTGGGCATGG - Intergenic
934692873 2:96375266-96375288 TAGGAGAAGCAGGGTTGTGGGGG - Intergenic
934925925 2:98381731-98381753 TGGGGGAAGGAGGCTGGGGAAGG + Intronic
935568647 2:104635933-104635955 TAACAAAAGCAGGCTGGGGATGG - Intergenic
935738333 2:106124643-106124665 TAGGGGAAGCAGGATGGCTGTGG + Intronic
937402906 2:121600765-121600787 TAGGAAAAGGAGGTTGGGGATGG - Intronic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937867784 2:126767037-126767059 GAGGAGTAGCGGGCTGGGGAAGG - Intergenic
937966531 2:127515830-127515852 TAACTGAAGCAGGATGGAGAAGG - Intronic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938099711 2:128490445-128490467 AAGGAGAAGGAGGAAGGGAAGGG + Intergenic
938127670 2:128686249-128686271 AAGGAGCCCCAGGATGGGGATGG - Intergenic
938232935 2:129677617-129677639 TAGGAGAATGAGGGTGGGGCTGG - Intergenic
938758552 2:134402593-134402615 TAGGAGAGGAAGTTTGGGGAAGG - Intronic
939606596 2:144262615-144262637 TAGGAGAGGAAGGGAGGGGAGGG + Intronic
939848875 2:147280190-147280212 TAGTACAAGCAAGATGGGGTTGG + Intergenic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940253721 2:151707514-151707536 TAGGAGGAGGAGGATGGAGCAGG + Intronic
940283024 2:152006874-152006896 GAGGAGAGGCAGGATTGGGGTGG - Intronic
940897359 2:159093736-159093758 TAAGAGAAGAGGGAGGGGGAGGG - Intronic
940937221 2:159510136-159510158 TAGGAGATGGGGGATGGTGAGGG + Intronic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943503415 2:188721596-188721618 TAGAGGAAGCAGGATTGGGCAGG - Intergenic
943567770 2:189536367-189536389 TAGGAGTAGCAGGAGAGGGGTGG - Intergenic
943890253 2:193277266-193277288 GAGGAGGAGGAGGAAGGGGAGGG - Intergenic
944516096 2:200513107-200513129 TTGGTGAGGCAGGAAGGGGAGGG + Intronic
944808570 2:203306379-203306401 TAGAAGGAACAGGATGGGGTCGG - Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946306735 2:218860521-218860543 TAGGCAAAGCAGGGCGGGGAAGG - Intronic
946599117 2:221340064-221340086 TAGCCTAAGCAGGATGGAGAGGG + Intergenic
946830561 2:223724186-223724208 TAAGATAGGCAGGATGGGGGTGG - Intergenic
946855829 2:223948833-223948855 TAGGAGGAGCAGGTTTGGAAGGG + Intergenic
947636948 2:231684987-231685009 GAGGAGGAGGAGGATGGGGAAGG + Intergenic
947901099 2:233722947-233722969 GAGGAGGAGGAGGAAGGGGAGGG + Intronic
948088239 2:235268132-235268154 GAGGAGAGGAGGGATGGGGAAGG - Intergenic
948231384 2:236351767-236351789 TAGGCAGGGCAGGATGGGGAGGG + Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948394241 2:237632655-237632677 TTGGAGAACCAAGCTGGGGATGG + Intronic
948538967 2:238672217-238672239 GAGGAGAAGGAGGAGGGGGGAGG - Intergenic
948558579 2:238835306-238835328 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
948882234 2:240865470-240865492 TTGGAGTAGCAGGTTGTGGACGG - Intergenic
948923806 2:241081385-241081407 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
948939253 2:241187931-241187953 GAGGAGAAGGAGGAGAGGGAAGG + Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168956957 20:1841149-1841171 TCGGGGGAGCAGGATGGAGAAGG - Intergenic
1169503118 20:6180558-6180580 TGGGAAAAGCAGGATGGAGTAGG - Intergenic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170602440 20:17851136-17851158 GAGGAGGAGGAGGAAGGGGAGGG + Intergenic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1172486960 20:35304150-35304172 GAGGAGAGGAAGGAAGGGGACGG + Intronic
1172621694 20:36321694-36321716 TGGGAGAACGAGCATGGGGAGGG + Intronic
1173025644 20:39305257-39305279 TGAGAGAAGCAGGATGGGCTGGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173134210 20:40424938-40424960 GAGGAGGAGAAGGATGGAGATGG + Intergenic
1173145542 20:40521095-40521117 TAGGAGGAGCAGGGAGGGGTGGG - Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173183611 20:40822447-40822469 TAGGAGAAGGGTGTTGGGGAGGG - Intergenic
1173189531 20:40865415-40865437 TAGAACAGGCAGGATGGGGATGG - Intergenic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1174055942 20:47798590-47798612 CAGGAGGAGCAGGTTTGGGAAGG - Intergenic
1174511921 20:51059952-51059974 TGAGAGAAGCAGGATGGAGCAGG + Intergenic
1174655372 20:52167529-52167551 GAGGAGAAGGAGGGAGGGGAAGG - Intronic
1174774895 20:53334480-53334502 TGGCTGAAGCAGGATGGGGGAGG + Intronic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175383294 20:58578175-58578197 TGGGGGAGGCAGGATGGGGTGGG - Intergenic
1175765866 20:61592624-61592646 TAGGAAAAGCAGGGTGGAGGGGG - Intronic
1175816633 20:61886482-61886504 TGGCAGAAGCAGGAAGGGTAGGG + Intronic
1176031123 20:63012568-63012590 AAGGAAAAACAGGATGGGCATGG - Intergenic
1176694661 21:9959740-9959762 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1177249361 21:18572226-18572248 GAAGAGAAGGAGGATGGGAATGG + Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177538066 21:22455167-22455189 GAGGAGGAGAAGGAAGGGGAAGG + Intergenic
1178563801 21:33664367-33664389 TAGTAGGAGCGGGATGGGAAGGG + Intronic
1178897467 21:36571128-36571150 AAGGAGATGCAGGCTGGGCACGG - Intronic
1179480936 21:41678256-41678278 GGGGAGAAGAAGGTTGGGGAGGG + Intergenic
1179582632 21:42352995-42353017 TTGGAGATGCAGGCTGGGAAGGG + Intergenic
1179893176 21:44347918-44347940 TAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180301620 22:11040960-11040982 AAGGAGGAGGAGGAAGGGGAAGG + Intergenic
1180926639 22:19559662-19559684 TAGGAGAAGCCACATGGTGATGG - Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182380455 22:29883369-29883391 GAGGAGACGGAGGACGGGGATGG - Intronic
1182442265 22:30371466-30371488 CATGAGAAGCAGGGTGGGTAAGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183581867 22:38731174-38731196 GAGGAGCAGCAAGATAGGGAGGG - Exonic
1184042340 22:41951560-41951582 TAGATGAGGCAGAATGGGGAGGG + Intergenic
1184205746 22:43001489-43001511 CAGAAGAAGCAGGACTGGGAGGG + Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184676176 22:46044700-46044722 GAGGAAAAGCAGGCCGGGGAGGG - Intergenic
1184883823 22:47329821-47329843 GAGCAGAAGGAGGAAGGGGAGGG + Intergenic
1184959363 22:47917900-47917922 AAGGAGAAGGAGGAAGGAGAGGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950437427 3:12988667-12988689 TCTGAGGAGCAGGCTGGGGAGGG + Intronic
950489863 3:13297628-13297650 TAGGAGCATCAGGATGGGAGAGG - Intergenic
950533184 3:13565007-13565029 TGGGGCAGGCAGGATGGGGAGGG - Intronic
951144844 3:19214619-19214641 TAAGGGAAGCAGGATTGAGAAGG - Intronic
951839929 3:27023440-27023462 TAAGAGAAGCAGGATAGGGCAGG + Intergenic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
953010003 3:39016075-39016097 TGAGAGAAGCAGGGTAGGGAAGG + Intergenic
953075652 3:39567913-39567935 TAGAAGAAGCAGGTTGGGTAGGG - Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953261079 3:41339498-41339520 TGGGAGAAGCAGGAGAGGGGAGG - Intronic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954157547 3:48694951-48694973 GAGGAGAAGGAGGAGAGGGAGGG + Intronic
954411854 3:50374334-50374356 TAGGGGGAGGAGGAGGGGGAAGG + Intronic
954448244 3:50557965-50557987 TAGGAGGGGCAGGATGGGTGAGG - Intergenic
954804146 3:53205855-53205877 TAGGAGAAATAGGCTGGGCATGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955087823 3:55720098-55720120 GAGGAGGAGGAGGAGGGGGATGG - Intronic
955406976 3:58631665-58631687 GTGGAGGAGCAGGATGGGAAAGG + Intergenic
956049760 3:65235367-65235389 TAGGAGGTGGAGGATGGAGAAGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956212626 3:66817307-66817329 GAGGAGGAGGAGGAAGGGGAAGG + Intergenic
956502163 3:69898664-69898686 TTGGAGAACCAGGATGGTAAAGG + Intronic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958584084 3:96062803-96062825 TAGGAGGAGGAGGAAGGGGAAGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960102055 3:113754231-113754253 TAGGAAAAACAGGCTGGGCATGG + Intronic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
961129492 3:124452664-124452686 TAGGTGGAGCCGCATGGGGAAGG + Intronic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
961487512 3:127227270-127227292 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961924032 3:130457552-130457574 TAGGAGAAACTGGGTGGGGTAGG - Intronic
962193009 3:133330987-133331009 TAGGAGAGGAGGGACGGGGATGG + Intronic
962249223 3:133824948-133824970 CAGGAAAACCAGGATGGAGAAGG - Exonic
962848932 3:139293492-139293514 TATGTGAAGCAGGCTGTGGAGGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963405378 3:144856620-144856642 GAGGAGAAGGGGGAGGGGGAGGG - Intergenic
963798793 3:149657468-149657490 TAAGACCAGCAGGATGGGGGAGG + Intronic
963836831 3:150066696-150066718 GAGGAGGAGGAGGAGGGGGAAGG + Intergenic
964124192 3:153218713-153218735 TAGTTGAAGTAGGCTGGGGAAGG + Intergenic
964568139 3:158080881-158080903 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965392448 3:168121332-168121354 TAGCAGCTGCAGGATGGGAAAGG - Intergenic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969315211 4:6377730-6377752 CAGGTGAAGGAGGATGGGCAGGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969617125 4:8260183-8260205 GAGGAGGAGCAGGAGAGGGAAGG - Intergenic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
969979531 4:11140488-11140510 GAGGAGAAGGAGGAGGGGAAGGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970483378 4:16500270-16500292 TGGGAAAAGCAGGATAGGGAAGG - Intergenic
970544570 4:17114381-17114403 TAGTAGAAGCAGGTCAGGGAAGG - Intergenic
970630761 4:17941535-17941557 TAGATGAAGCAGGATGGGAGTGG - Intronic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971251325 4:24975512-24975534 AAGGAAAAGTAGGATAGGGAAGG + Intronic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
972156782 4:36172886-36172908 AAGGAGCAGCAGGATGGAGGTGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972295381 4:37732774-37732796 TAGGGGAAACAGGATGTGTATGG + Intergenic
972833152 4:42837007-42837029 GAGGAGAAGCAGGGCAGGGAAGG + Intergenic
973330068 4:48904026-48904048 TAGGGAAAATAGGATGGGGAAGG - Intronic
973807166 4:54537818-54537840 TAAGAGCTGCTGGATGGGGATGG - Intergenic
974228122 4:59075247-59075269 AAGGAGAAGAAGGAAGGGAAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975778515 4:77816563-77816585 TAAGAGTCACAGGATGGGGAGGG - Intronic
976475512 4:85478019-85478041 TTGGAAAAACAAGATGGGGAAGG + Intronic
976478382 4:85510793-85510815 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
976482673 4:85563035-85563057 TGAGGGAAGCAGGATGGGGCAGG + Intronic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977628469 4:99215210-99215232 TAGGGGATGTAGGATGGAGAAGG + Intronic
977892362 4:102326849-102326871 TAGGATAACCAGGATGAGAAGGG - Intronic
978702311 4:111662595-111662617 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
978910320 4:114054903-114054925 TAGAAAAAGCAGGATGCAGAAGG - Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979488530 4:121297023-121297045 TGGGAGCAGGAGGGTGGGGATGG + Intergenic
979602782 4:122604504-122604526 TGAGAAAAGCAGGATAGGGAAGG - Intergenic
980367287 4:131819965-131819987 GAGAAGTAGCAGCATGGGGATGG - Intergenic
981055902 4:140361045-140361067 TGGGAGAAGCAGGCTGGGATGGG + Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983273955 4:165595033-165595055 TAGGAGAAGAAGGATTGAGAGGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986422554 5:7599286-7599308 TAGGAGAAGCAGGAATGAAAAGG + Intronic
986437576 5:7748970-7748992 TAGTAGAAGCAGGTTGCAGAGGG + Intronic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
986591850 5:9378993-9379015 TAGATGAAAAAGGATGGGGATGG + Intronic
986605881 5:9522290-9522312 GAGGAGAAGTAGGAGGGGAACGG + Intronic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987182784 5:15385072-15385094 GAGGAGGCGCAGGACGGGGAAGG + Intergenic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987428926 5:17807550-17807572 CAGGAACAGCAGGATGGAGATGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990182299 5:53174522-53174544 GAGGAGAAGGAAGAAGGGGAAGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991288109 5:65003389-65003411 TAGGAGAAGAAGAAAGGGAAGGG - Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992349713 5:75916390-75916412 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
992453208 5:76891820-76891842 TGGGAGAGGGAGGAGGGGGAGGG + Intronic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993716132 5:91277361-91277383 GAGGAGAAGGGGGAGGGGGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994541298 5:101101643-101101665 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
994616833 5:102114711-102114733 TAGAAGCAGCAGGAGGTGGAGGG + Intergenic
994850269 5:105046311-105046333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995286926 5:110399925-110399947 TAACAGAAGCAGGCTGGTGAAGG - Intronic
995385901 5:111588465-111588487 TAGGAGGTGGAGTATGGGGAAGG - Intergenic
995918749 5:117284463-117284485 CAGGAGAAGCAGGCCGGGCACGG - Intergenic
997303919 5:132825130-132825152 CAGGAGATGCAGGCTGGTGAGGG - Intronic
997373680 5:133382037-133382059 GAGGAAGTGCAGGATGGGGAAGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997653919 5:135541725-135541747 TAAGAGAAGAAGGGTGGGGTTGG + Intergenic
998392065 5:141793583-141793605 TAGGAGGGGAAGGGTGGGGAGGG - Intergenic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999639792 5:153661048-153661070 GAGGAGCAGCAGCATGGGGCTGG - Intronic
999679670 5:154045056-154045078 AAGGACAAGAGGGATGGGGAAGG - Intronic
1000113872 5:158135215-158135237 CAGGAGAAAGGGGATGGGGAAGG + Intergenic
1000194280 5:158942900-158942922 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000194291 5:158942949-158942971 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000260021 5:159578756-159578778 GAGGAGAAGCAAGATTGAGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001082344 5:168676551-168676573 TGGTAAAAGCAGGAAGGGGAGGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001706056 5:173741782-173741804 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002437455 5:179240389-179240411 TAAGAGAAGGAGGCTGGGTAAGG + Intronic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003023768 6:2535046-2535068 TAGAAGGAGGAGGTTGGGGAAGG + Intergenic
1003651758 6:7967319-7967341 GAGGACAAGCAGGTTGGTGAGGG + Intronic
1004119672 6:12808828-12808850 GAGGAGGAGGAGGAGGGGGAGGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1005044455 6:21628760-21628782 TAGGAGAATAAGGATGGTGCAGG + Intergenic
1005067461 6:21832403-21832425 TAGGATAAGATGGATGGGGATGG + Intergenic
1005647764 6:27857419-27857441 GAGGAGAAGAAGGAAGGAGAAGG + Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006675290 6:35758370-35758392 TGAGAGAAGCAGGAAGGGCATGG + Intergenic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007134478 6:39507952-39507974 GAGGAGGAGGAGGAAGGGGAAGG - Intronic
1007402394 6:41610821-41610843 TGTGAGAAGCTGGATGGGGGTGG + Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007720255 6:43880899-43880921 TGGGGGAAGCAAGATGGGAAAGG + Intergenic
1007812338 6:44495477-44495499 AAGGAGGAGCAGGAAGGGAAAGG - Intergenic
1008289493 6:49696302-49696324 TAGGAGTAGCAGGTTGTGGCAGG + Intronic
1008931752 6:56947536-56947558 TAAGAGAAGCAGGCTGGGCGTGG - Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010265578 6:73862245-73862267 AAGGAGAAGCAGGAAAGGTAGGG - Intergenic
1011417372 6:87136925-87136947 TAGGAGAAGCGGGGTTGGGTGGG - Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1012207625 6:96480168-96480190 CAGGAAAGGCAGGATGGGCAAGG - Intergenic
1012530887 6:100234946-100234968 TAGGAGAAGAAAGAGAGGGAAGG + Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013521265 6:110935910-110935932 TACTAGAATCAGAATGGGGAGGG - Intergenic
1013547147 6:111169485-111169507 TGGGAGATGGAGGCTGGGGAAGG - Intronic
1013836799 6:114343163-114343185 GAGGAGGAGGAGGGTGGGGAAGG + Intergenic
1014559963 6:122877856-122877878 TAGGAGAGGCAGGTTGGGAGAGG - Intergenic
1014571146 6:123009622-123009644 GGGAAGAGGCAGGATGGGGAGGG - Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1015018160 6:128439196-128439218 TATGTGAAGCAGGAAGGGGAAGG - Intronic
1015286412 6:131490628-131490650 TAGGGGACTCAGGATGGGGCTGG + Intergenic
1015577663 6:134690161-134690183 TCAGAGATGCAGGATGGGGTTGG - Intergenic
1016427502 6:143950089-143950111 TGGGTGAGGCAGGATGGTGAGGG - Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017192208 6:151666690-151666712 GAGGAGGAGGAGGAGGGGGATGG - Intronic
1017934794 6:158995887-158995909 TAAAAGAAGAAGGATGGGCACGG - Intronic
1018220202 6:161570495-161570517 GAGGAGGAGGAGGAGGGGGAAGG - Intronic
1018567562 6:165171012-165171034 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1018979551 6:168592185-168592207 TGAGAGAAGCAGGATGGCAAGGG - Intronic
1019294153 7:265114-265136 TAGGAGGGGCAGGAGGGGCAGGG + Intergenic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019891998 7:3954488-3954510 GAGGAGAAGCAGGAGGGGAGGGG - Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020410714 7:7888870-7888892 GAGGAGGAGGAGGAGGGGGAGGG + Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022680264 7:32538605-32538627 GAGGAGAATGAGGTTGGGGATGG - Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023150131 7:37194304-37194326 TAGGAGATGCAGCTTTGGGAAGG - Intronic
1023821438 7:43982871-43982893 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024385680 7:48748795-48748817 CAGGCGAAGCAGCATGGGGGAGG + Intergenic
1024599020 7:50963311-50963333 GAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1025237050 7:57241577-57241599 CAGGAGGAGCAGGTTTGGGAAGG + Intergenic
1026015788 7:66669733-66669755 CAGGAGGGGCAGGCTGGGGAAGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027814708 7:82953701-82953723 GAGGAGGAGGAGGAGGGGGAGGG + Exonic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028471586 7:91212206-91212228 TAGTAGAAGAAAGAAGGGGATGG + Intergenic
1028898416 7:96067831-96067853 TAGGAGGAGGAGGTTGGGGAAGG - Intronic
1029045276 7:97621368-97621390 TAGAAGAAACAGGATTGGGAAGG + Intergenic
1029309638 7:99650724-99650746 GAGGAGAAGGTGGACGGGGAAGG - Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029749701 7:102536292-102536314 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1029767651 7:102635397-102635419 TGGGAGAGGCAGGCAGGGGATGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030034449 7:105396695-105396717 AAGGAGGAGGAGGAAGGGGAGGG + Intronic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1031123056 7:117742959-117742981 GAGGTGAAGCAGGCTGGGCAGGG - Intronic
1031528622 7:122850670-122850692 TAGAAGCTGGAGGATGGGGATGG - Intronic
1031597942 7:123669391-123669413 CAGCAGAAGCAGGTTTGGGAGGG + Intergenic
1031989821 7:128190175-128190197 GAGGGGAAGCAGGATTGGGCAGG + Intergenic
1032130786 7:129225463-129225485 TAGGAGAGGAAGGGAGGGGAGGG + Intronic
1032159254 7:129498205-129498227 GAGGAAGAGCAGGGTGGGGAAGG + Intergenic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033309379 7:140249453-140249475 TGGGAGCAGGAGGATAGGGATGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1034337382 7:150332257-150332279 TGGGAGAAGAAGGAAGGGGGTGG + Exonic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1034393850 7:150805043-150805065 GAAGCGGAGCAGGATGGGGAAGG - Exonic
1034491732 7:151396487-151396509 CAGGAGCAGCGGGAAGGGGATGG + Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035226726 7:157438017-157438039 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035226746 7:157438076-157438098 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1035880257 8:3238817-3238839 TAAGAGTGGCAGGTTGGGGATGG + Intronic
1036453704 8:8891356-8891378 CAGGAGAAGCACGACGCGGAGGG - Exonic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036763850 8:11533616-11533638 GAGGAGTAGGAGGAGGGGGAAGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037747582 8:21659240-21659262 TGGGAGTGCCAGGATGGGGAGGG - Intergenic
1037773735 8:21818932-21818954 GAGGAGGAGGAGGGTGGGGAGGG - Intergenic
1038482134 8:27909175-27909197 TATGTGCAGCAGGATGGGGAGGG + Intronic
1038483731 8:27919130-27919152 GAGGAGAAGGAAGAAGGGGATGG + Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038882225 8:31627655-31627677 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1039031305 8:33312470-33312492 TAGGAGAGGGGGGATGTGGAAGG - Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039524675 8:38203621-38203643 TAGGACAAGCAAGATGAGTAGGG + Intronic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039945131 8:42122442-42122464 TAGGAGCAGGTGGATGGAGATGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040624101 8:49125719-49125741 GAGGAGAAGCAGGAAGGGATCGG - Intergenic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041284841 8:56249564-56249586 GAGGAGGAGGAGGAAGGGGAAGG - Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042487653 8:69364010-69364032 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1043044346 8:75302175-75302197 TATGAAAAGTAGGCTGGGGAAGG - Intergenic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1044121656 8:88404243-88404265 TAAGAGAAGCAGGCTGGGAGCGG - Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044460988 8:92443690-92443712 AAGGAGGAGCAGGTTGGAGATGG + Intergenic
1044461434 8:92449277-92449299 TATGAGAAGCAGGAAAGGTATGG - Intergenic
1044734564 8:95266941-95266963 TAGGAGAACTAGCATGCGGAGGG - Intronic
1044751085 8:95416010-95416032 TGGGAGAAGAAGGAAGGGAAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045024443 8:98073189-98073211 TAGATGAAGCAGCATGGAGAGGG - Intronic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045696113 8:104810547-104810569 TGGAAGAAGCAGGATAGGGTGGG + Intronic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046650107 8:116828435-116828457 GAGGAGAAGGAGTATAGGGAGGG - Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046779953 8:118204374-118204396 GAAGAGAAGCGGGATCGGGAGGG + Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1046943759 8:119955869-119955891 TGGAAGAAGAAGGAAGGGGAGGG + Intronic
1047261313 8:123263010-123263032 GAAGAGAAGCGGGAAGGGGAGGG + Intronic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048265269 8:132980070-132980092 TAGGACAAGGGGGCTGGGGAAGG + Intronic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049398555 8:142413163-142413185 TAGGAGGGGCAGGATGGAGGAGG - Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049454849 8:142681631-142681653 TGGAAGATGGAGGATGGGGAGGG - Intronic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050495273 9:6234415-6234437 GAGGGGAAGCAGGGTGGTGAAGG - Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050779920 9:9320585-9320607 TAGTAGACGAAGGATGGGAAGGG - Intronic
1050989798 9:12135956-12135978 TAGGTGAAGCAGGATTGAGCTGG - Intergenic
1052135557 9:24905629-24905651 TAGCAGGAGCAGCATGGTGAAGG + Intergenic
1052923496 9:33992587-33992609 GAGGGGCAGTAGGATGGGGAGGG - Intronic
1053169123 9:35865981-35866003 TAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1053217075 9:36280554-36280576 TAGGAGAAGCATGAAGGAGGAGG - Intronic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053512535 9:38700873-38700895 TCAGAGAAGGAGGCTGGGGATGG - Intergenic
1053631631 9:39945680-39945702 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1053774131 9:41517850-41517872 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1053832182 9:42095166-42095188 GAGGAGAAGGTGGATAGGGAAGG - Intronic
1053840067 9:42183506-42183528 GAGGTGCAGCAGGAGGGGGAGGG - Intergenic
1054212256 9:62305018-62305040 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1054312729 9:63543814-63543836 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055206109 9:73732464-73732486 TAGGAGAGGTAGGATGGGCAAGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055713155 9:79087808-79087830 TAGGAGGAGCAGCCTGGTGATGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056066650 9:82942408-82942430 GAGGAGAAAGAGGATGGGAAGGG + Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056687467 9:88778333-88778355 TGGGAGAACCCGGCTGGGGAGGG - Intergenic
1056810762 9:89762194-89762216 TAGAAGAAGCAGGCTGGGTGTGG + Intergenic
1057478247 9:95423451-95423473 TAGGAACAGGAGGAGGGGGAAGG + Intergenic
1057542593 9:95989330-95989352 TAGGAGCTTCAGGATGGGGCTGG - Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057954866 9:99399564-99399586 TAGAAGGCACAGGATGGGGAAGG - Intergenic
1058444581 9:105043437-105043459 GAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058817537 9:108698933-108698955 GAAGAGAAGGTGGATGGGGAGGG + Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059715149 9:116906413-116906435 CGGGAGAAGCAGGATGGGAGTGG + Intronic
1059872729 9:118595993-118596015 TAGGAGAAGGAGGTTTGGGGTGG + Intergenic
1060244100 9:121929517-121929539 TATGAAAAACGGGATGGGGAAGG + Intronic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1060389523 9:123267351-123267373 TAGGAGAAGGGTGATGGGGATGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060816742 9:126639098-126639120 TAGGAGAAGAGGGGAGGGGAGGG + Intronic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1062325627 9:136011160-136011182 CAGGAGGAGCAGGAAGGGCAGGG + Exonic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186124712 X:6400912-6400934 GAGGAGGAGGAGGAAGGGGAGGG - Intergenic
1186128743 X:6443753-6443775 TAGTTGAAGCAGGATTGGAAAGG - Intergenic
1186264564 X:7818541-7818563 GAGGAGAAGGAGGGCGGGGAGGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186712343 X:12212450-12212472 TAGGAACAGCACCATGGGGATGG + Intronic
1187106678 X:16250370-16250392 TAAGTGAAGCCGGATGGGGAAGG - Intergenic
1187179858 X:16934123-16934145 TGAGGGAAGCAGGATGGGGCTGG + Intergenic
1187561209 X:20405451-20405473 CACGAGAAGAAGGTTGGGGAGGG - Intergenic
1187705543 X:22006106-22006128 TAGGAGAACCAGGAAGGAGCTGG - Intergenic
1187722432 X:22165325-22165347 TGGGAGAAGCAAGACAGGGAGGG + Intronic
1187817730 X:23251050-23251072 TAGGCAAAGGAGGATGGGAAAGG - Intergenic
1188156620 X:26749169-26749191 TAGGAGAAGCAAGTAGGGGTGGG - Intergenic
1188442523 X:30227242-30227264 TACCAGAGGCAGGGTGGGGAGGG - Intergenic
1188522488 X:31054278-31054300 CAGAAGAAACAGGATGGGGTAGG + Intergenic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189208565 X:39263356-39263378 TGCGAGAAGCAGGATAGAGAAGG + Intergenic
1189477275 X:41365741-41365763 TAGGAGAAGCAGGCATCGGAGGG - Intergenic
1189753071 X:44242747-44242769 GAGGAGATGGTGGATGGGGAAGG - Intronic
1189814857 X:44814330-44814352 TAGGATAAGCAGGCTGGGTGCGG - Intergenic
1190053499 X:47169288-47169310 TGGAGGAAGAAGGATGGGGAGGG - Intronic
1190469505 X:50764218-50764240 CAGGAGCTGGAGGATGGGGATGG + Intronic
1191225706 X:58040662-58040684 GAGGCCATGCAGGATGGGGAAGG - Intergenic
1192195975 X:69028480-69028502 TAGGGCAAGAAGGATGGGAAAGG - Intergenic
1192594622 X:72393671-72393693 TGGGAAAAGGAGGATGGGGAGGG + Intronic
1193415407 X:81216569-81216591 TAGGGTAGGGAGGATGGGGATGG - Intronic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198383383 X:136105083-136105105 AAGGAAAAGGAGGAAGGGGAGGG + Intergenic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199023049 X:142904739-142904761 TAGGGGTAGGAGGCTGGGGATGG + Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199715748 X:150506330-150506352 GAGGAGGAGGAGGAAGGGGAGGG - Intronic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1199792948 X:151171931-151171953 TGGGAGGAGCAGGAGGGGCAGGG + Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1201342242 Y:12947182-12947204 TAGGAGAACCAGGATGGGCATGG - Intergenic