ID: 1160611965

View in Genome Browser
Species Human (GRCh38)
Location 18:80095867-80095889
Sequence GTGAATATACAAATGAACAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 3, 2: 29, 3: 107, 4: 593}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160611965 Original CRISPR GTGAATATACAAATGAACAA TGG Exonic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
900901006 1:5515818-5515840 GTGAAGACACAAAGGAACAGAGG - Intergenic
901587540 1:10310496-10310518 GACAATATGGAAATGAACAAGGG + Intronic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903065603 1:20697617-20697639 GTAAATAAATAAATGAATAAAGG + Intronic
904204483 1:28844589-28844611 GTTAATTAAAAAATGAACAAGGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904990276 1:34586988-34587010 GGGAATATACTAATGAGCAAAGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
906367629 1:45223753-45223775 GTAGATAAACAAGTGAACAAAGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906934900 1:50205822-50205844 TTTTATTTACAAATGAACAAAGG - Intergenic
907114002 1:51952669-51952691 ATGAATAAAGGAATGAACAAAGG + Intronic
907841407 1:58161160-58161182 GTTATTAAATAAATGAACAAAGG - Intronic
908374831 1:63524685-63524707 GTGGATATAGTACTGAACAATGG - Intronic
908554379 1:65242934-65242956 GAGAATATACAAAACAACATTGG - Intergenic
908718500 1:67097060-67097082 GTCAATAAACAAGTAAACAAGGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909640725 1:77869035-77869057 GTAGATAAACAAGTGAACAAAGG + Intronic
909837732 1:80277663-80277685 GTGAAAAGACAATAGAACAAGGG + Intergenic
910118561 1:83759529-83759551 GTAAATACAAAAATGAAAAAAGG - Intergenic
910195778 1:84638274-84638296 GTGAATATCCAAATTACCGATGG + Intergenic
910196584 1:84647529-84647551 GAGAATGTACAAATCAAAAATGG - Exonic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910403143 1:86856840-86856862 GAGAATATTAAAATGAACATTGG + Intergenic
910850632 1:91646761-91646783 GTCAATAAAAAAATGAGCAAAGG - Intergenic
911153903 1:94621133-94621155 TTAAATATATAAATGAATAAAGG - Intergenic
911466694 1:98263572-98263594 GTGAATGGAGAAATGAAGAAAGG + Intergenic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912371349 1:109176698-109176720 GCAGATAAACAAATGAACAAAGG + Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913503512 1:119494286-119494308 GAGAATATACAAATAAACGGTGG + Intergenic
913623320 1:120633603-120633625 GTGGATTAACAAATGAATAAGGG + Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915502533 1:156328758-156328780 GCAGATAAACAAATGAACAAAGG - Intronic
916495115 1:165339717-165339739 GGAAATGTACAAAAGAACAAAGG + Intronic
916601736 1:166299709-166299731 ATGAATATTCAAAGGAATAAGGG + Intergenic
917008536 1:170444449-170444471 GTAAAGAGACAAATAAACAATGG + Intergenic
917206165 1:172572601-172572623 GCAGATAAACAAATGAACAAAGG - Intronic
917340129 1:173967365-173967387 GTGAATAACCAAATAAGCAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
920164464 1:204025954-204025976 GTGAATACAAAAGTGAACAAGGG + Intergenic
920612569 1:207455683-207455705 GTGAATATACATTTGTTCAAAGG - Intronic
921497280 1:215857189-215857211 GTAAATAAACAAATTAAAAAGGG + Intronic
921596355 1:217057333-217057355 GTTCACATAAAAATGAACAATGG + Intronic
921692583 1:218166634-218166656 GTGATTATGAAAATAAACAAGGG + Intergenic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
921826272 1:219675242-219675264 GTAAATGAGCAAATGAACAAAGG + Intergenic
921928251 1:220731439-220731461 GTGAATATACTACAAAACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922742279 1:228020705-228020727 ATGAATAAAGAAGTGAACAAGGG + Intronic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924495034 1:244579664-244579686 AAAAATATACAAATGACCAATGG + Intronic
924688559 1:246322571-246322593 GGGGATATACAGATGAACACAGG - Intronic
1063033525 10:2261079-2261101 TTGAATATATAAACAAACAATGG - Intergenic
1063517167 10:6708085-6708107 GTGATTATATCATTGAACAATGG + Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1063942730 10:11147166-11147188 GTGACTATAGGAATGAAAAAGGG + Intronic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1064964007 10:20997204-20997226 GTAAATGTTTAAATGAACAAAGG - Intronic
1065364190 10:24918808-24918830 ATCATTTTACAAATGAACAAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1067250795 10:44585264-44585286 GTTAATTTACTATTGAACAAAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069234747 10:66056815-66056837 TTAAATGTATAAATGAACAATGG + Intronic
1070255852 10:74812771-74812793 GCGAATAAACATATGAAAAATGG - Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071182537 10:83003631-83003653 GTGAATAAATAAGTGAATAAAGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071421918 10:85509034-85509056 GTGAATAGACAAATGAGCATGGG + Intergenic
1073648059 10:105327331-105327353 GTGAATTAACAAATGCAAAAAGG - Intergenic
1073848255 10:107584468-107584490 GTTAATATTCAAATGATCTAAGG + Intergenic
1074261599 10:111859241-111859263 GGGAATTTACAAATAAGCAAGGG - Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076465702 10:130680220-130680242 GTGAAGATAGAAATGTACTACGG + Intergenic
1076945675 10:133648024-133648046 TTTACTATAAAAATGAACAAAGG + Intergenic
1077127332 11:946906-946928 GTGAAGAAATAAAAGAACAACGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077767329 11:5173842-5173864 GAAGATATACAAATGAACATTGG + Intronic
1077949920 11:6945274-6945296 GTGAAAATACAAGTGAGAAAAGG - Intronic
1078177302 11:8979425-8979447 GTAGATAAACAAGTGAACAAAGG - Intergenic
1078318106 11:10308312-10308334 GTGAAGAAAAAAATGAAAAAAGG - Intronic
1078616819 11:12873474-12873496 GTATATTTAAAAATGAACAATGG + Intronic
1079032105 11:16993547-16993569 GTGAGTATAGAAATGAGCCAGGG + Intronic
1079291295 11:19190417-19190439 TTCAATATACAAATGATCAGTGG - Intronic
1079766768 11:24403906-24403928 GTTAACAGACAAATGAATAAAGG + Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081234672 11:40633118-40633140 GTGGATAGACAAATGAATACTGG + Intronic
1081538299 11:44011581-44011603 GTGAATGAATAAATGAATAAAGG + Intergenic
1082082537 11:48023358-48023380 GTGATCATACAAATGAATGAAGG - Intronic
1082628310 11:55511163-55511185 GGGAAGGAACAAATGAACAAAGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086971137 11:93082351-93082373 GAGAATATAGCCATGAACAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088093547 11:106072989-106073011 GTGGAAATAAAAATGAACAATGG + Intronic
1089080034 11:115767919-115767941 GAGAATATCCAAAAGTACAATGG - Intergenic
1089246686 11:117126259-117126281 GTGTATATCCAAAAGAGCAAGGG + Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090544140 11:127744190-127744212 GTGAATGAATAAATGAACTATGG - Intergenic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1093118568 12:15240925-15240947 GTGAATATATAAATGAATTAAGG - Intronic
1093444174 12:19235735-19235757 GTGAATAGGCATATGAAGAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096856318 12:54486754-54486776 GTGAATATACTCATGAATTAAGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1100704394 12:97184535-97184557 AGAAATTTACAAATGAACAAAGG - Intergenic
1100755013 12:97741654-97741676 TTAAATATATAAATTAACAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104861332 12:131925828-131925850 GCGGATAAACAAGTGAACAAAGG + Intergenic
1105680473 13:22722018-22722040 GGAAATGAACAAATGAACAATGG - Intergenic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106928482 13:34637769-34637791 GGGAATATATAAATGTGCAACGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107143462 13:37030983-37031005 GTGAATATAAAAAACAACAGAGG + Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107678868 13:42826746-42826768 TTGAATATAGAAATTAACATGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108468116 13:50739409-50739431 GTGAATCCATGAATGAACAAAGG + Intronic
1108869794 13:54969783-54969805 GTGAATAGATAAATAAACTATGG + Intergenic
1109574360 13:64233479-64233501 GAAAATTTACAAATGACCAACGG - Intergenic
1109636340 13:65122796-65122818 GTGAAAATACAACTGCAGAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110164036 13:72415958-72415980 GTGGATAAACAAATGATTAAAGG - Intergenic
1110634544 13:77751549-77751571 GAGAAGGAACAAATGAACAAGGG - Intronic
1111167409 13:84478121-84478143 AAGACTATACAAATGACCAAAGG + Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111473236 13:88713619-88713641 GTAGATATACTAAAGAACAAAGG + Intergenic
1111868294 13:93797528-93797550 ATGAATATATGAATGAGCAAGGG + Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112762630 13:102708499-102708521 ATGAATGTACGAATGAACACTGG + Intergenic
1113003204 13:105667744-105667766 GTGAATGAACAAATAAACCATGG + Intergenic
1113168834 13:107474820-107474842 GTGAGTATACAAAAGAACCCAGG - Intronic
1113478805 13:110605751-110605773 GCCAATAAACAAGTGAACAAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114375961 14:22147388-22147410 GTGAATTTAAAAATGTAAAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114943452 14:27647364-27647386 GTCAATCTAAAAATGAACATAGG + Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117864718 14:60134850-60134872 GTGAATATTCACATGATGAATGG - Exonic
1117883240 14:60332125-60332147 GTCAATTTACAAATGAGAAACGG - Intergenic
1119254085 14:73183390-73183412 GTAGATAAACAAGTGAACAAAGG + Intronic
1119451603 14:74716636-74716658 GGGGATATACAAATACACAAGGG - Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119816891 14:77577556-77577578 GTGAATATACACATGAGAAGGGG + Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120301846 14:82717470-82717492 GTGAATAAACAAATCTTCAAAGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120563145 14:86021289-86021311 GTGAATATCCTAATGAGAAAAGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1122946864 14:105015358-105015380 GGGAATATACCAACAAACAATGG + Intronic
1123693197 15:22856720-22856742 GTTAATAAACAAATGAAAATGGG + Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125991198 15:44110005-44110027 GTGAATAAATAAATAAACCATGG - Intronic
1126944412 15:53803062-53803084 GGGAATATACAGATAAGCAAGGG + Intergenic
1127204532 15:56700211-56700233 GTGCATATACATATAAACTATGG + Intronic
1127215491 15:56819277-56819299 GTGAAAGTACAAATGAATTAGGG - Intronic
1127407258 15:58663622-58663644 TTGAATCTACAAATCAATAAAGG + Intronic
1128209227 15:65882168-65882190 GTGAATATAGAAAGGAAAAGTGG - Intronic
1130199240 15:81809864-81809886 ATAAAAATAGAAATGAACAAGGG - Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130635768 15:85618468-85618490 GTGAAGAAACAAAAGAAAAAGGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131912284 15:97221090-97221112 GTGAATGAAGAAATGAACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134356188 16:13484318-13484340 GTGAAGTTACAATTGTACAAGGG - Intergenic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135896708 16:26412114-26412136 GGGAATTTACAGATCAACAAAGG + Intergenic
1136123780 16:28161062-28161084 ATGCAACTACAAATGAACAAAGG + Intronic
1136918814 16:34245198-34245220 GTAGATAAACAAGTGAACAAAGG + Intergenic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137507746 16:49069221-49069243 GTGAATAGAGATATAAACAAAGG - Intergenic
1137516777 16:49151744-49151766 ATGAAATTACAAATGAAAAAAGG + Intergenic
1137914900 16:52419307-52419329 GAGAATATCCAAAGGAAGAAGGG - Intergenic
1139184019 16:64782566-64782588 GTGAATAGATAAATAAACCATGG - Intergenic
1139726039 16:68899338-68899360 GTGAATATAGAAATCAGTAAGGG - Intronic
1139831707 16:69804029-69804051 TTCAATATAAAAATGAGCAAAGG - Intronic
1139833361 16:69818813-69818835 GTAAATTAACAAATGAACACAGG - Intronic
1139843560 16:69902322-69902344 GTTCATATACAACTGAACCAAGG + Intronic
1140128448 16:72137047-72137069 GTGAATATACTAAAAACCAATGG + Intronic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1140876794 16:79160154-79160176 GAGAACATCCAAATGAACACTGG + Intronic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141272612 16:82554943-82554965 GTGAATAAACAAAACAATAATGG + Intergenic
1142332525 16:89463572-89463594 GCAAATAAACAAGTGAACAAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1143993586 17:10987944-10987966 GTGCTTGTACAAATGAACACTGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1145937127 17:28720934-28720956 GTGAATTTCCAAATTACCAATGG - Intronic
1146187647 17:30735820-30735842 GCGGATAAACAAGTGAACAAAGG + Intergenic
1146250757 17:31341723-31341745 GTGTATATATATATGAACATGGG + Intronic
1146670430 17:34733738-34733760 TTGAAAGAACAAATGAACAAAGG - Intergenic
1148378518 17:47173529-47173551 TTGATTATACCAATAAACAATGG + Intronic
1148636193 17:49150824-49150846 GCGGATAAACAAGTGAACAAAGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149125854 17:53231478-53231500 GTCAAGTTACAAAGGAACAAAGG + Intergenic
1150577118 17:66440342-66440364 GAGAAGAAACAAATGAACATTGG - Intronic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1153116807 18:1667555-1667577 GTAACAAAACAAATGAACAAGGG - Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155621106 18:27781199-27781221 GTGAGTATACAAGTGTACAGAGG + Intergenic
1155934058 18:31736953-31736975 GGGAGTATACTAATGACCAAAGG + Intergenic
1156068006 18:33168520-33168542 TTGTATAAACAAATTAACAAAGG - Intronic
1156975594 18:43218385-43218407 ATCAATATACATGTGAACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158091617 18:53721261-53721283 GGGAATATACAAAGGCACAGTGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158820650 18:61154802-61154824 GAGAACACACAAGTGAACAAGGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159123975 18:64201628-64201650 GTGAATTAAAAAGTGAACAATGG + Intergenic
1159346854 18:67216784-67216806 GGGAATTTACAAACTAACAAAGG - Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160394333 18:78560405-78560427 AGGAATACACCAATGAACAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1164016333 19:21258984-21259006 GCGGATAAACACATGAACAAAGG + Intronic
1164192997 19:22928488-22928510 GTAGATAAACAAGTGAACAAAGG - Intergenic
1164214863 19:23135126-23135148 GTAGATAAACAAGTGAACAAAGG - Intronic
1164626667 19:29733583-29733605 GAAAATATACAAATGACCACAGG - Intergenic
1164957235 19:32397081-32397103 GTTAATATAAAGTTGAACAAAGG + Intergenic
1165544652 19:36524608-36524630 GTAGATAAACAAGTGAACAAAGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167980083 19:53268279-53268301 GTCAATATCCAAATAAATAAAGG + Intergenic
1168561021 19:57383383-57383405 TTGACTATAGAAATCAACAATGG - Intronic
924979876 2:209904-209926 GGGAATACAGAAGTGAACAAAGG - Intergenic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
926221127 2:10936162-10936184 GTGAATGCACAAAGAAACAAGGG + Intergenic
926805138 2:16702069-16702091 GTGCATTTAAAAATGCACAATGG + Intergenic
927061347 2:19425234-19425256 ATGAAAAGAGAAATGAACAAAGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928002756 2:27539201-27539223 GTAGATAAACAAGTGAACAAAGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930008684 2:46917445-46917467 TTGAATGAATAAATGAACAAAGG - Intronic
930482798 2:51970512-51970534 GTGAATAGACAAATACATAATGG + Intergenic
930626459 2:53703767-53703789 GAAAATATACAAATGAGAAAAGG + Intronic
931796997 2:65720935-65720957 GGGAACATATAAATGAAGAAAGG - Intergenic
931995314 2:67834051-67834073 ATGAATCTACAAATGACCTAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
934140928 2:89046548-89046570 GGGAATATGCAAATGAGCAGAGG + Intergenic
934228304 2:90153994-90154016 GGGAATATGCAAATGAGCAGAGG - Intergenic
934228897 2:90159757-90159779 GGGAATATGCAAATGAGCAGAGG - Intergenic
934631309 2:95926674-95926696 TTGAATATACAACTGAACTCAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935258805 2:101336757-101336779 GTGAATTTTAAAATGTACAAGGG - Intergenic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937380670 2:121373826-121373848 GTGTTTATGCAAATGAACAGAGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938088531 2:128417669-128417691 GTAGATAAACAAGTGAACAAAGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938450623 2:131415870-131415892 GTGAAAACACATATGATCAAGGG + Intergenic
938823787 2:134984422-134984444 GATAATATACAAACCAACAATGG + Intronic
938865214 2:135411726-135411748 GTACACATAAAAATGAACAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939785818 2:146510755-146510777 GTGAATATGCAATTTAATAAGGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943875537 2:193062474-193062496 GAGCATATTCAAATGAATAATGG + Intergenic
943926436 2:193788505-193788527 GTGAATCAACAAATAAACAGTGG + Intergenic
944199242 2:197087980-197088002 GGTAATATACAAATGACAAATGG + Intronic
944266839 2:197736737-197736759 TTGAATTTACAAATCAAAAAAGG - Intronic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
945215910 2:207433894-207433916 GTGAAGATGGAAAGGAACAAGGG - Intergenic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945558908 2:211313910-211313932 GTGAATAGCCATGTGAACAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945884245 2:215358091-215358113 GTGAATAAAGAAATGATCAGGGG - Intergenic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
947869893 2:233428994-233429016 GTTAAGATACAAGTGACCAATGG - Intronic
947953512 2:234168311-234168333 GCAAATAAACACATGAACAAAGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169570022 20:6896222-6896244 GGGAGTATTCAAATGAAGAAGGG + Intergenic
1170205720 20:13795975-13795997 GTGAATACAAAAATGAATTAGGG + Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1171983017 20:31640238-31640260 GTGAATAAAGAAACGAACAAAGG - Intronic
1172601390 20:36186011-36186033 GTGCATATACAGGTGAAAAATGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174279593 20:49429484-49429506 GGGAACATACAAATGAGGAAGGG + Intronic
1175449661 20:59052449-59052471 GTGAATAGACAAGTCAGCAAAGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175638015 20:60601763-60601785 GAGAATATACAAGTGGACTACGG - Intergenic
1175645680 20:60669165-60669187 GTGAATGAATAAATGAGCAAGGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177593075 21:23198515-23198537 TTGAATAAATAAATGAACATTGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180942504 22:19668554-19668576 GTGAATGCACATATGAGCAAGGG - Intergenic
1181186409 22:21109086-21109108 GTGAATAAATAAATAAACCATGG + Intergenic
1181289412 22:21779582-21779604 GTGTATAAATAAATGAGCAAAGG - Intronic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
949983007 3:9514878-9514900 GTGAATGTATAAATAAACTATGG - Intronic
950580331 3:13857887-13857909 GTGATGATAAAAATTAACAATGG + Intronic
950753734 3:15154652-15154674 ACAAAAATACAAATGAACAAGGG + Intergenic
951046006 3:18039174-18039196 GTAAATACATAAATCAACAAAGG - Intronic
951112255 3:18818340-18818362 GTTACTAAACAAATAAACAAAGG - Intergenic
951589631 3:24249413-24249435 GTGAAAATACTAGAGAACAAGGG - Intronic
951677418 3:25257930-25257952 GTGGAAATACAAATGATGAAGGG - Intronic
951787916 3:26443287-26443309 GTAAATACACAAATGAGAAAAGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953373594 3:42410120-42410142 GTGAACAGATAAATGAGCAATGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956980632 3:74633307-74633329 GTGAGTATAGAAATGAAAACAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957380492 3:79421964-79421986 GTGGATATAAAAATGTACAGTGG - Intronic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
958047293 3:88301696-88301718 GTGAATAAATAAATGAATCAAGG - Intergenic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960022663 3:112972790-112972812 GTAAATTCACAAAGGAACAAGGG - Intronic
960132753 3:114074702-114074724 GAAAATACACAAATCAACAATGG - Intronic
960256944 3:115520723-115520745 GGCCATATACAAATAAACAATGG + Intergenic
960323573 3:116267213-116267235 GAGGAAATAAAAATGAACAATGG + Intronic
960550323 3:118969226-118969248 GTGACTATAAAAATAAAGAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960678398 3:120220937-120220959 GCCAATAAACAAATGAAAAAGGG - Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962418539 3:135206231-135206253 GTGAATGGACAAATAAACCATGG - Intronic
962440689 3:135413052-135413074 GCAACTATAGAAATGAACAAAGG + Intergenic
962688945 3:137873424-137873446 GCAGATAAACAAATGAACAAAGG - Intergenic
963287819 3:143453170-143453192 TTGAATACACAAATTAACATAGG + Intronic
963812473 3:149792202-149792224 GTGCATTTAAAAATGTACAAAGG - Intronic
964154407 3:153566700-153566722 GTGAAAATACAAAACAACAAAGG - Intergenic
964188839 3:153979299-153979321 GTTAAGAAACAAATGAAAAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965831995 3:172801792-172801814 GTCAAAATACAAAGAAACAAGGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967011026 3:185434248-185434270 GCTAATAGATAAATGAACAAAGG + Intronic
967139022 3:186537762-186537784 GTGAACATACAAGTGAACCTGGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967831303 3:193922341-193922363 GTAAATAGACAAATAAAAAAGGG - Intergenic
968184091 3:196619706-196619728 GCAAATAAACAAGTGAACAAAGG + Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969962893 4:10963770-10963792 GTGTATACACAAGTGAACACAGG + Intergenic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970258817 4:14201136-14201158 GAGAATAGAAAAATGACCAATGG - Intergenic
970615189 4:17762197-17762219 GTAAATGAACAAATTAACAAAGG + Intronic
970632760 4:17969712-17969734 CTGAGTTTACGAATGAACAAAGG - Intronic
970759304 4:19465057-19465079 GAGAACATACCCATGAACAATGG + Intergenic
970808044 4:20059084-20059106 GTGAGTATATAAATACACAATGG - Intergenic
970982405 4:22115416-22115438 GTGATTCTAAAAATAAACAAAGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971925158 4:32999351-32999373 GTGAGTATAAAAATGAAAAAAGG - Intergenic
972145296 4:36017177-36017199 GTCAAGATAAAAATGAAAAATGG + Intronic
973160796 4:47013659-47013681 GTCAATAAAAGAATGAACAATGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974179818 4:58370272-58370294 GTGTATAAACATTTGAACAATGG + Intergenic
974995243 4:69147981-69148003 GTGAATAAACATATCAACTAAGG - Intronic
975044880 4:69790072-69790094 GTGAATATAAAAATAAAAAAAGG - Intergenic
975213322 4:71726171-71726193 AGGAATTTACAAATAAACAAGGG - Intergenic
975616209 4:76250321-76250343 GTGAACAAACATATGAAAAAAGG - Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
976994006 4:91406898-91406920 GAGAATATTCAAATAAACAAAGG - Intronic
977231855 4:94460986-94461008 GTGAATACACAGTTGAACAGTGG + Intronic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
977469245 4:97421340-97421362 GTGAATATTGAAAAGAACCATGG - Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978024948 4:103861902-103861924 GTGATTATAAAAATGATCTAAGG + Intergenic
978175127 4:105720944-105720966 GTAAAAATACAAAGGAACGAAGG - Intronic
978180556 4:105789903-105789925 GAGAAAATTCAAAAGAACAATGG - Intronic
978409374 4:108410471-108410493 GTAGATAAACAAGTGAACAAAGG - Intergenic
979264088 4:118681694-118681716 GTGGTTATAGAAATGAAGAATGG + Intergenic
979546037 4:121941067-121941089 GGGAATAAGAAAATGAACAATGG + Intronic
980406627 4:132361304-132361326 GTAAATATACACATAAACATAGG + Intergenic
980684524 4:136209337-136209359 TTGAATAAACTAATGAATAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982040595 4:151391694-151391716 GTAGATAAACAAGTGAACAAAGG - Intergenic
982198852 4:152940066-152940088 GAGAATACACAAAAGAACGATGG - Intronic
982852072 4:160331250-160331272 GTGAATATATAAACAAACTATGG + Intergenic
983275533 4:165612855-165612877 GTGAATATATATTTTAACAAAGG + Intergenic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984357959 4:178689554-178689576 GTGAATATAGAAATACAAAAAGG + Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
986058238 5:4161135-4161157 GACAATATACAAACAAACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987003372 5:13684219-13684241 GTGAAGAAATAAATGAAGAAAGG + Intergenic
987497563 5:18667851-18667873 TTGAATATCCAAGTGAAGAAAGG + Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
987768023 5:22261071-22261093 GTGTATATACACATAATCAAGGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989238836 5:39180314-39180336 GTGAAAATGGAAAAGAACAAAGG - Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
989698660 5:44235718-44235740 GAGGATATAAAAATGAAAAAGGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
990603984 5:57388993-57389015 GTGAATATATAAATAAACCGTGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991290021 5:65024560-65024582 GTGAATAGACTAATTAAGAATGG + Intergenic
991443870 5:66679554-66679576 GAGAGTATACAAATGAAGAAGGG - Intronic
991614495 5:68482010-68482032 GAGACTGTGCAAATGAACAATGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993105086 5:83591431-83591453 ATGAAAAAATAAATGAACAAAGG - Intergenic
993135989 5:83965152-83965174 GAGAAAATATAAATGATCAATGG - Intronic
993418793 5:87673556-87673578 GTGAAAATAAATATGAAAAAGGG - Intergenic
993446681 5:88021109-88021131 GTGTATATATACATAAACAATGG + Intergenic
994319386 5:98374502-98374524 GGGGATTTACAAATGAACAAAGG - Intergenic
995829666 5:116341319-116341341 GTGTCAATAAAAATGAACAAAGG + Intronic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996117466 5:119634139-119634161 ATGCAGGTACAAATGAACAAAGG + Exonic
996245016 5:121252161-121252183 GTAAGAATACAAAAGAACAAAGG + Intergenic
996376193 5:122810303-122810325 GTAGATAAACAAGTGAACAAAGG - Intronic
996402174 5:123074511-123074533 GTGAATGAATGAATGAACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996883518 5:128328019-128328041 ATGAAAATATAAATGAAGAAAGG - Intronic
997306365 5:132839847-132839869 GTGAAAATAAACAAGAACAAAGG - Intergenic
997397002 5:133569485-133569507 GTCAATAAACAAATGAGTAAAGG - Intronic
997869481 5:137494808-137494830 ATGAAGGTACAAATGAACAGAGG + Intronic
998032704 5:138885300-138885322 GGAGAGATACAAATGAACAAAGG - Intronic
998429235 5:142056351-142056373 GTGAATATACTAAAAAACAGTGG + Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
999041782 5:148421735-148421757 GTGAAGATACAAATGATTCATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
999663526 5:153890111-153890133 GTGAATAACCAAATGAATGAAGG - Intergenic
999861283 5:155649353-155649375 GAGAATAAATAAATGAACAACGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000735793 5:164898684-164898706 GGAAATATACAAATAAGCAAGGG - Intergenic
1001998943 5:176185271-176185293 GAGAATGTTCAAATGAACACAGG + Intergenic
1002410026 5:179066912-179066934 GTGAATATCCAAAGTAATAATGG - Intronic
1002585797 5:180246614-180246636 GTTAAAACACAAATGAAAAAGGG + Intronic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004011159 6:11689058-11689080 GTGAATATACAAAGTAGCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008184205 6:48370757-48370779 GCAGATAAACAAATGAACAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009837677 6:69025265-69025287 GTGAATATAAGAAAGAACATAGG - Intronic
1009964180 6:70561000-70561022 GTGAAAATAAAAATGCACTAAGG + Exonic
1009971925 6:70633940-70633962 GTAAAAATAGAAATAAACAAAGG + Intergenic
1011126504 6:84013446-84013468 GTGGCTCTCCAAATGAACAAAGG - Intergenic
1011367203 6:86596015-86596037 GTGAAAATACATATTAAAAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012742460 6:103035743-103035765 GTATATATACAAATGACCAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013638160 6:112048257-112048279 GCAGATAAACAAATGAACAAAGG - Intergenic
1013734382 6:113208384-113208406 GTGCATATAAAACTGAGCAATGG - Intergenic
1013752781 6:113426354-113426376 GTAAAAATACAAATGACCATAGG - Intergenic
1013815922 6:114097305-114097327 GTGGATATACTTATGAAAAAAGG + Intronic
1013946994 6:115733313-115733335 GTGATTATACAAATTACCTAGGG + Intergenic
1013982994 6:116155892-116155914 GTGTTTATACAAAAAAACAATGG + Intronic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1014488553 6:122033001-122033023 GTGAAAATAAATAGGAACAAAGG - Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014649933 6:124023513-124023535 GTTGACATAAAAATGAACAAAGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015643402 6:135363141-135363163 GTAGATAAACAAGTGAACAAAGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016185979 6:141197710-141197732 GTGAAGATAGACATGAACACAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016620191 6:146100149-146100171 GTGAAAATCCAAATTACCAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017558572 6:155601857-155601879 GTGAATGAATAAATTAACAAAGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018132574 6:160746891-160746913 GGAAATATACAAATAAAAAATGG - Intronic
1018311112 6:162509916-162509938 GTTAATATACAAAAGAAAATAGG + Intronic
1020356090 7:7277401-7277423 GTGTATATACAAGTCAACACTGG + Intergenic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021118386 7:16769743-16769765 GTGTAAATACAAAATAACAATGG - Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021418515 7:20418090-20418112 GTGAGTATGCACATGAAGAAAGG + Intergenic
1021598112 7:22338531-22338553 GAGAATACACAAATGACTAAAGG - Intronic
1021880231 7:25088190-25088212 GTGACTATACAGATGATGAAAGG - Intergenic
1022060728 7:26791705-26791727 GGGACAATACAAATGAAGAAAGG + Intronic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023896446 7:44437380-44437402 GAGAATTTACAAAGAAACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024400346 7:48917544-48917566 ATTTATATATAAATGAACAAAGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026080239 7:67211666-67211688 GGGAATTTACAGATGAGCAAGGG - Intronic
1026696849 7:72602337-72602359 GGGAATTTACAGATGAGCAAGGG + Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027331552 7:77100878-77100900 TTGAAGATTCAAAGGAACAAAGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028671371 7:93404038-93404060 GTTAATATACAAATGATGTAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029784219 7:102770462-102770484 TTGAAGATTCAAAGGAACAAAGG - Intronic
1029876104 7:103753673-103753695 TTGAAAATACAAATTAATAATGG + Intronic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1031045652 7:116884643-116884665 GTGAACAGACAAATAAACCATGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031241383 7:119246347-119246369 TTGACAATACAAATGAACATAGG - Intergenic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1031751626 7:125581991-125582013 GTCATTATTTAAATGAACAAGGG + Intergenic
1031794543 7:126155538-126155560 GTGAATATACAAATGAGTTAAGG + Intergenic
1032575790 7:133052843-133052865 ACGAATATACAAATGAGCTATGG - Intronic
1032667629 7:134052545-134052567 GATAATATATACATGAACAATGG + Intronic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1033272468 7:139944957-139944979 GTGAATAAACTAAGGAGCAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035449137 7:158964110-158964132 GTAAATAAACTAATGAACAGAGG + Intergenic
1036089461 8:5649612-5649634 GTAGATATAAAAATGAATAAAGG + Intergenic
1036374023 8:8184705-8184727 GTGTAAGTACAAATGAAAAATGG - Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037086969 8:14864264-14864286 TTGTTTATACAAATGAACACAGG - Intronic
1037607423 8:20449423-20449445 GTGAATGTAGGAATGAACGAAGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040777240 8:51060256-51060278 GTGGATAAACAAATGTACACAGG - Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041308032 8:56484014-56484036 GTAAATGCACAAATGATCAATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041947057 8:63457278-63457300 ATGAAAATATAAATGTACAAAGG - Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044141847 8:88665057-88665079 GTACATATATAAATGCACAATGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045107752 8:98909396-98909418 GTGAATATACTAAAAAACATTGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1045880083 8:107028557-107028579 GAGAATATGAAAATGACCAAGGG + Intergenic
1046636995 8:116680728-116680750 GTAGATAAACAAGTGAACAAAGG - Intronic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047658182 8:127001990-127002012 GTCAATATAAAAAGGTACAAAGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1048196728 8:132337561-132337583 ATGAATATATGAATGAAGAAGGG + Intronic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1048301924 8:133257922-133257944 GTGAGGATACAAAGGAACAGTGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1050392812 9:5164462-5164484 GTTAATACAAAAATGTACAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050571778 9:6948577-6948599 GTAGATAAACAAGTGAACAAAGG + Intronic
1050653253 9:7795936-7795958 GTGAATGTACATGTGAACATTGG - Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051192846 9:14533517-14533539 GTGAATATAAAAATACCCAAAGG - Intergenic
1051649748 9:19310151-19310173 GATAATATACAAATTAAAAAAGG - Intronic
1051753289 9:20367094-20367116 GAGAATTTACAAAAAAACAATGG - Intronic
1052162359 9:25280498-25280520 GTGAATGTACAAATAAATCATGG + Intergenic
1052629677 9:31021147-31021169 GTAAAAAAAAAAATGAACAAGGG + Intergenic
1053271549 9:36753001-36753023 GTGAATAGATAAATAAACCATGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1055214879 9:73847169-73847191 GTGAATGAATAAATAAACAAAGG - Intergenic
1055425251 9:76188683-76188705 GAGAATAAACAAAAGAACTAGGG - Intronic
1055673493 9:78631303-78631325 GAGAATAGAAAAAAGAACAAGGG + Intergenic
1055723085 9:79197463-79197485 GTGAATATACCAAATAACCATGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG + Intronic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058397134 9:104567419-104567441 GTGAATAAACAAGTAAAGAATGG + Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059722668 9:116976484-116976506 GTGAATATTCTAGAGAACAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060265020 9:122106988-122107010 GTAAAAATAAAAATAAACAAAGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186331886 X:8543142-8543164 ATGAATAAATAAGTGAACAAAGG + Intronic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188218859 X:27514730-27514752 GTGGCAACACAAATGAACAATGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188593968 X:31874050-31874072 GTAAATCAACATATGAACAATGG + Intronic
1188707208 X:33349532-33349554 GAGAATATATAAATGAATTATGG - Intergenic
1189079608 X:37957163-37957185 GCGAATATACAAATATATAAAGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1190281051 X:48930380-48930402 GGGAATTTGCAGATGAACAAGGG + Intronic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1191046340 X:56141811-56141833 GTGATGATACAAATGACCAAAGG + Intergenic
1191068793 X:56379568-56379590 GTAGATAAACAAGTGAACAAAGG + Intergenic
1191586441 X:62832345-62832367 GAAGATATACAAATGACCAATGG + Intergenic
1192187688 X:68963218-68963240 GTGAATAAATAAATAAACAGTGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194171601 X:90591733-90591755 GTGAATATATTAAGGAATAAAGG - Intergenic
1194413425 X:93581383-93581405 GAGAATATCCACATGACCAATGG + Intergenic
1194528656 X:95014833-95014855 GAGAATATACATATGAGTAATGG - Intergenic
1194729554 X:97437937-97437959 GTAAATAGAGAAATCAACAAAGG + Intronic
1194859370 X:98978059-98978081 GTGAATAGTCAAATAAACATTGG + Intergenic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1197001542 X:121445620-121445642 GTGTATAAACAAGTGAATAATGG + Intergenic
1197014720 X:121609613-121609635 GTAAATATAAACAAGAACAAAGG + Intergenic
1197051837 X:122068508-122068530 GTGAGTTCACAAAAGAACAAAGG - Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1197539505 X:127739724-127739746 ATGAATATATAAATAAACAGTGG + Intergenic
1197573095 X:128174291-128174313 GTGAATAGATAAATAAACTATGG + Intergenic
1198263454 X:134987526-134987548 TTTAATATAGAAATGAGCAAAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198646598 X:138813878-138813900 GAGAATATATGAATGAATAAAGG + Intronic
1198649024 X:138840537-138840559 GTGGATATCTAAATGAAAAAGGG + Intronic
1199036382 X:143055505-143055527 GTGAATGAACAAATGAGCGACGG - Intergenic
1199255533 X:145714959-145714981 GTGTATATAGAAATGAATAAGGG - Intergenic
1199295619 X:146154810-146154832 GTGTATATACAAATCAAATATGG - Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1201049806 Y:9921310-9921332 TTTAATATTCAAATGAATAAAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201430728 Y:13899476-13899498 ATGAATAAATAAGTGAACAAAGG - Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic