ID: 1160613927

View in Genome Browser
Species Human (GRCh38)
Location 18:80109618-80109640
Sequence CGTGGCCGCCTCGGGAATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160613908_1160613927 24 Left 1160613908 18:80109571-80109593 CCGGTACCCAGCCCACACCCACG 0: 1
1: 0
2: 3
3: 18
4: 340
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613916_1160613927 0 Left 1160613916 18:80109595-80109617 CCGCCGCCTGCCCTCGCGCCGCC 0: 1
1: 0
2: 6
3: 88
4: 707
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613910_1160613927 17 Left 1160613910 18:80109578-80109600 CCAGCCCACACCCACGCCCGCCG 0: 1
1: 0
2: 4
3: 59
4: 547
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613905_1160613927 29 Left 1160613905 18:80109566-80109588 CCCCGCCGGTACCCAGCCCACAC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613911_1160613927 13 Left 1160613911 18:80109582-80109604 CCCACACCCACGCCCGCCGCCTG 0: 1
1: 0
2: 1
3: 15
4: 312
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613904_1160613927 30 Left 1160613904 18:80109565-80109587 CCCCCGCCGGTACCCAGCCCACA 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613913_1160613927 7 Left 1160613913 18:80109588-80109610 CCCACGCCCGCCGCCTGCCCTCG 0: 1
1: 0
2: 1
3: 36
4: 326
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613906_1160613927 28 Left 1160613906 18:80109567-80109589 CCCGCCGGTACCCAGCCCACACC 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613914_1160613927 6 Left 1160613914 18:80109589-80109611 CCACGCCCGCCGCCTGCCCTCGC 0: 1
1: 0
2: 7
3: 93
4: 851
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613912_1160613927 12 Left 1160613912 18:80109583-80109605 CCACACCCACGCCCGCCGCCTGC 0: 1
1: 0
2: 4
3: 64
4: 678
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613907_1160613927 27 Left 1160613907 18:80109568-80109590 CCGCCGGTACCCAGCCCACACCC 0: 1
1: 0
2: 0
3: 23
4: 323
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613920_1160613927 -10 Left 1160613920 18:80109605-80109627 CCCTCGCGCCGCCCGTGGCCGCC 0: 1
1: 0
2: 5
3: 50
4: 288
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613909_1160613927 18 Left 1160613909 18:80109577-80109599 CCCAGCCCACACCCACGCCCGCC 0: 1
1: 1
2: 6
3: 63
4: 698
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613915_1160613927 1 Left 1160613915 18:80109594-80109616 CCCGCCGCCTGCCCTCGCGCCGC 0: 1
1: 1
2: 6
3: 57
4: 592
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613919_1160613927 -6 Left 1160613919 18:80109601-80109623 CCTGCCCTCGCGCCGCCCGTGGC 0: 1
1: 0
2: 3
3: 21
4: 278
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1160613917_1160613927 -3 Left 1160613917 18:80109598-80109620 CCGCCTGCCCTCGCGCCGCCCGT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160613927 Original CRISPR CGTGGCCGCCTCGGGAATCC CGG Intronic
900690656 1:3978410-3978432 CGTGGGAGCCTTGGGACTCCAGG - Intergenic
902114728 1:14112063-14112085 GGTGGCAGTCTCAGGAATCCAGG - Intergenic
902238114 1:15070596-15070618 CCTGGGCTCCTGGGGAATCCAGG + Intronic
903927347 1:26840018-26840040 CCTGGCAGCCTCAGGAAGCCGGG + Intronic
904130744 1:28273582-28273604 AGTGGCTGCCTCTGGAATGCAGG - Intronic
905317211 1:37090478-37090500 AGTGGCAGCCAAGGGAATCCAGG - Intergenic
906773738 1:48509674-48509696 AGTGGAGGCCTAGGGAATCCAGG + Intergenic
907069359 1:51519484-51519506 CGGGGCCGCCTTGGAAAACCCGG + Intergenic
909941677 1:81618103-81618125 CTTTGCAGCCTCGGGAAGCCAGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922380229 1:225015903-225015925 AGTGGCCGACTCTGGAACCCAGG - Intronic
1064384664 10:14879210-14879232 CGTGGCGGCCTCGGGCTTCGAGG + Intronic
1065761064 10:28983729-28983751 CGTGGCCCTCTTGGGAAGCCAGG + Intergenic
1073124813 10:101142480-101142502 CGTGGCACCCTCGGAAATGCAGG + Intergenic
1075334351 10:121597894-121597916 CGTGGGCGCCACGGGAGCCCGGG - Intronic
1090473567 11:127000708-127000730 CTTAGCCGCCTCGGGAAGCCGGG + Exonic
1091696945 12:2633998-2634020 TGTGGCCGCCCCGGGGAGCCGGG - Intronic
1091802215 12:3331414-3331436 GGTGGCCGCCTAGGAAAGCCTGG + Intergenic
1095099265 12:38163611-38163633 CTCGGCCGGCTCGGGGATCCCGG - Intergenic
1095982885 12:47982864-47982886 CGTGGCCTCCCCGGCACTCCTGG - Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096467611 12:51856048-51856070 AATGGCTGCCTTGGGAATCCCGG + Intergenic
1097290582 12:57911081-57911103 CGTGGCAGCCTCGAGAAGCTAGG + Intergenic
1101597257 12:106178241-106178263 CGAGGCAGCCTGGGAAATCCAGG - Intergenic
1102527112 12:113520051-113520073 CGTGCCAGCCGCGGGGATCCTGG + Intergenic
1103392537 12:120584813-120584835 CGTGCCCGCCGCCGGAATGCCGG + Intergenic
1103726795 12:123001208-123001230 CGTCCCCACCTCGGGAAGCCAGG - Intronic
1104232702 12:126900535-126900557 AGTGGCCGACTCTGGAACCCAGG - Intergenic
1104747035 12:131216994-131217016 TGTGGCTGCCTGGGGAATCCGGG - Intergenic
1104785583 12:131446191-131446213 TGTGGCTGCCTGGGGAATCCGGG + Intergenic
1112752645 13:102597486-102597508 CGCGGCTGCCTGGGGAAGCCTGG + Intronic
1117424358 14:55580046-55580068 GCTGGCCGGCTCGGGATTCCGGG - Intronic
1130230094 15:82090493-82090515 GGTGGCCGCCCCAGGAATGCAGG - Intergenic
1130411701 15:83653734-83653756 GGTGGCGGCGTCGGCAATCCCGG + Intergenic
1131070245 15:89461444-89461466 GGTGGCCGCCCCGAGCATCCAGG + Intergenic
1133693391 16:8237407-8237429 TGTGGCTGCCTCCAGAATCCAGG + Intergenic
1133802127 16:9092368-9092390 GGCGGCGGCCTCGGGGATCCCGG + Intronic
1135526131 16:23215002-23215024 CGTGGCTCCCTTGGGAATCAGGG + Intronic
1141647175 16:85373778-85373800 CTGGGCTGCCTCGGGGATCCAGG - Intergenic
1142251028 16:88992180-88992202 CGTGGCGGCCTCGTGGATTCTGG + Intergenic
1146722584 17:35133473-35133495 CGTGGCCGCGTAGGGAAGCCAGG + Exonic
1147559063 17:41497834-41497856 TGTGGCCCCATCAGGAATCCCGG - Intergenic
1152753687 17:82078140-82078162 CGTGGCAGCCCCGGGCTTCCCGG - Intergenic
1160613927 18:80109618-80109640 CGTGGCCGCCTCGGGAATCCCGG + Intronic
1160872747 19:1284575-1284597 CGTGGCCCGCTGGGGAATCGGGG + Intergenic
1161570249 19:5026633-5026655 CTTGCCAGCCTCGGGAACCCAGG - Intronic
1163875413 19:19863675-19863697 AGTGGCCGACTCTGGAACCCAGG - Intergenic
1164617192 19:29674282-29674304 CGTGGCCTTGTCGGGGATCCAGG - Exonic
1168101607 19:54144429-54144451 CCTGTCCGCCTGAGGAATCCAGG - Intronic
1168336282 19:55599408-55599430 CGGGGCCGCCCCGGGTCTCCAGG - Intronic
926488392 2:13492020-13492042 CGAGGCCCCCTGGGGAATGCAGG - Intergenic
935595171 2:104872554-104872576 CCTGGCCGCCGCGGGAACTCGGG - Intergenic
937246971 2:120499887-120499909 TGTGGCCCACTCAGGAATCCCGG + Intergenic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
947745041 2:232503107-232503129 CCTGGCCGCTGCGGGACTCCTGG + Intergenic
1173463916 20:43266221-43266243 CATGGCCACCACTGGAATCCAGG + Intergenic
1175684892 20:61021724-61021746 CGTGGCAGACCCAGGAATCCAGG + Intergenic
1175832810 20:61976418-61976440 CCTGGCCTCCTCTGGAATCGGGG - Intronic
1180300394 22:11032293-11032315 CGTGCACGCTGCGGGAATCCGGG + Intergenic
1181998369 22:26901261-26901283 GGTGGCTGCCTCTGGAATCTGGG - Intergenic
1182086414 22:27564084-27564106 CGTGGCCACCTCAGGGCTCCGGG + Intergenic
1184059627 22:42074169-42074191 CGAGGCGGCCTCGGAGATCCCGG + Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
950683758 3:14602541-14602563 CGTGGCCGCCTCGCCAAGCCAGG + Intergenic
954136664 3:48585061-48585083 CCTGGCCGCGCCGGGAATCCTGG - Exonic
954328258 3:49875390-49875412 CCTGGCCTCCTTGGGAATCAGGG + Intergenic
962704124 3:138026966-138026988 TGTGGCTGCCTCTGGAATTCTGG - Intronic
962825390 3:139096102-139096124 CCTGCCAGCCTTGGGAATCCCGG - Intronic
966517020 3:180829738-180829760 CCTGGCAGCCTCAGGAAGCCCGG - Intronic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968662169 4:1803184-1803206 CGGGGCCGCCTCGGCAAGGCTGG + Intronic
968958657 4:3731600-3731622 GGTGGGCTCCACGGGAATCCAGG + Intergenic
972738132 4:41865387-41865409 GGTGGCCTCTACGGGAATCCTGG + Intergenic
976719814 4:88158805-88158827 GGTGGCCGCCTGGGGAGACCCGG + Exonic
976774919 4:88697733-88697755 CATGGCCGACTCGGAAAACCAGG - Exonic
988804955 5:34731883-34731905 CCTGGCCGCATCAGGACTCCTGG - Intronic
990472604 5:56130095-56130117 CTTGGCAGCCTCTGGAGTCCAGG - Intronic
997414251 5:133712769-133712791 AGTGGCCCCCTTGGGAATCCTGG - Intergenic
1023931939 7:44711557-44711579 CGTGGCCCCTTTGGGTATCCTGG - Intergenic
1037855423 8:22367698-22367720 CGTGTCCGCGCGGGGAATCCGGG - Intronic
1041107726 8:54458651-54458673 CCCGGCCACCTGGGGAATCCGGG - Intronic
1049755520 8:144309750-144309772 CCTGTCCCTCTCGGGAATCCAGG + Exonic
1050345260 9:4679778-4679800 CGTGGCCGCCTCCGGGACCCTGG + Exonic
1050982205 9:12035014-12035036 TGTGGCCACCTGGGTAATCCGGG - Intergenic
1053623494 9:39844449-39844471 CTTGGCCGCCTAAGAAATCCAGG - Intergenic
1053881375 9:42598779-42598801 CTTGGCCGCCTAAGAAATCCAGG + Intergenic
1053891289 9:42695533-42695555 CTTGGCCGCCTAAGAAATCCAGG - Intergenic
1054220406 9:62406250-62406272 CTTGGCCGCCTAAGAAATCCAGG + Intergenic
1054230309 9:62502922-62502944 CTTGGCCGCCTAAGAAATCCAGG - Intergenic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1190063306 X:47224263-47224285 CGTGGCCCCCACAGGAAACCTGG - Intronic
1200165280 X:154031219-154031241 CGTGGCCGCCTTGGGTCTCGTGG + Exonic