ID: 1160614745

View in Genome Browser
Species Human (GRCh38)
Location 18:80116554-80116576
Sequence TTCTTTATAGATATCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160614741_1160614745 -2 Left 1160614741 18:80116533-80116555 CCAACACGTTTCCTTTTTTTTTT 0: 1
1: 2
2: 44
3: 727
4: 6068
Right 1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG 0: 1
1: 0
2: 0
3: 34
4: 377
1160614738_1160614745 18 Left 1160614738 18:80116513-80116535 CCAATTTCTCCACGTCCTTGCCA 0: 8
1: 216
2: 2005
3: 21919
4: 13519
Right 1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG 0: 1
1: 0
2: 0
3: 34
4: 377
1160614739_1160614745 9 Left 1160614739 18:80116522-80116544 CCACGTCCTTGCCAACACGTTTC 0: 1
1: 1
2: 3
3: 103
4: 710
Right 1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG 0: 1
1: 0
2: 0
3: 34
4: 377
1160614740_1160614745 3 Left 1160614740 18:80116528-80116550 CCTTGCCAACACGTTTCCTTTTT 0: 1
1: 0
2: 2
3: 74
4: 687
Right 1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG 0: 1
1: 0
2: 0
3: 34
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160614745 Original CRISPR TTCTTTATAGATATCCTGGT GGG Intronic
903068283 1:20713499-20713521 TTCATTGTAGATCTCCAGGTAGG + Exonic
904982398 1:34517598-34517620 TTCTGTATACATATCCCGGTTGG + Intergenic
906760274 1:48370837-48370859 TTCCTTGTAGAAATCCTGTTAGG - Intronic
908557862 1:65275549-65275571 TTCTTTGTATTTATCCTGCTTGG + Intronic
909477916 1:76103167-76103189 TTCTTTTTACATTTCCTGCTTGG + Intronic
909573824 1:77149692-77149714 TTCTTTGTAGATTTTCTGCTTGG - Intronic
909911244 1:81260578-81260600 TTCTTTATGGAGGGCCTGGTAGG - Intergenic
910016966 1:82536883-82536905 TTATTTAAAGATATCTTGTTGGG - Intergenic
912281870 1:108324102-108324124 TTCTTTATTGATATTCTGTCTGG + Intergenic
912689161 1:111791216-111791238 CTTTTTATAGCTATCCTGGTGGG + Intronic
912991401 1:114490355-114490377 TTTATTGTAGCTATCCTGGTGGG - Intronic
912996779 1:114538430-114538452 TTGTTTATTGATATACAGGTAGG - Intergenic
913308160 1:117454308-117454330 TTCTTTATATTTATCCTGCTGGG - Intronic
913502097 1:119480710-119480732 TTCTTAATACATATGTTGGTAGG - Intergenic
913591735 1:120335441-120335463 TGCTTAATAAATATCCTAGTAGG + Intergenic
913651622 1:120919708-120919730 TGCTTAATAAATATCCTAGTAGG - Intergenic
914169484 1:145209362-145209384 TGCTTAATAAATATCCTAGTAGG + Intergenic
914524598 1:148453324-148453346 TGCTTAATAAATATCCTAGTAGG + Intergenic
914641802 1:149613814-149613836 TGCTTAATAAATATCCTAGTAGG - Intergenic
914794102 1:150905683-150905705 TTCTTTATATATACTGTGGTGGG - Intergenic
915397735 1:155598409-155598431 TTTTTTAAAGAAATCCTGGCCGG - Intergenic
917341626 1:173985469-173985491 TTTATTATAGCTATCCTGTTGGG + Intronic
920158190 1:203973252-203973274 TTCTTTATAGCTATTCTAGTGGG - Intergenic
920577097 1:207069503-207069525 ATCTGTATCGATATCCTGGTGGG + Exonic
921016465 1:211196658-211196680 TTCTTTGTATTTATCCTGCTTGG - Intergenic
921150385 1:212396686-212396708 TTTTTTTAAGTTATCCTGGTTGG - Intronic
921588642 1:216978052-216978074 TTCTTTATAGATTATCTAGTCGG + Intronic
921877534 1:220215556-220215578 TCCTTTGTAGATTTCCTGTTGGG + Intronic
922644154 1:227268442-227268464 TTATTTATATACACCCTGGTGGG - Intronic
924601705 1:245495730-245495752 TTCTCTGTGTATATCCTGGTTGG - Intronic
924843053 1:247734866-247734888 GACTTTCTAGATATCCTGGTGGG - Intergenic
1062792133 10:314479-314501 TTCTTTAAGGAAATCCTGGCTGG - Intronic
1063039894 10:2326853-2326875 TTCATTATAAGTATCCTCGTAGG + Intergenic
1063435943 10:6030303-6030325 TTCTTTATACGTATCTTGCTTGG - Intronic
1063723156 10:8605390-8605412 TTCTTTTTAGTTATACTGCTTGG - Intergenic
1063836044 10:10013862-10013884 TTGCTTATAGACATCCTAGTGGG - Intergenic
1066518047 10:36185620-36185642 TTTTTTTTTGCTATCCTGGTGGG + Intergenic
1068550338 10:58400815-58400837 TTTTTTATAGCCATCCTAGTGGG + Intergenic
1068580629 10:58735409-58735431 TTAATTAAAGATATCCTGGAAGG - Intronic
1068737993 10:60436484-60436506 TTTTTTATAGTTATTCTAGTTGG + Intronic
1069308273 10:67000565-67000587 TTCTTTATAGATACAGAGGTTGG - Intronic
1069538562 10:69275026-69275048 TTCTTTTTAGAGATACTGGAAGG - Intronic
1069730083 10:70605459-70605481 TTGATTATAGCCATCCTGGTGGG + Intergenic
1070089398 10:73269987-73270009 TGGTTTATAGATGTCCTGATGGG - Intronic
1070220561 10:74438700-74438722 TTCTTTATTGTTTTCATGGTGGG + Intronic
1070220724 10:74441237-74441259 TTGATTATAGACATCCTAGTGGG - Intronic
1071582939 10:86790265-86790287 TTGATTATAGACATCCTAGTGGG - Intronic
1071818721 10:89258510-89258532 TTTATTATAGCTATCCTAGTGGG - Intronic
1073567501 10:104547605-104547627 TTCATTAGAGATATCCTTTTGGG - Intergenic
1074031686 10:109695332-109695354 TTCCTTATAGAAAACTTGGTGGG - Intergenic
1074096950 10:110322103-110322125 TTCTTTGTATTTATCCTGCTTGG - Intergenic
1074972747 10:118552813-118552835 TTAATTTTAGATATTCTGGTGGG + Intergenic
1075962184 10:126578445-126578467 TTCTTTTTAGCCATCCTGATGGG - Intronic
1076217246 10:128705084-128705106 TTCATTATAGTTGTCCTGGTGGG + Intergenic
1077980705 11:7297781-7297803 TGCTTTATTGATATCATGTTTGG + Intronic
1079607335 11:22386429-22386451 TTTTTTATACATATCCTAATTGG + Intergenic
1079717991 11:23772391-23772413 TTCCTTGTATATATCTTGGTTGG + Intergenic
1079830930 11:25266753-25266775 TTCTGTAAAGGTATTCTGGTAGG + Intergenic
1079840115 11:25386381-25386403 TGCTTTAAAACTATCCTGGTGGG + Intergenic
1079961151 11:26925403-26925425 TTCTTTGTAGATTTTCTGTTTGG + Intergenic
1080128841 11:28769548-28769570 TTCTTTGTTGATTTCCTGTTGGG - Intergenic
1080208670 11:29759530-29759552 CTTTTTATCAATATCCTGGTAGG + Intergenic
1080634760 11:34113904-34113926 TTCTTTAAAGAATTCCTGTTGGG + Intronic
1081015570 11:37875222-37875244 TCCTTTATGCATATCGTGGTTGG + Intergenic
1081224721 11:40505855-40505877 TTCTTAATATTTATGCTGGTTGG + Intronic
1082057459 11:47831320-47831342 TTAATTCTAGATATCCTAGTGGG - Intronic
1082225384 11:49700213-49700235 TTCTTTATTGATTTCCTGTCTGG + Intergenic
1083567035 11:63727930-63727952 TTCTTTGTAATTATCCTAGTAGG - Intronic
1084034251 11:66498523-66498545 TTCTTAAAAGATGTCCTGGCTGG - Intronic
1084854678 11:71975130-71975152 TACTTTAAAGATTTCCAGGTAGG - Intronic
1085685055 11:78613952-78613974 GTCTTGATATATATCCTGCTTGG + Intergenic
1085813320 11:79707153-79707175 TTCTTTATATCTATCCTGCTTGG - Intergenic
1086623708 11:88919492-88919514 TTCTTTATTGATTTCCTGTCTGG - Intronic
1087961831 11:104361293-104361315 TTCTTTGTATTTATCCTGCTTGG + Intergenic
1088304408 11:108392687-108392709 TTAATTATAGCTATCCTAGTAGG + Intronic
1089047736 11:115517979-115518001 TTCTTTCTAGAAATGCTGGTCGG + Intergenic
1090362123 11:126180714-126180736 TTCATTCTAGACATCCTAGTGGG - Intergenic
1090435684 11:126684695-126684717 TGACTTATAGTTATCCTGGTAGG + Intronic
1090708372 11:129361713-129361735 TTAATTATAGCTATCCTAGTAGG + Intergenic
1091834148 12:3572970-3572992 TTCTTTTTATTTATCCTGCTTGG + Intronic
1092577568 12:9804111-9804133 TTTATTATAGCTATCCTAGTGGG + Intergenic
1093350009 12:18087310-18087332 TTCCTTAAATATAACCTGGTAGG - Intronic
1093376991 12:18441423-18441445 TGCTTTTTAAATATACTGGTGGG + Intronic
1093439337 12:19175523-19175545 TTCTATATAAAAATTCTGGTAGG + Intronic
1094159307 12:27372995-27373017 TTGATTATAGCCATCCTGGTAGG + Intronic
1095118760 12:38387550-38387572 TTTTTTCTAGATAATCTGGTTGG + Intergenic
1095554005 12:43478539-43478561 TTCTTTTTATTTATCCTGCTTGG - Intronic
1097416104 12:59318285-59318307 TTCTATCTATATATCCTGTTAGG + Intergenic
1098366485 12:69708828-69708850 TTGTTTATAGCCATCCTAGTGGG - Intergenic
1098821022 12:75229514-75229536 TTCTTTATTGATTTTCTGTTTGG + Intergenic
1099732009 12:86517007-86517029 TTTATTATAGTTATCCTCGTAGG - Intronic
1099823149 12:87741007-87741029 GTCTTTTCAGATTTCCTGGTTGG - Intergenic
1101570031 12:105945424-105945446 CTCTTTATAAACATCCTGATTGG - Intergenic
1102984488 12:117267204-117267226 TAGTTTCTAGATCTCCTGGTTGG + Intronic
1103143164 12:118569819-118569841 TTCTTTGTATGTATCCTGCTTGG + Intergenic
1103456041 12:121066336-121066358 TTCTTTGTATTTATCCTGTTTGG + Intergenic
1105525531 13:21174841-21174863 TTCGTTTTAGCTATCCTGCTGGG + Intronic
1105757848 13:23485907-23485929 TTCTTTATTTTTATCCTGCTTGG - Intergenic
1106132707 13:26953040-26953062 TTTTTTCTAGATGCCCTGGTGGG - Intergenic
1106740185 13:32632473-32632495 TTTTTTATAGCCATCCTAGTAGG - Intronic
1107322434 13:39203888-39203910 TTCTTTAAATATACCCTGGTGGG - Intergenic
1107813545 13:44222780-44222802 TTCTTTTTAGCCATTCTGGTGGG + Intergenic
1109486749 13:63033028-63033050 TTTATTATAGCTATCCTAGTAGG + Intergenic
1110811367 13:79813859-79813881 TTGAGTATAGATATCCTGGTGGG + Intergenic
1111362984 13:87200537-87200559 TTCATTATAGACATCCTATTAGG + Intergenic
1112516765 13:100059793-100059815 ATTTTTATAGAAATCCTGATAGG - Intergenic
1113154495 13:107303069-107303091 TTTGTTACAGCTATCCTGGTGGG + Intronic
1116971708 14:51073132-51073154 TTCATTTTAGCTATCCTGGTGGG - Intronic
1117125634 14:52621072-52621094 TTCTTCATATTTATCCTGATTGG - Intronic
1117381447 14:55167728-55167750 TTCGGTATAGAAATCCAGGTTGG + Intronic
1117560870 14:56936956-56936978 TTCTTAGGAGATATCATGGTTGG - Intergenic
1118518428 14:66552927-66552949 CTCTTTATATTTATCCTGTTTGG + Intronic
1118754905 14:68834691-68834713 TTCTTTATTGATATTCTGCATGG + Intergenic
1118968820 14:70613966-70613988 TGCTTGACAGATATTCTGGTGGG - Intergenic
1119067830 14:71548397-71548419 TTTTTTATTTATATCCTTGTGGG + Intronic
1119264796 14:73258206-73258228 TTGATTATAGACATCCTAGTGGG + Intronic
1119349317 14:73950802-73950824 TTGTTTATAGACATTCTAGTGGG + Intronic
1119838373 14:77771441-77771463 TTGGTTATAGCTATCCTAGTGGG - Intergenic
1120481696 14:85056820-85056842 TACTTTATATATATCTTTGTAGG - Intergenic
1120810746 14:88801054-88801076 TTCTTTTTAAATATACTTGTTGG + Intergenic
1121012132 14:90526206-90526228 TTGATTATAGACATCCTAGTGGG + Exonic
1121316914 14:92967376-92967398 TTTATTATAGTCATCCTGGTAGG - Intronic
1121805154 14:96812426-96812448 TTGTTTATATATGTCCTAGTGGG + Intronic
1122404029 14:101488367-101488389 TTCTTTGTATTTATCCTGCTTGG + Intergenic
1124397919 15:29321108-29321130 TTTTTGATAGTTATCCTGTTTGG - Intronic
1124826140 15:33097435-33097457 TTCTTTGTATTTATCCTGCTGGG - Intronic
1125136027 15:36343870-36343892 TTCTTTGTATTTATCCTGCTTGG - Intergenic
1125453371 15:39832180-39832202 TTGATTATAGCTATCCTAGTAGG - Intronic
1126863336 15:52908836-52908858 TTCTTTTTAGTTATTCTGATAGG + Intergenic
1127161196 15:56188452-56188474 TTCTTTATAATTATCCTGCTTGG - Intronic
1127438074 15:58977956-58977978 TTAATTATAGACATCCTAGTGGG - Intronic
1128627026 15:69219638-69219660 TTCTTTACAAATAAGCTGGTTGG + Intronic
1129553666 15:76481246-76481268 TGCTTTATAAATATGCTGGGAGG + Intronic
1129586480 15:76872356-76872378 TTCTTTGTATTTATCCTGCTTGG - Intronic
1131348627 15:91675628-91675650 TTCATTACAGTTATCCTGTTTGG - Intergenic
1133133821 16:3695237-3695259 TTCTCTGTACATATGCTGGTTGG - Intronic
1133615345 16:7471084-7471106 ATCTTTATAGAGAGACTGGTTGG - Intronic
1133863270 16:9616939-9616961 TGCTTTCTAGATAACCTTGTAGG + Intergenic
1134562358 16:15221465-15221487 TTAATTATAGCTATCCTTGTGGG - Intergenic
1134922899 16:18133092-18133114 TTAATTATAGCTATCCTTGTGGG - Intergenic
1135550657 16:23395779-23395801 ATATTTCTTGATATCCTGGTTGG + Intronic
1137941385 16:52690785-52690807 TTCTTTGTAGTTATCTTGCTTGG + Intergenic
1139201229 16:64979538-64979560 TTCATTATAGCTATCATAGTGGG - Intronic
1141024302 16:80529769-80529791 TTCTTTGTATTTATCCTGCTTGG - Intergenic
1142661902 17:1436443-1436465 TTCTTCATAGAAAACCTGTTTGG - Intronic
1143552930 17:7642332-7642354 TTCTTTCTGGAGATGCTGGTGGG + Intergenic
1144007806 17:11116876-11116898 TTCTTTATAGATAGATTGATAGG + Intergenic
1145356134 17:22154454-22154476 TTTATTATAGCTATCCTAGTAGG - Intergenic
1146459570 17:33034808-33034830 TTCTTTGTAGTTATCCTGCTTGG + Intronic
1146622845 17:34413273-34413295 TTCTTTATCAATATCCAGGAAGG - Intergenic
1147361332 17:39932540-39932562 TTTTTTATAGAGATGGTGGTTGG - Intergenic
1148146545 17:45368800-45368822 TTGATTATAGCCATCCTGGTGGG - Intergenic
1149373178 17:56016938-56016960 TTCTTTATATTTATTCTGTTTGG + Intergenic
1149814671 17:59711903-59711925 TTCTTTATAGATTACCTGGAAGG + Intronic
1150097640 17:62391921-62391943 TTCATTATAGACATCATGCTTGG - Exonic
1150115341 17:62543515-62543537 TTCATTATAGCCATCCTAGTGGG + Intronic
1150345386 17:64400703-64400725 TTGGTTATAGTTATCCTAGTGGG - Intronic
1150665559 17:67133440-67133462 TTCTTTAAAAATATTCAGGTTGG + Intronic
1150859046 17:68782164-68782186 TTGTTTATAGCCATCCTAGTTGG + Intergenic
1151809881 17:76432897-76432919 TTGTTTATAGCCATCCTAGTGGG - Intronic
1152851522 17:82639382-82639404 TTCATTATAGATGTACTGTTTGG - Intronic
1153733930 18:8044820-8044842 TTTTTTATAGAAATCCTAGTGGG - Intronic
1155435033 18:25803619-25803641 TTATTTATAATTATTCTGGTTGG - Intergenic
1156759999 18:40577335-40577357 TTCTTCAGAGCTCTCCTGGTTGG + Intergenic
1157047150 18:44115512-44115534 TTCATTACAGACATCCTAGTGGG - Intergenic
1157215888 18:45783065-45783087 TTTTTAATGCATATCCTGGTAGG + Intergenic
1157376325 18:47169628-47169650 TTTATTATAGCCATCCTGGTTGG + Intronic
1157720451 18:49919633-49919655 TTCATTATAGCTATTCTGGTGGG - Intronic
1158149079 18:54346372-54346394 TTGATTATAGCTATCCTAGTTGG - Intronic
1158182246 18:54729400-54729422 TCCTTTCTAGATATCCTTCTTGG - Intronic
1158906869 18:62021635-62021657 TTCTTCACAGAAATCCTGGTGGG - Intergenic
1159622351 18:70652838-70652860 GTCTTTATAGATATGTGGGTTGG + Intergenic
1159632489 18:70764925-70764947 TTCTTTGTAGATAATCTGATTGG - Intergenic
1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG + Intronic
1162883393 19:13677577-13677599 TTCTTTTTATTTATCCTGGTTGG - Intergenic
1163937408 19:20460327-20460349 TTCTTTATAGACCACCTGTTAGG - Intergenic
1163955487 19:20634382-20634404 TTCTTTATAGACCACCTGTTAGG + Intronic
925792971 2:7511699-7511721 TTCTTTATAGATAAGCTTGCGGG + Intergenic
927343229 2:22006591-22006613 TTGTTTATTGATTTCCTGGAAGG - Intergenic
928047072 2:27945572-27945594 TTGTTTACAGAAATCCTGCTGGG + Intronic
928556026 2:32425999-32426021 TTTATTGTAGATATCCTGTTAGG + Intronic
928764547 2:34627961-34627983 TTCTTTTTTGAGATCCTGGGGGG - Intergenic
930602947 2:53462588-53462610 TTCTTTATAGACATCATTGCCGG + Intergenic
930629434 2:53736304-53736326 TTCATTTTAAATATTCTGGTGGG - Intronic
930855549 2:56013198-56013220 ATCTTTTCAGATATGCTGGTTGG + Intergenic
930993992 2:57694338-57694360 ACCTCTATAGATATCCTTGTGGG - Intergenic
931306034 2:61029305-61029327 TTCATTATAGCTATCCTAGTGGG - Intronic
931690008 2:64827522-64827544 TAATTTAGAGATATGCTGGTTGG - Intergenic
932755075 2:74402228-74402250 TTCTTTTTATTTATTCTGGTGGG - Intergenic
933609521 2:84419564-84419586 TTCTTTATGGATATTCAAGTGGG - Intergenic
934690463 2:96354633-96354655 TTCTTAACAGATTTCCTGCTGGG + Intronic
936242870 2:110803125-110803147 ATCTTCACAGTTATCCTGGTGGG + Intronic
936256014 2:110913070-110913092 TTCATTATAGCCATCCTAGTGGG - Intronic
936280003 2:111130509-111130531 TTTTTCATAGATTTCCTGGGAGG + Intronic
936601740 2:113903271-113903293 TTCTTTATATTTATTCTGCTTGG + Intronic
936936409 2:117842350-117842372 TTTCTTATAGCCATCCTGGTGGG + Intergenic
937613234 2:123889301-123889323 TTCTTTGTAGATTTTCTGTTGGG + Intergenic
937686237 2:124700532-124700554 TTTATTATAGTTATCCTAGTGGG + Intronic
938872884 2:135499663-135499685 TTCATTTTAGATATTCTGGTAGG - Intronic
940016629 2:149113113-149113135 TTATTTATAGATATCCTTTAAGG + Intronic
940214644 2:151291960-151291982 GTCTTTATAGAAAGCCTGGGAGG - Intergenic
940657452 2:156506301-156506323 TTCTTTCCAGAAATTCTGGTGGG + Intronic
940884837 2:158980215-158980237 TTCATTATAAATATCCTGGAAGG + Intronic
941253958 2:163204341-163204363 TTCTTTAAAGATATAATGGCTGG - Intergenic
941945093 2:171087626-171087648 TTCTTTGTAGTTATCCTGCTTGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942180415 2:173375040-173375062 TGTTTTATAGACATCCTAGTAGG + Intergenic
948227867 2:236326065-236326087 TTCTTTGTAGGTAATCTGGTAGG + Intronic
1168990526 20:2091639-2091661 TTCTTTATAGAAATTATTGTAGG - Intergenic
1169949232 20:11024573-11024595 TTGATTATAGCTATCCTAGTAGG + Intergenic
1170252836 20:14304401-14304423 TTCTTTTTAAAAATACTGGTTGG - Intronic
1174674726 20:52342637-52342659 TTCATTAAAGAGATCTTGGTGGG + Intergenic
1175288780 20:57858459-57858481 TTGATTCTAGCTATCCTGGTGGG + Intergenic
1175587627 20:60157288-60157310 TTCTTTGTATCTATCCTGTTTGG + Intergenic
1175843518 20:62046616-62046638 TTCTTTCCAAATATCCTGGGTGG + Intronic
1176247118 20:64102573-64102595 TTCTTTGGAGGAATCCTGGTTGG + Intergenic
1176956709 21:15113255-15113277 TTCATTTTGGATATTCTGGTAGG - Intergenic
1178187747 21:30243269-30243291 TTCTTTGTAGAGATTGTGGTGGG + Intergenic
1179709178 21:43202889-43202911 TTCTTTACTGATATCCTTTTTGG + Intergenic
1184284637 22:43463125-43463147 TCCTTTATATATAACCTGTTGGG + Intronic
950170584 3:10836528-10836550 TTGATTATAGCTATCCTAGTAGG + Intronic
950935059 3:16830920-16830942 TAAATTATAAATATCCTGGTGGG - Intronic
951464427 3:22986783-22986805 TTCTCTGTAGATCTCCTGGCAGG - Intergenic
952742902 3:36751376-36751398 ATCTTTACAGCTATCCTGGGAGG - Intergenic
953137586 3:40195885-40195907 TTCTTTATAGATTTCTTCTTTGG + Intronic
953331420 3:42056362-42056384 TTGATTATAGAAATCCTTGTGGG + Intronic
955895193 3:63692052-63692074 TTCCTTGTATATATCCTGTTTGG - Intergenic
955921665 3:63963287-63963309 TTCTTTATAGATTTTTTGATTGG + Intronic
956299297 3:67752493-67752515 CTCTTTTTAGTTATTCTGGTAGG - Intergenic
957176726 3:76820484-76820506 TAATTTATAGCCATCCTGGTAGG + Intronic
959283090 3:104372097-104372119 TTCTTTGTATCTATCCTGCTTGG + Intergenic
960661533 3:120065431-120065453 TTGATTATTGCTATCCTGGTGGG - Intronic
960750602 3:120948128-120948150 TTTATTATAGTTATCCTAGTGGG + Intronic
960840257 3:121950849-121950871 TTCTTTATATTCATCCTGCTTGG + Intergenic
961234372 3:125351856-125351878 TTGATTATAGCTATGCTGGTGGG - Intronic
961259780 3:125592782-125592804 TTTTTTATACATTTCCTGTTAGG - Intronic
961557584 3:127707133-127707155 TTCTTTATAAGTACCCTGGGAGG - Intronic
961605545 3:128092666-128092688 TTGATTATAGATATTCTAGTGGG - Intronic
961843779 3:129742525-129742547 GTCTTTATAGCCATCCTAGTGGG - Intronic
962659983 3:137591977-137591999 TTTTTTATAGCCATCCTAGTGGG - Intergenic
963706467 3:148694539-148694561 TTGATTATAGCTATCCTAGTAGG + Intergenic
963981159 3:151538648-151538670 TTCTTTATGGAAATTCTGCTCGG - Intergenic
964733557 3:159892800-159892822 TTCTTTGTAGATTTCCTTGCAGG + Intronic
965972538 3:174579301-174579323 CTCTTTATAGATATCTCTGTTGG - Intronic
966876813 3:184327063-184327085 TTCTTCATACCTGTCCTGGTTGG + Intronic
967112868 3:186310497-186310519 TTCTTAATAGATGTCTGGGTTGG + Intronic
970149150 4:13070425-13070447 TTCTTTACAGCTACCCTGCTAGG - Intergenic
970519324 4:16866076-16866098 TCCTCTGTAGATATCCTGTTAGG - Intronic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
971957346 4:33438962-33438984 TTCTGTGTATAGATCCTGGTTGG + Intergenic
972753043 4:42012121-42012143 TTCTTTTTATTTATCCTGCTTGG - Intronic
973036853 4:45417568-45417590 TTCTTTATCCATTTACTGGTTGG + Intergenic
973608867 4:52614334-52614356 TTCTTTGTATTTATCCTGCTTGG - Intronic
973874572 4:55204159-55204181 ATCTTTATATTTATCCTGCTTGG + Intergenic
974510122 4:62828782-62828804 TTAATTATAGACATTCTGGTAGG + Intergenic
974848317 4:67378264-67378286 TTTTTTATATTTATCCTGCTTGG - Intergenic
976871573 4:89800497-89800519 GTCTTTAGAGAAATCCTTGTGGG - Intronic
977140155 4:93361334-93361356 TTCTTTATAAATATGCTGCTTGG + Intronic
977605257 4:98977866-98977888 TTCTTTGTATTTATCCTGCTTGG - Intergenic
978003239 4:103583009-103583031 TTGATTATAGCTATCCTAGTAGG + Intergenic
978349561 4:107807564-107807586 CTCAATTTAGATATCCTGGTGGG - Intergenic
979623701 4:122824203-122824225 TTAATTATAGCTATCCTAGTGGG + Intergenic
979639557 4:122997821-122997843 TTGATTATAGCTATCCTAGTGGG + Intronic
979877770 4:125914957-125914979 TTCTTTATAGCTGTCTTAGTGGG - Intergenic
980333782 4:131442087-131442109 TTATTTATTGATATATTGGTGGG - Intergenic
980482669 4:133408305-133408327 TTCTTGACAGGTAACCTGGTAGG + Intergenic
980619925 4:135287665-135287687 TTCTAGATGGATATCATGGTAGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982107951 4:152027299-152027321 TTCATTATAGCTACCCTAGTAGG - Intergenic
982900675 4:160998061-160998083 TCCTTTATATACATCCTGCTTGG + Intergenic
984456745 4:179978523-179978545 TTCTTTATTAATATCCTCCTTGG + Intergenic
984787761 4:183584580-183584602 TTCATCATAGCTATCCTCGTGGG - Intergenic
984805753 4:183749982-183750004 TTCTTTAAATTTATCCTGTTTGG - Intergenic
989350776 5:40483778-40483800 TTCTTTTTATTTATTCTGGTTGG - Intergenic
990754058 5:59048526-59048548 TTCATTATAGTTAGCCTGGATGG + Intronic
991155763 5:63433024-63433046 TGCTTTAAAAATATCATGGTAGG - Intergenic
991536098 5:67670557-67670579 TTCATTATAGCCATCCTAGTGGG + Intergenic
993114038 5:83697715-83697737 TTCATTATAGCCATCCTAGTGGG + Intronic
993770081 5:91916047-91916069 TTCTTTGGAGACATCATGGTTGG + Intergenic
994574745 5:101563825-101563847 TTCTGTATTTTTATCCTGGTAGG - Intergenic
994633631 5:102317517-102317539 TTCTTTCTTGATATTCTGTTTGG + Intergenic
995285201 5:110380397-110380419 TTGTTTATAGCCATCCTAGTGGG + Intronic
996446330 5:123556264-123556286 TTCTTTTTAGTTATCCTGTTTGG + Intronic
996583880 5:125063213-125063235 TTTTTTATAGTTATCTTAGTGGG - Intergenic
996610943 5:125379688-125379710 TTCATTATAGACATCCTAGTGGG - Intergenic
997128159 5:131249312-131249334 TTCTTTAGAAATAACCTGGCCGG - Intronic
997937637 5:138127855-138127877 TTCTTTCTAGTTATCCTGAAAGG - Intronic
999479315 5:151931583-151931605 TTCTTTACAAATATCTTGCTTGG + Intergenic
999493449 5:152073819-152073841 TTATTTAGAGAGAGCCTGGTGGG + Intergenic
1000015834 5:157274747-157274769 TTCATTATAGCCATCCTAGTGGG + Intronic
1000392465 5:160739193-160739215 TTCTGTGTAGATATCCTTATCGG - Intronic
1000492985 5:161938724-161938746 GTGGTTATAGCTATCCTGGTGGG - Intergenic
1000867638 5:166534808-166534830 TTCATTTTAGCCATCCTGGTGGG + Intergenic
1002354366 5:178612343-178612365 TTCTTTACAGCTTTACTGGTGGG - Intronic
1002973970 6:2055354-2055376 TTCTTTGTATTTATCCTGTTTGG - Intronic
1003179967 6:3782895-3782917 TTCTTTAGAAATTTCCTGGGAGG - Intergenic
1003233882 6:4278704-4278726 TTTATTATAGCTATCCTGGTAGG + Intergenic
1004600661 6:17146593-17146615 TTATTTATATATATCCGAGTTGG + Intergenic
1004783149 6:18935269-18935291 CTCATTATGAATATCCTGGTAGG + Intergenic
1006007291 6:31012692-31012714 TACTTTATAGATCTAGTGGTAGG - Intronic
1007334503 6:41143152-41143174 TTTATTATAGCTATCCTAGTGGG + Intergenic
1008041478 6:46805750-46805772 TTCTTTTTATCTATCCTGTTTGG + Intronic
1008119146 6:47590857-47590879 TTCTTTGCATATATCCAGGTTGG - Intronic
1008285527 6:49644721-49644743 TTAATTCTAGCTATCCTGGTGGG + Intergenic
1010082783 6:71884008-71884030 TTCTTGATACATATTCTGGAAGG + Intergenic
1010394247 6:75372582-75372604 TTCTTGATAGCCATCCTGTTGGG - Intronic
1011351050 6:86424224-86424246 TTCTTTGTAGAGAGCTTGGTAGG - Intergenic
1011481737 6:87800735-87800757 TTCTTTGTATTTATCCTGCTTGG + Intergenic
1012366103 6:98442948-98442970 TTCTTTTTAGTTATTGTGGTAGG + Intergenic
1012969557 6:105713567-105713589 TTCTTTATATTTATTCTGCTTGG - Intergenic
1013885239 6:114956924-114956946 TTTATCATACATATCCTGGTTGG + Intergenic
1014499910 6:122173983-122174005 TTAATTATAGCTATCCTTGTAGG + Intergenic
1015646913 6:135402137-135402159 TTCTTTATAGCCATCCTAGTGGG - Intronic
1016406113 6:143732816-143732838 TTTATTATTGCTATCCTGGTGGG + Intronic
1016635119 6:146279977-146279999 TTCTTTGTATTTATCCTGCTAGG + Intronic
1016764928 6:147781899-147781921 TTCCTTTTTGATATCCTGGGAGG - Intergenic
1017244861 6:152212802-152212824 TTCATTATAGTCATCCTTGTGGG + Intronic
1018609080 6:165629257-165629279 TTCTTCTTAGATATCCCAGTGGG + Intronic
1021031373 7:15740748-15740770 TTCTTTATAGAATTCTTGGTTGG - Intergenic
1021528142 7:21611577-21611599 GTCTTTGTATTTATCCTGGTTGG - Intronic
1022566062 7:31402993-31403015 TTTATTATAGCTATCCTAGTGGG + Intergenic
1023070995 7:36433517-36433539 TTCTTTGTATTTATCCTGTTTGG + Intronic
1023252718 7:38282791-38282813 TTTTTAATATTTATCCTGGTTGG + Intergenic
1024132619 7:46370613-46370635 TTGATTATAGCTATCCTAGTGGG + Intergenic
1024321381 7:48074684-48074706 GTTTTTATAGATAACTTGGTGGG - Intergenic
1028503519 7:91546252-91546274 TTCATTATAACTATCCTAGTGGG - Intergenic
1028564791 7:92217932-92217954 TTTTTTATAGCCATCCTAGTGGG + Intronic
1029259186 7:99290185-99290207 TTCTTTAACAATATCCTGGCTGG + Intergenic
1029630458 7:101747096-101747118 TTCTTTCTAGATTTTCTGATCGG - Intergenic
1030151979 7:106416370-106416392 GGCTTTATATTTATCCTGGTTGG + Intergenic
1030238040 7:107288490-107288512 TTGTTTATAGACATCCTAGGGGG + Intronic
1030388316 7:108893196-108893218 TTCTTTAAAGATATCAAGGCTGG + Intergenic
1030492953 7:110262018-110262040 TTCTTTATAGATATATTTCTAGG - Intergenic
1030676143 7:112387855-112387877 TTCTTAATAGCCATCCTAGTGGG - Intergenic
1031671778 7:124556227-124556249 TTTTATATATATATCCTAGTGGG - Intergenic
1032045066 7:128599206-128599228 TTCATTATAGCCATCCTAGTGGG + Intergenic
1032106845 7:129039119-129039141 TTGATTATAGCCATCCTGGTGGG - Intronic
1032673689 7:134108721-134108743 TTCTTAATAGTTATAATGGTGGG - Intergenic
1032928130 7:136632908-136632930 TTCTTTATTGATATTCTGTCTGG + Intergenic
1033005408 7:137556237-137556259 TTTTTTCTAGGTATCTTGGTGGG - Intronic
1035102242 7:156410215-156410237 TTCTTTGTATTTATCCTGCTTGG + Intergenic
1037675117 8:21044450-21044472 TTCTTAATAGGTCTCCAGGTCGG + Intergenic
1038386517 8:27152922-27152944 TTCTTTGTAGATATCTTTGATGG - Intergenic
1039622967 8:39017341-39017363 TTCTTTCTCTATATCCTTGTTGG - Exonic
1042116073 8:65432881-65432903 TTCTTTATATTTATCCTTTTTGG - Intergenic
1043326055 8:79052917-79052939 TTCCTTTTAGTTATTCTGGTGGG + Intergenic
1043842327 8:85122239-85122261 TTCTTTGTATTTATCCTGCTTGG + Intronic
1044330738 8:90917297-90917319 TTTTTTATTCATCTCCTGGTGGG + Intronic
1044623602 8:94214955-94214977 TTTATTATAGCTGTCCTGGTGGG - Intronic
1045633299 8:104153394-104153416 ATCTTTATAGAAATGCTGTTAGG - Intronic
1045683209 8:104684675-104684697 TTCATTATAAATTACCTGGTGGG - Intronic
1046403017 8:113731825-113731847 TTCTCTATAGTTATCTTGGGGGG - Intergenic
1046737005 8:117787742-117787764 TTCTTCATATTTATCCTGTTTGG + Intergenic
1048966504 8:139618691-139618713 AGCTTTATGTATATCCTGGTGGG - Exonic
1050454013 9:5815185-5815207 TTCTTTATATTTATCTTGTTTGG - Intronic
1050619382 9:7436846-7436868 TTTTTTAAGGATAGCCTGGTGGG + Intergenic
1050654970 9:7818080-7818102 TTCTTTATAGATTACCCAGTTGG - Intronic
1050930487 9:11317221-11317243 CTCTTTCTAAATATCCTTGTTGG - Intergenic
1051027410 9:12629938-12629960 TTCTCTACAAATATCCTGCTGGG - Intergenic
1051033382 9:12711817-12711839 TTCTTTATAGATCTCCTACCTGG - Intergenic
1051870333 9:21729897-21729919 TTCGTTGTAGTTATCCTGCTTGG - Intergenic
1052424916 9:28291858-28291880 TTCTTTAAATTTATCCTGTTTGG - Intronic
1054711881 9:68518942-68518964 TTATTTTTATATATCCTGCTTGG - Intronic
1054885026 9:70187067-70187089 TTCTTTGTAGTTATTCTGCTTGG + Intronic
1054961228 9:70971902-70971924 TTCATTACAGTCATCCTGGTTGG - Intronic
1056311411 9:85345237-85345259 TTCTTTATTGATATCATATTGGG + Intergenic
1056345114 9:85685276-85685298 TTCTTCATAGTTATCCTGCTTGG - Intronic
1056421133 9:86427564-86427586 TTCATTATAGCCATCCTAGTGGG + Intergenic
1056741513 9:89259833-89259855 TTGGTTATAGCTATCCTAGTGGG - Intergenic
1056948805 9:91025477-91025499 TTCATATTAGATATCCTGTTGGG + Intergenic
1058339102 9:103872599-103872621 TTCTATATAGATATTTTGTTAGG - Intergenic
1058638752 9:107062561-107062583 TTCTATATAGATGTCCTAGATGG + Intergenic
1059474592 9:114534657-114534679 TACTTTATAGCCATCCTAGTGGG - Intergenic
1059645276 9:116259910-116259932 TTCTTGATAGATACCTAGGTTGG - Intronic
1060006412 9:120003974-120003996 TTCTTTATAAATTACCTAGTCGG + Intergenic
1060861551 9:126958959-126958981 TTAATTATAGCCATCCTGGTAGG + Intronic
1061797261 9:133093725-133093747 TTCCTTATAGATCTTCTGTTTGG + Intergenic
1185645731 X:1614382-1614404 TTCTTTGTAGAGATCGGGGTGGG - Intergenic
1186335409 X:8581634-8581656 TCCTTTAGACATATCCTGGAGGG - Intronic
1186627504 X:11310194-11310216 TTTTTTAAAGCTATCCTAGTGGG - Intronic
1186652989 X:11581243-11581265 TTGTTTATAGCCATCCTAGTAGG - Intronic
1187040363 X:15588619-15588641 TTAATCATAGCTATCCTGGTGGG + Intronic
1187298277 X:18023855-18023877 TTCTGTATAGATATAATGGTTGG + Intergenic
1187981414 X:24761667-24761689 TTCTTTAATGATGTCCTGATAGG + Intronic
1188164703 X:26847533-26847555 TTGATTATAGCTATCCTGGCAGG + Intergenic
1188545873 X:31306251-31306273 TTGTTTATATATCTTCTGGTTGG + Intronic
1189532054 X:41895188-41895210 TTCTTTCTTGATTTCCTCGTTGG - Intronic
1189963335 X:46346118-46346140 TTCTTTAGATTTATCCTGTTTGG - Intergenic
1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG + Intergenic
1191584110 X:62801241-62801263 TTTTTTCTAGATTTCATGGTGGG + Intergenic
1191951930 X:66602186-66602208 TTCTTTATATCTATACTAGTAGG - Intronic
1192101809 X:68272235-68272257 TTCTTTGTAGATATGCAGGTTGG + Intronic
1192345953 X:70305912-70305934 TTAATTATAGCTATCCTAGTGGG + Intronic
1193545334 X:82819886-82819908 TGCTTTATAGCTATCCTAATGGG + Intergenic
1193894077 X:87089252-87089274 TTCTTTATTGATATTCTGTCTGG - Intergenic
1194221365 X:91196464-91196486 TTTTTTAAAGATATTCTTGTAGG - Intergenic
1194439123 X:93908131-93908153 TTCTTTATTGATTTCCTGTCCGG + Intergenic
1194488670 X:94518942-94518964 TTTGTTATAGCTATGCTGGTAGG + Intergenic
1194686393 X:96923051-96923073 TGCTTTCTAGATAGCCAGGTAGG + Intronic
1194754517 X:97722657-97722679 TTCATTTTAGATACTCTGGTGGG - Intergenic
1194894166 X:99418561-99418583 TTCTATATATATATACTAGTAGG + Intergenic
1195035783 X:100970828-100970850 TTGTTTACAGCTATCCTAGTGGG - Intronic
1195205144 X:102591944-102591966 TTTATTATAGACATCCTAGTGGG + Intergenic
1195781105 X:108465282-108465304 TTAATTATAGCTATCCTGGTGGG + Intronic
1196087821 X:111705161-111705183 TTTATTACAGCTATCCTGGTAGG + Intronic
1196392556 X:115223973-115223995 TTGTTTATAGCCATCCTAGTGGG - Intronic
1196412762 X:115437248-115437270 TTGATTATAGCCATCCTGGTGGG - Intergenic
1196531659 X:116794779-116794801 TTGTTTATAGCTATCTTGCTGGG + Intergenic
1197435996 X:126428978-126429000 ATCTTTAGAGTTATCCTAGTTGG + Intergenic
1197694789 X:129539546-129539568 TTCTTTAAATAAATCCTGTTGGG - Intergenic
1199337425 X:146635804-146635826 TTCATTATAGCCATCCTAGTGGG - Intergenic
1200557872 Y:4660212-4660234 TTTTTTAAAGATATTCTTGTAGG - Intergenic