ID: 1160615097

View in Genome Browser
Species Human (GRCh38)
Location 18:80120153-80120175
Sequence GGGACATGGAGCATATGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160615097 Original CRISPR GGGACATGGAGCATATGCCA AGG (reversed) Intronic
900381175 1:2384871-2384893 GGCACATGGAGAAGCTGCCAGGG + Intronic
900462958 1:2810157-2810179 GGCACATGGAGCAGGGGCCAGGG - Intergenic
901259321 1:7860089-7860111 CGAACATTGAGCATGTGCCAGGG + Intergenic
901870719 1:12137803-12137825 GGGTTATGGACCAGATGCCAGGG + Intronic
903028413 1:20445570-20445592 GGGAAAAGGAGAATCTGCCAGGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907161523 1:52373816-52373838 GGTACAGTGAGCAAATGCCAAGG + Intronic
907309723 1:53532300-53532322 GGCAGATGGAGCACAGGCCAGGG + Intronic
909481102 1:76129612-76129634 GGGAGGTGCAGCATATGCCATGG + Intronic
910124358 1:83824043-83824065 GGGCCATGGAGGTCATGCCAAGG + Intergenic
910814501 1:91276170-91276192 GGGACCTGAAGGATAAGCCAAGG - Intronic
911981012 1:104566367-104566389 GGCACAGGGACCATATGGCAAGG + Intergenic
916386028 1:164271502-164271524 TGGAAATGGAGAATAGGCCAAGG - Intergenic
917296531 1:173525165-173525187 GAGATATGGAGGAGATGCCATGG - Intronic
919073404 1:192784371-192784393 GGAACATCCAGCATATGCCTAGG + Intergenic
922219704 1:223549179-223549201 CAGGCATGGAGCATATGTCAAGG - Intronic
923289169 1:232527435-232527457 GGCACAGGGAGCAAATTCCAGGG + Intronic
1063377216 10:5561539-5561561 GGGCCCTGGAGCAGGTGCCAAGG + Intergenic
1063598413 10:7458453-7458475 GGGACATGCAGGAAATGCTAAGG + Intergenic
1064526437 10:16260838-16260860 GGGAGATGGAGGATAAGCGAAGG + Intergenic
1064742706 10:18449766-18449788 GGAACCCGGAGCATATCCCAGGG + Intronic
1067291496 10:44946683-44946705 GGGTCATGGTTCAAATGCCATGG + Intergenic
1069901143 10:71707290-71707312 GGGACGGGGAGCATCTACCAAGG + Intronic
1070284532 10:75073376-75073398 GGGAAATGGAGAAAATTCCATGG + Intergenic
1072960512 10:99924972-99924994 GGGGCACAGAGCATATGACAGGG - Intronic
1074047157 10:109849718-109849740 GGTTCATGGAGCATTTGGCAAGG - Intergenic
1074418968 10:113292643-113292665 AGGACAGGGAGCATCTACCATGG + Intergenic
1075000350 10:118792385-118792407 GGGACATGGAAGACCTGCCATGG + Intergenic
1075673346 10:124279447-124279469 GAAAGATGGAGCATAAGCCAGGG + Intergenic
1075840195 10:125494692-125494714 GGGACATGGCACATATCACACGG + Intergenic
1076597689 10:131635929-131635951 GGGGCATGGAGACAATGCCAAGG + Intergenic
1078099824 11:8323482-8323504 GGGACATGGAGGCTGTGCCCGGG + Intergenic
1078397182 11:10991570-10991592 AGGAAAAGGAGCATATGTCAGGG + Intergenic
1080846108 11:36028396-36028418 GGGATAGGGAGGATATGCCTTGG + Intronic
1081120124 11:39255990-39256012 GGGAACTGGAGCAAAGGCCATGG - Intergenic
1084040951 11:66542476-66542498 GGCTCATGGAGCAGGTGCCAGGG + Intronic
1084892198 11:72242100-72242122 GGGACATGGAGAAGGTGCCTGGG - Intronic
1084946179 11:72639800-72639822 GGGGCATGGAGAACATTCCAGGG + Intronic
1092986714 12:13852782-13852804 CGTGGATGGAGCATATGCCATGG - Intronic
1093180251 12:15959018-15959040 GGGCCATGAAGCATACTCCATGG - Intronic
1096477840 12:51919266-51919288 GGGGCAGGGAGCATGGGCCAGGG - Intronic
1096769253 12:53923668-53923690 GGGAGATGGAGCATATACTCAGG - Intergenic
1102737207 12:115172975-115172997 TGGACAGGCAGCATATGTCAAGG - Intergenic
1103916611 12:124379019-124379041 GGGACAAGGAGCACAAGGCAGGG + Intronic
1104756253 12:131271067-131271089 GGGAGATGGAGCCTGGGCCATGG - Intergenic
1104777525 12:131399958-131399980 GGGAGATGGAGCCTGGGCCATGG + Intergenic
1106666518 13:31856878-31856900 GGGATGTGAAGCACATGCCATGG - Intergenic
1110338971 13:74366864-74366886 AGGACACGTAGCAGATGCCAAGG + Intergenic
1110401997 13:75102862-75102884 GGGAAATGGAGAAAATGCAAAGG - Intergenic
1112428945 13:99332679-99332701 GGAACAAAGAGCATATGCCCGGG - Intronic
1114270338 14:21097259-21097281 GGGACATGGAACCTCAGCCATGG + Intronic
1116672926 14:47866747-47866769 CGGATATGGAGCATTTGCCATGG - Intergenic
1118112900 14:62742730-62742752 GCAACATGGAGGAGATGCCATGG + Intronic
1123944786 15:25233764-25233786 GGGACATGGGGCATGGGACAGGG - Intergenic
1124533674 15:30526065-30526087 GGGAGATGGAGAAGCTGCCAGGG - Intergenic
1124764981 15:32481580-32481602 GGGAGATGGAGAAGCTGCCAGGG + Intergenic
1125071595 15:35561065-35561087 CAGAAACGGAGCATATGCCAAGG + Intergenic
1125191241 15:36996676-36996698 GAGACATGGAGCAGATGGAACGG + Intronic
1129944134 15:79524504-79524526 GGGACACAGAGCATAATCCATGG + Intergenic
1133753775 16:8745919-8745941 GGGACATTGGGCATCTGTCAGGG + Intronic
1141623157 16:85247782-85247804 GGCACATGGGGGACATGCCAGGG + Intergenic
1144390840 17:14792018-14792040 GGAACATGGAGCATGTGGCAGGG - Intergenic
1144515388 17:15914077-15914099 GGGACATGCAGCTCATGGCAAGG + Intergenic
1145715473 17:27015704-27015726 GGGCCAAGGATCATCTGCCAGGG + Intergenic
1148884971 17:50765887-50765909 GGACAATGGAGCATGTGCCAGGG - Intergenic
1150302565 17:64058740-64058762 GGGAAATTCAGCATGTGCCAGGG - Intronic
1152316200 17:79581819-79581841 CTGCCATGGAGCATCTGCCATGG + Intergenic
1152475004 17:80512279-80512301 GGGACCTGGACCACCTGCCATGG + Intergenic
1153307863 18:3649313-3649335 GGGACCTGTGGCATCTGCCAGGG - Intronic
1153943954 18:10002635-10002657 GGTAAATGTACCATATGCCACGG - Intergenic
1154472485 18:14718354-14718376 GGGTCAAGGATCATCTGCCAGGG - Intergenic
1156148642 18:34217715-34217737 GGTATATGTAGCATATGCCGGGG - Intronic
1156520444 18:37717767-37717789 GAGACAGGGAGCCTAGGCCATGG + Intergenic
1156584265 18:38414312-38414334 GAGTCATGGTGCATATGCAAAGG - Intergenic
1159871789 18:73766892-73766914 GGGACAGGAAGCAAATGTCATGG + Intergenic
1160615097 18:80120153-80120175 GGGACATGGAGCATATGCCAAGG - Intronic
1160781840 19:880956-880978 GGAAAATGGAGCATAAACCAAGG + Intronic
1162046329 19:8002727-8002749 GAGCCATGGAGCATAAGCAAAGG + Intronic
1164697189 19:30254172-30254194 CTGACATGGAGCATATATCAAGG - Intronic
1166331026 19:42078099-42078121 GGGAGAAGGAGCAGAGGCCATGG + Intronic
1166741115 19:45115381-45115403 GGGAGATGGAGCATGTGCCAAGG - Intronic
926300325 2:11597476-11597498 GGGACAAGGAGCCTATCCCAGGG - Intronic
926417450 2:12663729-12663751 GGTACTTGGAGCTTATCCCAAGG + Intergenic
937379395 2:121362904-121362926 CGGACATGGAACACATCCCAGGG + Intronic
937396579 2:121541728-121541750 CGGAGATGGAGCAGCTGCCATGG - Intronic
942248499 2:174028155-174028177 AGGACACAGACCATATGCCACGG + Intergenic
944282608 2:197915030-197915052 GGGACATGGAGCTCTTCCCAAGG + Intronic
944947304 2:204703738-204703760 GGGACATGAAGCAGAATCCAAGG - Intronic
948315252 2:237023715-237023737 GGGACATGTGGCAGATGCCAGGG + Intergenic
948701053 2:239760603-239760625 GAGCCAGGGAGCATGTGCCATGG + Intergenic
948818361 2:240525499-240525521 GGGACCCTGAGCAGATGCCAAGG - Intronic
1173564431 20:44028891-44028913 GGCACATGGGGCAGATGTCATGG - Intronic
1173841073 20:46157687-46157709 GGGGCCTGGGGCATATGCCCAGG + Intergenic
1174482009 20:50837926-50837948 GGGCCAGGAAGCATATGCCAAGG - Intronic
1175739924 20:61413199-61413221 GGGAAAGGGAGCATGGGCCAGGG - Intronic
1175885680 20:62289139-62289161 GGGTCTTGGAGCATAGTCCATGG + Intronic
1176802007 21:13439539-13439561 GGGTCAAGGATCATCTGCCAGGG + Intergenic
1178305713 21:31488628-31488650 GGGCAAAAGAGCATATGCCAGGG + Intronic
1181968736 22:26674326-26674348 GGGGCAGGGAGCATACGCAAGGG + Intergenic
1182041543 22:27242170-27242192 GGGACATGCAGCCTTTCCCAGGG - Intergenic
1182476136 22:30577376-30577398 GGGAAATGGGGCAGTTGCCAAGG - Intronic
1183381677 22:37493346-37493368 GGGCCGTGGGGCACATGCCAGGG - Intronic
1184196996 22:42936497-42936519 GGGACATGAAGCATAGGCAAAGG + Intronic
949135107 3:554991-555013 GAGACATGGAGGAAAAGCCAGGG - Intergenic
950262752 3:11554348-11554370 GGAACATGGAGCAGGTGCCCAGG + Intronic
953598174 3:44337557-44337579 GGGGCATGGAGCAGATGGCAAGG + Intergenic
965543983 3:169896914-169896936 GGGACCTGGGGCATATGGGAAGG + Intergenic
965794703 3:172427867-172427889 GGGCCTTGGAGGCTATGCCAGGG - Intergenic
966815774 3:183888650-183888672 GGGACTTGGAGAACATGCCGTGG - Intergenic
968788743 4:2644306-2644328 GGGACAAGGAACACATGACAGGG + Intronic
971455560 4:26840802-26840824 GGGATAACGAGCATGTGCCAGGG + Intergenic
971658736 4:29384660-29384682 GTGACATAGAGCAAGTGCCATGG - Intergenic
974909259 4:68096522-68096544 GGGAAAAAGAACATATGCCATGG - Intronic
978735241 4:112077214-112077236 GAAAAATGGAGCATGTGCCAGGG - Intergenic
983133967 4:164056801-164056823 GGACAATGGAGCAAATGCCAAGG + Intronic
984585949 4:181564492-181564514 TGGACATGGGGCTTATTCCATGG - Intergenic
988872443 5:35406030-35406052 GGACCATGGAGCATGTGTCAGGG + Intergenic
989031827 5:37127155-37127177 GGTACATGGAGTAAATTCCAGGG - Intronic
989700443 5:44257847-44257869 GGGAAATCGAACATATGCCAAGG + Intergenic
998355133 5:141529083-141529105 GCGGCAAGGAGCATATGCCCAGG + Intronic
1002608993 5:180401584-180401606 GAGACATGGAGCAGGAGCCATGG + Intergenic
1004390895 6:15208961-15208983 GGGAGATGGAGGATTTGCCTCGG - Intergenic
1007114955 6:39336732-39336754 GGGAGATGGAGCTTCTGCAAAGG - Intronic
1007575564 6:42923366-42923388 GGGACAGGGAGCATCCGCAAGGG - Intronic
1007837871 6:44689398-44689420 GAAATATGGAGCATATGGCAGGG - Intergenic
1008663810 6:53696674-53696696 GGGCAATGGAGCATGTGCCAGGG + Intergenic
1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG + Intergenic
1013172414 6:107648665-107648687 GGGAGATGGAACATAGGCTAGGG + Intronic
1016344876 6:143102592-143102614 GGGTCATAGAACATATCCCAGGG + Intronic
1016803340 6:148188721-148188743 GTGAGATGAAGTATATGCCAAGG - Intergenic
1017125484 6:151060523-151060545 GAGCCAGGGAGCAGATGCCATGG + Intronic
1017541345 6:155406044-155406066 GGCAACTGGAGCATGTGCCAAGG - Intronic
1017713444 6:157190431-157190453 GAAACAGGGAGCATGTGCCAGGG - Intronic
1019150180 6:170000471-170000493 GGGACATGGGGCATTCGACATGG - Intergenic
1019280789 7:199020-199042 TGGACATGGAGCAGCTCCCATGG - Intronic
1019759137 7:2796177-2796199 GGGTCTTGGAACTTATGCCACGG - Intronic
1024201120 7:47106670-47106692 GGAACATGGAGCTAATGACAGGG - Intergenic
1028217422 7:88151563-88151585 GGCAGATGGAGCCCATGCCAGGG + Intronic
1028562535 7:92191530-92191552 TGGACATGGAACATACTCCAGGG - Intergenic
1029015907 7:97315365-97315387 TGGAAATGGAGCAGAGGCCATGG + Intergenic
1034244173 7:149632059-149632081 GAGCCATGGAGCATGTGGCAGGG + Intergenic
1035328701 7:158082713-158082735 TGGACATGGTGCATTTTCCAAGG - Intronic
1037740406 8:21604444-21604466 GGAACTTGGAGAATATGCCTGGG + Intergenic
1038307406 8:26417215-26417237 GGGACATGTGGCAGATGTCAAGG - Intronic
1042937614 8:74076275-74076297 GGGACATCCATCAAATGCCAAGG + Intergenic
1043865641 8:85372158-85372180 GGACGATGGACCATATGCCATGG + Intronic
1045000203 8:97871619-97871641 GGGAGGCTGAGCATATGCCAAGG + Intronic
1046514311 8:115238991-115239013 GGCAGATGCAGCAGATGCCAAGG - Intergenic
1047080253 8:121452540-121452562 AGGACAAGGAGCATAAGCCAGGG + Intergenic
1049172365 8:141169500-141169522 GGGACGTGGGACAAATGCCAGGG + Intronic
1049658626 8:143809851-143809873 GGGACAGGGAGCAGCTGCGAGGG - Intronic
1050280672 9:4046939-4046961 GAGACTTTGAGCATCTGCCAGGG - Intronic
1051368221 9:16336228-16336250 GGGACAAGGAGCAGATGGCTTGG - Intergenic
1056426639 9:86484129-86484151 GAGACATGGAGCACATGCCAAGG - Intergenic
1059107383 9:111523543-111523565 GGGTAAAGGAGAATATGCCATGG + Intergenic
1061037978 9:128123980-128124002 GGGATTTGGAGTAGATGCCAGGG + Intronic
1061904401 9:133689262-133689284 GGGACATGGAGGATATCAAAGGG - Intronic
1186949557 X:14608333-14608355 AGGACATTTAGCATATGCCTAGG - Intronic
1187228125 X:17393928-17393950 GGGAAACTGAGCCTATGCCAGGG - Intronic
1190639416 X:52468221-52468243 TGGAAATTGACCATATGCCAGGG - Intergenic
1194655417 X:96567685-96567707 GGGACATAGAACAAAAGCCAGGG - Intergenic
1200095430 X:153657441-153657463 TGGACATGGAGGCTATGCCAAGG - Intergenic
1200119121 X:153782103-153782125 CGGACCTGGAGCAAAAGCCAAGG - Exonic
1200276343 X:154736672-154736694 GGGGCAGGGAGAATAAGCCAGGG + Intronic