ID: 1160616299

View in Genome Browser
Species Human (GRCh38)
Location 18:80132184-80132206
Sequence CCCTTTAAGTATGAAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160616299_1160616302 28 Left 1160616299 18:80132184-80132206 CCTCAGATTTCATACTTAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1160616302 18:80132235-80132257 ATAGTCTGTCCTCTGTATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 142
1160616299_1160616303 29 Left 1160616299 18:80132184-80132206 CCTCAGATTTCATACTTAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1160616303 18:80132236-80132258 TAGTCTGTCCTCTGTATCCAGGG 0: 1
1: 1
2: 16
3: 111
4: 513
1160616299_1160616304 30 Left 1160616299 18:80132184-80132206 CCTCAGATTTCATACTTAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1160616304 18:80132237-80132259 AGTCTGTCCTCTGTATCCAGGGG 0: 1
1: 0
2: 13
3: 91
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160616299 Original CRISPR CCCTTTAAGTATGAAATCTG AGG (reversed) Intronic
900662094 1:3789870-3789892 CCCTTCATGTGTGAAATCTCTGG - Intronic
902365934 1:15974472-15974494 CCATTTAAGAATCAGATCTGTGG - Intronic
906717890 1:47984007-47984029 CCCTTTTAGAATGATATCAGCGG - Intronic
909241257 1:73216806-73216828 GACTGTAAGTATGAAATCTTGGG - Intergenic
910908097 1:92203507-92203529 TCTCTTAAGTATGAATTCTGTGG - Intergenic
912395107 1:109336505-109336527 CACTTTAAATATGATATTTGAGG + Intronic
915052975 1:153095519-153095541 CACTTAAAGTCTGAAATCTAGGG + Intronic
915054592 1:153114549-153114571 CACCTAAAGTCTGAAATCTGGGG + Intergenic
916416902 1:164600755-164600777 CACTTTAGGGATGAAGTCTGTGG - Intronic
916751550 1:167727446-167727468 CCCTTTTAAAATGACATCTGTGG - Intronic
917539979 1:175902584-175902606 CCATTTCACTATGAAATCTTGGG + Intergenic
918620595 1:186600019-186600041 CCCATTTAGTATAATATCTGTGG + Intergenic
919645684 1:200092386-200092408 CCATTTAAGTATGTGGTCTGCGG + Intronic
920234037 1:204491085-204491107 TCCATTAAGAATGAATTCTGAGG + Intronic
921693112 1:218176176-218176198 CCCTCTATGTCTAAAATCTGTGG - Intergenic
923241584 1:232090274-232090296 CCCTTTAAGGATTCAATCTCTGG - Intergenic
924381272 1:243467041-243467063 CCCTTAAAGTTGGAAACCTGGGG + Intronic
1065785468 10:29209137-29209159 CATTTTAAGTATGTAAACTGGGG - Intergenic
1066554775 10:36600089-36600111 CCCTCTAAGAAGGAAATGTGAGG + Intergenic
1068682890 10:59839173-59839195 CCCTTTACGTGTGAAATTTCAGG - Intronic
1068950903 10:62776300-62776322 CCCTGTAGGTATGAAACCTTGGG - Intergenic
1069105983 10:64384029-64384051 CCCATTAGGTATCAAATGTGTGG + Intergenic
1070515421 10:77201061-77201083 GCCTGAAAGTATGAATTCTGGGG + Intronic
1071097031 10:81988331-81988353 CTCTGTAAGTAAGAAATGTGAGG + Intronic
1080734833 11:35003413-35003435 CCCTTTAAATAAGAACACTGAGG - Intronic
1080846286 11:36029951-36029973 CAGTGTAAATATGAAATCTGTGG + Intronic
1082799624 11:57405034-57405056 CCATTTAAATATGAAATATCGGG - Intronic
1089476553 11:118767932-118767954 CCCTATAGGTAGGAAAGCTGAGG - Intronic
1092589467 12:9937704-9937726 CACTTAATGTATGAAATTTGGGG - Intergenic
1093043456 12:14413158-14413180 ACCATTAAGTATGATAGCTGTGG + Intronic
1094229020 12:28081459-28081481 CCCTTTCAGTATAAAAGCAGGGG - Intergenic
1095224406 12:39662737-39662759 CCCATTCAGTATGATACCTGTGG + Intronic
1095396536 12:41768549-41768571 CCCGTCAGGTATGAAATCAGAGG + Intergenic
1100450234 12:94698920-94698942 CCCTTTATATATAAAATCTGTGG + Intergenic
1100541300 12:95560160-95560182 GCCTTTACGTATGAATTTTGAGG - Intergenic
1101250504 12:102929569-102929591 CCCTTGAAGTGTGTAATCAGAGG + Intronic
1102627754 12:114249541-114249563 CCCTATAAGCCAGAAATCTGAGG - Intergenic
1105342926 13:19544779-19544801 CCTATTAAGTATGATAGCTGGGG - Intergenic
1105542757 13:21328941-21328963 ACCTGTCAGTGTGAAATCTGGGG + Intergenic
1106722574 13:32451014-32451036 CCCTTTAAGTATCACATTTTAGG - Intronic
1107807295 13:44165480-44165502 ACCTCTAATTAGGAAATCTGAGG - Intergenic
1108020122 13:46119828-46119850 ACTTTTAAGTGTTAAATCTGAGG - Intergenic
1108029411 13:46213341-46213363 CCCTTTGAGTACCAATTCTGGGG - Intronic
1109915482 13:68980065-68980087 CCCATTAAGGATGATAGCTGTGG + Intergenic
1110105576 13:71671533-71671555 CCTTCTAATTATGAAATATGTGG - Intronic
1110690616 13:78426999-78427021 CCCTTAAAGAATCAAATATGAGG - Intergenic
1111409280 13:87853425-87853447 CCCTTATAGTAGGAAATGTGAGG - Intergenic
1115029728 14:28780974-28780996 CCATTTCAGTCTGAAATTTGTGG + Intronic
1115559742 14:34572513-34572535 CCCTTTAACTTTGAATTCTTAGG - Intronic
1116299377 14:43158178-43158200 ACATTTAAATATTAAATCTGTGG + Intergenic
1116724737 14:48548489-48548511 CCCATTCAGTATGATATTTGTGG - Intergenic
1117055653 14:51909689-51909711 CCCCTTGAGTATGAATACTGAGG + Intronic
1119127074 14:72137426-72137448 CCCTTTACCTGTGAGATCTGAGG - Intronic
1119888888 14:78167740-78167762 GCCTTTTATCATGAAATCTGTGG - Intergenic
1120362280 14:83519945-83519967 GCTTTTAAGTATGAACTCTTTGG - Intergenic
1122230679 14:100305201-100305223 GGCCTTAAGTATTAAATCTGTGG - Intronic
1123493842 15:20803402-20803424 CACTTTGAGTATGAAATCATAGG - Intergenic
1123550340 15:21372484-21372506 CACTTTGAGTATGAAATCATAGG - Intergenic
1124528871 15:30485382-30485404 ATGTTTAAGTATTAAATCTGAGG - Intergenic
1124769786 15:32522304-32522326 ATGTTTAAGTATTAAATCTGAGG + Intergenic
1126249993 15:46556098-46556120 CACATTAAGAATGAAATATGAGG - Intergenic
1129773374 15:78217022-78217044 CCCTTTATCTGTGATATCTGAGG - Intronic
1130035175 15:80353425-80353447 AGCATTAAGTATGATATCTGTGG - Intronic
1130379980 15:83363190-83363212 CCCTTTAATTATAAAATATCTGG + Intergenic
1131129971 15:89892369-89892391 CCCTTTAAATAAGTAAACTGGGG + Intronic
1131196678 15:90360951-90360973 CCTTTTAAGTGCGAAAACTGTGG + Exonic
1202958683 15_KI270727v1_random:99738-99760 CACTTTGAGTATGAAATCATAGG - Intergenic
1135736865 16:24938845-24938867 CCCTACAAGACTGAAATCTGGGG + Intronic
1136564250 16:31060745-31060767 CCCTTCTAGTTTCAAATCTGTGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137806690 16:51313191-51313213 CCCTTTATGTAATCAATCTGTGG - Intergenic
1137908216 16:52348264-52348286 ACCATTAAGTATGATAACTGTGG - Intergenic
1139552498 16:67682549-67682571 AGCTTTAAGGATGAAATCGGAGG + Intronic
1140632108 16:76865649-76865671 TGCTGGAAGTATGAAATCTGTGG - Intergenic
1142108927 16:88321017-88321039 GCCTTTCAGTATGAAATGTTGGG + Intergenic
1144106129 17:11987214-11987236 TCCTTTAAGTCTGAAAACAGGGG + Intronic
1144601825 17:16622613-16622635 CCCTATAAGTGTGATGTCTGTGG - Exonic
1148657538 17:49298894-49298916 CCCTTTATCTGTGAAATCTGTGG - Exonic
1151785690 17:76273853-76273875 CCCTTGAAGAATGGAAGCTGAGG + Intergenic
1152453157 17:80396516-80396538 CACTTTATGTATCAAATCAGAGG - Exonic
1153968707 18:10204978-10205000 CCCTTTCAGTAGGAATTGTGGGG - Intergenic
1156075501 18:33273817-33273839 TGCTTTAAGTATCATATCTGAGG - Intronic
1160354331 18:78214333-78214355 CCCTTTGGGAATGAAAACTGTGG + Intergenic
1160616299 18:80132184-80132206 CCCTTTAAGTATGAAATCTGAGG - Intronic
1164174275 19:22755353-22755375 CCCTACAAATATGAAAACTGTGG - Intergenic
1165297932 19:34943489-34943511 CCCTATAAATATGAAAAATGTGG + Exonic
1167616686 19:50538366-50538388 CCCTTTAAGGAAGAAAACGGTGG - Intronic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
927951242 2:27171012-27171034 CCTTTTAAGTAGGGAATCTGAGG + Intergenic
931579813 2:63760414-63760436 TCCTTTCAACATGAAATCTGTGG + Intronic
932596642 2:73097713-73097735 CCCTTTAAGCCTGACATCTCTGG - Intronic
935080783 2:99791633-99791655 CACTGTGAGTATGAAATTTGGGG - Intronic
935395861 2:102607913-102607935 CCCTTTGTGTAAGAAAACTGAGG + Intergenic
935601583 2:104927630-104927652 ACCTGTAAGTCTGAAAGCTGGGG + Intergenic
936244291 2:110813267-110813289 CCCTTTAAGTAAGTCATCAGAGG + Intronic
936412183 2:112270256-112270278 CCCATTTAGGATGATATCTGGGG - Intergenic
939389563 2:141548903-141548925 CCCCTGAAGTATGAAATATCTGG + Intronic
939693747 2:145298011-145298033 CCCTGTAAGCATGGAATTTGAGG - Intergenic
941893202 2:170603521-170603543 TCCTTCATCTATGAAATCTGGGG - Intronic
941969431 2:171333396-171333418 GCCTTTAAGAATATAATCTGAGG - Intronic
942626676 2:177908554-177908576 CCCATCAGGTATGAAATGTGAGG + Intronic
944292413 2:198022264-198022286 CCCATTCAGTATGATATCAGTGG - Intronic
944499260 2:200341610-200341632 CCCTTTCATTGTGAAACCTGAGG - Intronic
945206445 2:207337733-207337755 CCCTTTAGATAAGAAATCAGAGG + Intergenic
945546429 2:211158424-211158446 GCCTTTAGGTATGGAACCTGAGG + Intergenic
947443781 2:230147524-230147546 GCCTTTAACTAGGAGATCTGTGG - Intergenic
1169411328 20:5372793-5372815 GCATTTGAGTTTGAAATCTGTGG - Intergenic
1173387372 20:42601207-42601229 CCCTTTCAGAATGAAATTTGAGG + Intronic
1173655213 20:44695565-44695587 CCTTTCAGGTTTGAAATCTGTGG + Intergenic
1174654625 20:52160344-52160366 CCCCATAAGTGTGAAGTCTGTGG - Exonic
1178311026 21:31530172-31530194 CCTTTTCAGTATGAATTCAGAGG - Intronic
1180588350 22:16914033-16914055 GCCTTAACATATGAAATCTGAGG + Intergenic
949717627 3:6951353-6951375 ATCTTTTAGTGTGAAATCTGGGG + Intronic
950641208 3:14349688-14349710 CTCTTTAAGTTTACAATCTGAGG - Intergenic
954479615 3:50786680-50786702 CCCTTTATCTGTGAAATCTGTGG - Intronic
958108783 3:89113093-89113115 CCCTTTATTTAAAAAATCTGTGG - Intronic
959765239 3:110018969-110018991 CCTTTCAAGTATGAAATATGGGG - Intergenic
960642546 3:119840838-119840860 CTCTTTCAGTACCAAATCTGAGG + Intronic
963322207 3:143821220-143821242 CCCTTGGAGTAAGAAGTCTGAGG - Intronic
963902393 3:150745278-150745300 TGCTTGAAGTATGAAATGTGGGG - Intronic
964107140 3:153051387-153051409 CCCTTTACAAATGAAAACTGAGG - Intergenic
965747544 3:171940842-171940864 CCCTGTTAGGATGAAAACTGTGG - Intergenic
966061104 3:175757081-175757103 CCCTTTAAGAATGAAAGTTCTGG + Intronic
966503978 3:180678774-180678796 CCCGGTAAGAATGAAATGTGCGG - Intronic
972763030 4:42125433-42125455 GCCTGTAAGTATGTAATTTGTGG - Intronic
976616885 4:87087068-87087090 GCCTGTAAGTAGAAAATCTGAGG - Intronic
977662709 4:99609388-99609410 CCATTTAAGTTTAAAATCTTAGG + Intronic
978223964 4:106311756-106311778 TCTTTTAATTATGAAATATGTGG - Intronic
978270800 4:106887665-106887687 TCCTTTAAATATGAGATCAGTGG + Intergenic
978754120 4:112285094-112285116 ACCTTTCAATCTGAAATCTGGGG + Intronic
980214604 4:129835387-129835409 CCTTTTAAGTCTGAGATCTGGGG + Intergenic
981699158 4:147589686-147589708 CCCTTTTAGTATAAAAACAGAGG - Intergenic
982390803 4:154862197-154862219 ACATTTCAGTGTGAAATCTGGGG + Intergenic
982758602 4:159253437-159253459 CCCTTTCTTTATGAGATCTGTGG - Intronic
983061396 4:163165744-163165766 TCTTTTAAATATGAAATCTCTGG - Intronic
984056070 4:174930587-174930609 CCTTTTAAACATAAAATCTGAGG - Intronic
986121592 5:4842626-4842648 CTCTTTAATTAGAAAATCTGTGG + Intergenic
996020002 5:118580300-118580322 TCCTGTAAGTATGTGATCTGTGG - Intergenic
996948795 5:129100274-129100296 TCTTTTGAGTATGAAATCTAAGG + Intronic
997139046 5:131359544-131359566 GCCTGTAAGTATGAAGTATGTGG + Exonic
1003409246 6:5848880-5848902 ACCTGTCAGTGTGAAATCTGGGG - Intergenic
1006768334 6:36529320-36529342 CCCTAAAATTATTAAATCTGAGG + Intronic
1007987477 6:46221478-46221500 CCTTTTAAAAATAAAATCTGAGG - Exonic
1008256643 6:49309823-49309845 CTCTTTTACTATGAATTCTGTGG - Intergenic
1009447520 6:63760823-63760845 GCCTTTAAGCATCAAAACTGTGG + Intronic
1010641279 6:78331124-78331146 CTCTTTCATTATGACATCTGTGG + Intergenic
1010823951 6:80450442-80450464 CCCCTAAAGTATATAATCTGGGG - Intergenic
1011776959 6:90741362-90741384 ACGTTTAAGTATGCTATCTGTGG + Intergenic
1012671579 6:102055270-102055292 ACCTTTAATTATGAAATTTCAGG + Intronic
1013370610 6:109467704-109467726 CCATTTACTTGTGAAATCTGTGG - Exonic
1016135663 6:140538830-140538852 CCCTTTATGTAAGAACTCTGTGG + Intergenic
1017960159 6:159214733-159214755 ACCTTTTGGTATGAAATGTGGGG + Intronic
1021384378 7:20009910-20009932 CCCATCATGTATAAAATCTGTGG - Intergenic
1022446675 7:30476788-30476810 GGCTTTAAGTCTGAAATCTTAGG - Intronic
1025241048 7:57274876-57274898 CCCTATAAGTGTGAAAAATGTGG + Intergenic
1027945532 7:84740542-84740564 CTCATTAAATATGAAAACTGTGG + Intergenic
1029138339 7:98391150-98391172 CAGTTTAAGCAGGAAATCTGGGG + Intronic
1029779167 7:102713362-102713384 CCCTGTAAGTGTGAAGTGTGTGG - Intergenic
1030946579 7:115729672-115729694 CCCTATAGGTAGGAAATCAGTGG - Intergenic
1031889702 7:127279789-127279811 ACCTTTAAATATGACATCTCTGG + Intergenic
1033974151 7:147079223-147079245 CCCATTTAGTAGGAAAACTGAGG + Intronic
1035600749 8:895581-895603 CCCTTTAACGATGAAATGTTTGG + Intergenic
1036935369 8:12997094-12997116 CCCTTTTAATATGATATTTGTGG + Intronic
1038380625 8:27089775-27089797 CTCTGTAAGTCTGAAATCTTGGG + Intergenic
1038440984 8:27570751-27570773 ACCTTAAAGTATTGAATCTGAGG + Intergenic
1040045023 8:42953716-42953738 CACTTTAAGTATAAATTCAGAGG - Intronic
1041087255 8:54268388-54268410 CCCTTTCAGGATGAGATATGGGG + Intergenic
1041479985 8:58309097-58309119 CCTTTCAAGTATGAAATATGCGG + Intergenic
1041560036 8:59206962-59206984 CCCTGTAAGTATCAGTTCTGAGG - Intergenic
1041703482 8:60818331-60818353 CCCTTTAAGTGAGTAATCTGCGG - Intronic
1043547998 8:81336794-81336816 CCCTTTAAGTATGATATCAATGG + Intergenic
1044420906 8:91994790-91994812 TCCTTTAAAAATGAAATCTTAGG - Intronic
1045721985 8:105123283-105123305 TCCTTTAAGTTTGAAATTTTAGG + Intronic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1046854077 8:119009183-119009205 CCCCTTAAGGATGAATTTTGTGG + Intronic
1048994384 8:139784028-139784050 ACCCTTAAGTATGATGTCTGTGG - Intronic
1050333388 9:4567903-4567925 CCCCTTAAGTATGGATTTTGGGG - Intronic
1050446125 9:5724668-5724690 CCCATTCAGTATGATATTTGTGG + Intronic
1050803752 9:9647906-9647928 CAATTAAAGTATGAGATCTGGGG - Intronic
1051480773 9:17557449-17557471 CCCCTTATTCATGAAATCTGAGG - Intergenic
1051883756 9:21868392-21868414 CCATTTAAGTATTACATATGTGG - Intronic
1053073329 9:35113946-35113968 CCCTTTCACTGTGACATCTGGGG + Intronic
1059187316 9:112286187-112286209 CATTTTAAATATGAAATCTCAGG - Intronic
1060435987 9:123593622-123593644 CCCTGTAAGTATGACTTCTTGGG + Intronic
1187349130 X:18495808-18495830 TCCTTTAGGTAGGAGATCTGGGG - Intronic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1190406401 X:50091990-50092012 CCCTTTCAGTATGAGATCACAGG - Intronic
1192131545 X:68556632-68556654 ACTTTACAGTATGAAATCTGTGG - Intergenic
1195430563 X:104784681-104784703 CTCTTTAAGTATGTATGCTGGGG + Intronic
1195651386 X:107288691-107288713 CACTTCAACTATGAAATCTAGGG + Intergenic
1196494599 X:116309588-116309610 CCCTCTAACTGTGAAATCTAGGG + Intergenic
1197360765 X:125500442-125500464 CCCATTCAGTATGATACCTGTGG + Intergenic
1200760729 Y:7036551-7036573 CCCTTGCACTTTGAAATCTGGGG + Intronic
1202589428 Y:26466904-26466926 CCTCTTAAGTATGATAGCTGGGG + Intergenic