ID: 1160620767

View in Genome Browser
Species Human (GRCh38)
Location 18:80169100-80169122
Sequence GCTCCGGTCACTCAGGAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160620760_1160620767 26 Left 1160620760 18:80169051-80169073 CCAACTGCACTCTGGGGAAGGGA 0: 1
1: 0
2: 0
3: 21
4: 238
Right 1160620767 18:80169100-80169122 GCTCCGGTCACTCAGGAAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160620767 Original CRISPR GCTCCGGTCACTCAGGAAGG TGG Exonic
900118042 1:1036860-1036882 GCTCCTGAGTCTCAGGAAGGGGG - Intronic
900539882 1:3197329-3197351 GCTGGGGGCACACAGGAAGGAGG - Intronic
901274835 1:7983269-7983291 GCACCGGCCACGCAGGCAGGCGG - Intronic
903561063 1:24228042-24228064 GCTAAGGTCATTCATGAAGGTGG - Intergenic
904379640 1:30102104-30102126 GCTCCAGTCCCTCAGGCAGGTGG + Intergenic
905144033 1:35872678-35872700 TCTCGGGTGACTGAGGAAGGAGG - Intronic
905677765 1:39840814-39840836 GCTCAGGTCACTCCAGAAAGAGG + Intergenic
905834174 1:41102800-41102822 GCTTAGGCCACTCAGAAAGGTGG + Intronic
906203111 1:43972415-43972437 GCTCCGGGAACTAAGGAATGAGG - Exonic
908398351 1:63746771-63746793 GCTGAGGTCACACAGTAAGGAGG + Intergenic
912799888 1:112714251-112714273 GCTCAGTTCGCTGAGGAAGGTGG - Intronic
913209543 1:116571185-116571207 GCCCCGGGGACACAGGAAGGAGG - Intergenic
914322221 1:146576246-146576268 GCTCCTGGCACTCAGGAGAGAGG - Intergenic
914737860 1:150435776-150435798 GCTAGGATCACTCATGAAGGTGG + Intronic
923311268 1:232737698-232737720 GCTGCGACCACACAGGAAGGCGG - Intergenic
1063002307 10:1936010-1936032 GCTCAGGTCACACAGCAAGTAGG - Intergenic
1063015902 10:2076680-2076702 GCTCCGGGCACCTGGGAAGGTGG - Intergenic
1069559027 10:69416687-69416709 GCCCAGGTCACTCAGGAAGTTGG + Exonic
1069824525 10:71246942-71246964 GCTCTGGTCACACAGGGAGTGGG - Intronic
1072549305 10:96465335-96465357 GCTCCAGTCAATCAGTGAGGTGG - Intronic
1075744595 10:124717963-124717985 GCTCCAGTCACTCAGCAGGCAGG + Intronic
1077082425 11:730002-730024 GCACCCGTTACCCAGGAAGGTGG + Intergenic
1077244057 11:1527409-1527431 GCTCCAGCCACTCAGAAAGGAGG + Intergenic
1078360283 11:10662701-10662723 GCTCTGCTCTGTCAGGAAGGAGG - Intronic
1079714712 11:23730893-23730915 GCTCAGGTCACTCAGGATCCTGG - Intergenic
1083932829 11:65855247-65855269 CCTCCGGTCTGGCAGGAAGGGGG + Exonic
1085028833 11:73257637-73257659 GCTCCTGGACCTCAGGAAGGAGG + Intergenic
1086333264 11:85775244-85775266 GATACTGTCATTCAGGAAGGAGG - Intronic
1087152918 11:94874567-94874589 GCTTCTGTTACTCAGGAAGGAGG + Exonic
1087289028 11:96299645-96299667 GCTCCGGTGCCTCTGGAGGGAGG + Intronic
1089621733 11:119726591-119726613 GCTCCACCCACTCAGGAAGTGGG - Intronic
1091792573 12:3280296-3280318 CCTCAGGTCACCCAGGATGGTGG - Intronic
1096546569 12:52344202-52344224 GCACCTGCCATTCAGGAAGGAGG - Intergenic
1097062293 12:56294501-56294523 GCACTGATCACTCAGTAAGGAGG + Intronic
1104832290 12:131761578-131761600 GCCCCGATCACTCAGGGACGTGG + Intronic
1106987690 13:35373979-35374001 GCTCAGATCACTGATGAAGGAGG - Intronic
1108766117 13:53631446-53631468 AATCCTGGCACTCAGGAAGGTGG - Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1113825840 13:113252429-113252451 GCTCAGGACACTGAGGCAGGTGG + Intronic
1113878835 13:113611186-113611208 GCTCCGGGAACCCAGGAGGGTGG + Intronic
1113913798 13:113858033-113858055 GCTCCGGCCCCTCAGGCAGGGGG + Intronic
1115514948 14:34175822-34175844 GCACCCCTCACACAGGAAGGAGG + Intronic
1118959962 14:70520203-70520225 GCTAAGGTCACTGATGAAGGTGG + Intergenic
1121252341 14:92509325-92509347 GCTAAGATCACTGAGGAAGGCGG - Intergenic
1121835158 14:97085635-97085657 GCTCCTTTCATTCAGGATGGGGG + Intergenic
1122959863 14:105089469-105089491 GCGCTGGGCACTCAGGATGGGGG + Intergenic
1123908823 15:24946585-24946607 GCTCCAGCCACTCAGGAAGTTGG - Intronic
1124701716 15:31919458-31919480 ACTCAGGTCACTGAGGCAGGAGG - Intergenic
1127457308 15:59166935-59166957 GCTCCTCTCATTCTGGAAGGGGG - Intronic
1127930831 15:63596291-63596313 GCCTCGGGTACTCAGGAAGGGGG + Intergenic
1128495945 15:68198491-68198513 GGGCTGGACACTCAGGAAGGAGG - Intronic
1128521710 15:68379627-68379649 GCCCAGCTCTCTCAGGAAGGTGG + Intronic
1133192774 16:4146735-4146757 GCTCCTGTCACCCAGGCTGGAGG + Intergenic
1133420627 16:5643336-5643358 CCTCTGGGCACCCAGGAAGGTGG + Intergenic
1133839154 16:9393315-9393337 GCTCCAGTCATTCAGGAAGCTGG - Intergenic
1135205165 16:20477454-20477476 GCTCGGGACACTGAGGAGGGAGG + Intronic
1135213734 16:20546367-20546389 GCTCGGGACACTGAGGAGGGAGG - Intronic
1137789808 16:51165550-51165572 GCTCCTGGCTCTCAGGAAGGTGG - Intergenic
1139329610 16:66177060-66177082 GCTCCGGTTCCTAAGGAAGCAGG + Intergenic
1140011405 16:71134922-71134944 GCTCCTGGCACTCAGGAGAGAGG + Intronic
1141358176 16:83369386-83369408 TCTCTGGTCACTCTGAAAGGAGG - Intronic
1141501732 16:84449371-84449393 GCTCCCCTCACTCGGGAAGAGGG - Intronic
1142343120 16:89536920-89536942 GCTCAAGTCACTCAAAAAGGTGG - Intronic
1142662335 17:1439732-1439754 ACTCAGGACACTCAGGTAGGGGG + Intronic
1142933195 17:3306055-3306077 GCTCTGGATACTCAAGAAGGTGG + Intergenic
1143220163 17:5255002-5255024 GCCCCGCTCACTCAGCAAAGGGG + Intergenic
1144999034 17:19290579-19290601 GCTCCGCAGACTCAGCAAGGGGG - Intronic
1147231173 17:39019261-39019283 GCTCAGATCACTGATGAAGGTGG + Intergenic
1147669235 17:42167219-42167241 GCTCAGGGCACTCAGGTAGTAGG - Intronic
1151783413 17:76262797-76262819 CCTAAGGTCACTCAGGAAGAAGG - Intergenic
1153976983 18:10277922-10277944 GCTAAGGTCACTGATGAAGGTGG - Intergenic
1157280740 18:46344950-46344972 GCTCATGTCCCTCAGGACGGAGG + Intronic
1160620767 18:80169100-80169122 GCTCCGGTCACTCAGGAAGGTGG + Exonic
1160921810 19:1524185-1524207 GCCCGGGTCTCGCAGGAAGGCGG - Intronic
1161453754 19:4360305-4360327 GAGCCGGCCCCTCAGGAAGGCGG + Intergenic
1162011730 19:7820580-7820602 GCTCTGCTCCCTCTGGAAGGAGG - Intergenic
1165218868 19:34298303-34298325 GCTCCGGAGACTGAGGCAGGAGG + Intronic
1165368745 19:35388610-35388632 GCTTCAGTCACTGAGCAAGGAGG - Intergenic
1167921623 19:52787112-52787134 TCTCCATTCACTCAGGAGGGAGG + Intronic
1168185786 19:54698562-54698584 GCTCTGGACACTAAGGAAAGAGG + Intronic
926429056 2:12767370-12767392 GCTGGGGTCACTCAGGTAGTGGG + Intergenic
927520045 2:23693108-23693130 CCTCCAGACACCCAGGAAGGGGG + Intronic
929737386 2:44564575-44564597 GCTCTTGTCACCCAGGAAGCTGG + Intronic
930022420 2:47009392-47009414 TGTGCGGTCACTCAGGAAAGGGG - Intronic
931375199 2:61701010-61701032 GCTCTTGTCACCCAGGATGGAGG + Intergenic
933858426 2:86441414-86441436 CCGCCGGTGACTCAGGGAGGCGG + Exonic
935781055 2:106509639-106509661 GCTCCGGCCACCCAGGGAGCTGG + Intergenic
942560560 2:177213687-177213709 GCTCCGGCCGCTGAGGAGGGTGG + Intronic
1169310647 20:4536031-4536053 CTTCCTGTCATTCAGGAAGGAGG - Intergenic
1170669236 20:18415400-18415422 CCTCCGCCCACTCAGAAAGGGGG - Exonic
1170819252 20:19742409-19742431 GCTCTGCTCACTAAGGAAAGAGG - Intergenic
1170937555 20:20823284-20823306 GATCCCTTCACTCTGGAAGGGGG - Intergenic
1172537485 20:35685255-35685277 GTTCCAGCTACTCAGGAAGGAGG + Intronic
1173502076 20:43561287-43561309 GCTGAGGGCAGTCAGGAAGGAGG + Intronic
1173731879 20:45334925-45334947 GCTCAGTTCACACAGGATGGAGG + Intronic
1174207546 20:48851704-48851726 GTTCAGGTCCTTCAGGAAGGCGG - Intergenic
1175427915 20:58881638-58881660 GCAGCAGTCACCCAGGAAGGTGG - Intronic
1176686753 21:9855610-9855632 GCCCAGATCAGTCAGGAAGGTGG - Intergenic
1178799709 21:35781129-35781151 GCTCAGGTGCCTGAGGAAGGTGG + Intronic
1181542446 22:23580527-23580549 GCTGAGGTCACACAGGGAGGTGG + Intergenic
1182423040 22:30257738-30257760 GCCTGGGTCACTCAGGCAGGCGG - Intergenic
1182451264 22:30423346-30423368 GCTCAGGTCAGTCAGGAAGCGGG - Exonic
1185115854 22:48937436-48937458 GCTCCGGTCACACAGCAGGACGG - Intergenic
949247413 3:1941677-1941699 GCTCCGGTGACAGAGGGAGGAGG + Intergenic
949621561 3:5818554-5818576 GCACCAGTCTCTCAGAAAGGAGG - Intergenic
950022119 3:9794559-9794581 GCTCAGGACACTGAGGCAGGAGG + Intronic
952402340 3:32974744-32974766 GCTCAAGTCAGTCAGGAAGGAGG + Intergenic
952651907 3:35737348-35737370 CCTCTGGTCACTCAGGTAGGGGG + Exonic
956031198 3:65039915-65039937 TCTGCAGACACTCAGGAAGGAGG + Intergenic
960673293 3:120172133-120172155 GCTTCGTTGACTCAGGAAGAAGG - Intronic
963986232 3:151597882-151597904 GCTCCTGTCACCCAGGCTGGAGG - Intergenic
969869307 4:10094800-10094822 GCTACGGTCCCTCAGGACGAGGG + Intronic
973319678 4:48797315-48797337 GGCCCAGACACTCAGGAAGGTGG + Intergenic
978206168 4:106083354-106083376 GCCCCGCCCACTGAGGAAGGTGG - Intronic
978545891 4:109872651-109872673 ACTCTGGTCCCACAGGAAGGTGG + Intergenic
980350143 4:131673760-131673782 GCCCAGATCAATCAGGAAGGTGG - Intergenic
980851868 4:138392965-138392987 GCTCCAGTAATTCAGGAGGGAGG + Intergenic
982063242 4:151625356-151625378 CCTTCTGTCACTCAGGCAGGTGG - Intronic
984727714 4:183037300-183037322 CCTGCAGGCACTCAGGAAGGAGG + Intergenic
987064741 5:14278373-14278395 GCTACGGTGACCCAGGAGGGAGG + Intronic
988488705 5:31689099-31689121 GCTCTTGTCACTCAGGCTGGAGG + Intronic
996464936 5:123789322-123789344 GCTCAGATCACTAATGAAGGTGG + Intergenic
996726905 5:126680487-126680509 CCTCCGGGCACTGTGGAAGGGGG - Intergenic
1000406195 5:160890825-160890847 GCTCCAGCTACTCAGGAAGCTGG - Intergenic
1002158575 5:177301849-177301871 GATCAGGTAACTCAGGAAAGGGG + Intronic
1002284246 5:178151719-178151741 GCTCCGGTCAGCCAGGAAGAAGG - Intronic
1002327022 5:178416357-178416379 GCTCCGGTCAGCCACGATGGAGG - Intronic
1002710396 5:181191602-181191624 GCTCTGGCCTCCCAGGAAGGCGG + Intergenic
1006651059 6:35551951-35551973 GCTCCGGACCCTGAGGCAGGAGG + Intergenic
1006807640 6:36798974-36798996 GGCCTGGTCACTCAAGAAGGAGG + Intronic
1007378017 6:41469532-41469554 TCTGCAGTCACTCAGGGAGGAGG + Intergenic
1010470787 6:76225938-76225960 GCTCAGGCCTCTAAGGAAGGCGG + Intergenic
1013414746 6:109914693-109914715 GCTAAGGTCACTGATGAAGGTGG + Intergenic
1016159595 6:140861934-140861956 GTCCCAGCCACTCAGGAAGGAGG + Intergenic
1016614341 6:146029031-146029053 GCTGTGGTCACTGAGGAAGGCGG - Intronic
1017068888 6:150554735-150554757 GCTCAGATCACTGATGAAGGTGG + Intergenic
1017317109 6:153044114-153044136 GCTCATTTCACTAAGGAAGGAGG + Intronic
1017612140 6:156199038-156199060 GCCCCGGCAACTCAGAAAGGGGG - Intergenic
1018271351 6:162081851-162081873 GCTACGGTCAATGATGAAGGTGG - Intronic
1018406732 6:163493162-163493184 GCTCTTGTCACTCAGGCTGGAGG + Intronic
1018949632 6:168370769-168370791 TCTCCGGCCACTCAGAGAGGAGG - Intergenic
1020090824 7:5339595-5339617 GCTCTTGTCACCCAGGATGGAGG + Intronic
1023659382 7:42456971-42456993 GCTCTGGGCACACAGAAAGGGGG + Intergenic
1024348709 7:48340222-48340244 GTTCCAGCCACTCAGGAGGGTGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028173624 7:87628486-87628508 GCTGAGGTCCCTCGGGAAGGAGG + Exonic
1028841580 7:95434870-95434892 GCTTCTGGCACTCAGGTAGGTGG - Exonic
1029126308 7:98297272-98297294 GCTCCGTACAGTCGGGAAGGGGG - Intronic
1031911104 7:127517549-127517571 GAGCTGGTCACTGAGGAAGGGGG + Intergenic
1035255977 7:157627769-157627791 GCTACGGGGACTCAGGAAGTGGG + Intronic
1035732566 8:1863183-1863205 ACACCTGCCACTCAGGAAGGTGG + Intronic
1038843080 8:31204365-31204387 GCTCCGGTGACACAGCAGGGAGG + Intergenic
1039176182 8:34809100-34809122 GCTGCTATCACACAGGAAGGAGG - Intergenic
1040058134 8:43079174-43079196 GCTCAGATCACTAATGAAGGTGG + Intronic
1045158296 8:99504924-99504946 GCTCAGTTCACTGATGAAGGTGG - Intronic
1047739589 8:127795831-127795853 GCTCTGATCAGTCAAGAAGGGGG + Intergenic
1048958243 8:139554584-139554606 GCTCCGGCCCCTCAAGAACGAGG - Intergenic
1049271182 8:141697099-141697121 GCTGCGGTCACTCACACAGGTGG + Intergenic
1052866598 9:33467925-33467947 GCTCAGATCATTCAGGGAGGAGG - Intronic
1053739509 9:41124761-41124783 GCTCTGTGCAGTCAGGAAGGCGG + Intergenic
1053782567 9:41625952-41625974 GCCCAGATCAGTCAGGAAGGTGG + Intergenic
1054170523 9:61836108-61836130 GCCCAGATCAGTCAGGAAGGTGG + Intergenic
1054667014 9:67744707-67744729 GCCCAGATCAGTCAGGAAGGTGG - Intergenic
1054688839 9:68306559-68306581 GCTCTGTGCAGTCAGGAAGGCGG - Intergenic
1054784808 9:69200494-69200516 GCTCAGGACACTGAGGCAGGAGG - Intronic
1055462214 9:76529785-76529807 GCTGCAGGCACCCAGGAAGGGGG - Intergenic
1056212748 9:84380339-84380361 GCTCCGGTCACCCAGGCTGGAGG - Intergenic
1057846975 9:98533343-98533365 GCCCGGGTGACTCAGGCAGGAGG + Intronic
1059457519 9:114408956-114408978 GCTCCGGTGTCTGAGGGAGGAGG - Intronic
1059744864 9:117190048-117190070 GTTCCAATCTCTCAGGAAGGAGG + Intronic
1060495030 9:124112214-124112236 ACTCTGGACTCTCAGGAAGGGGG + Intergenic
1062072609 9:134565660-134565682 GCTGTGGTCTCTCAGGAATGAGG + Intergenic
1062308274 9:135921707-135921729 GATCAGGTCACCCAGGAGGGTGG - Intergenic
1188777896 X:34244526-34244548 GCTCTGGTGACTGAGGCAGGAGG - Intergenic
1190017038 X:46836198-46836220 GTTCCAGCTACTCAGGAAGGAGG + Intergenic
1190183557 X:48215441-48215463 GCTAAGGTCACTGATGAAGGTGG - Intronic
1190204322 X:48390417-48390439 GCTAAGGTCACTGACGAAGGTGG - Intronic
1190206214 X:48404986-48405008 GCTAAGGTCACTGACGAAGGTGG + Intronic
1190210162 X:48440067-48440089 GCTAAGGTCACTGATGAAGGTGG - Intergenic
1200305565 X:155022943-155022965 GCTGCTGCCACTCAGGAAGAGGG - Intronic