ID: 1160621049

View in Genome Browser
Species Human (GRCh38)
Location 18:80170887-80170909
Sequence TCCCCAGCAAAACTGGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160621049_1160621060 25 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621060 18:80170935-80170957 ATTCCTGGCCCTGACCCAGGAGG 0: 1
1: 0
2: 5
3: 24
4: 252
1160621049_1160621055 -8 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621055 18:80170902-80170924 GCTGGGGAAGGCTGCAGGCAAGG 0: 1
1: 0
2: 9
3: 85
4: 710
1160621049_1160621056 -3 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621056 18:80170907-80170929 GGAAGGCTGCAGGCAAGGAGAGG 0: 1
1: 0
2: 7
3: 124
4: 733
1160621049_1160621059 22 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621059 18:80170932-80170954 GCTATTCCTGGCCCTGACCCAGG 0: 1
1: 0
2: 0
3: 29
4: 236
1160621049_1160621058 10 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621058 18:80170920-80170942 CAAGGAGAGGAGGCTATTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 237
1160621049_1160621057 0 Left 1160621049 18:80170887-80170909 CCTTTCCCCAGTTTTGCTGGGGA 0: 1
1: 0
2: 4
3: 20
4: 316
Right 1160621057 18:80170910-80170932 AGGCTGCAGGCAAGGAGAGGAGG 0: 1
1: 0
2: 13
3: 93
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160621049 Original CRISPR TCCCCAGCAAAACTGGGGAA AGG (reversed) Exonic
900768218 1:4519721-4519743 CCACCAGCAAAGCTGGGGAGTGG + Intergenic
901504570 1:9676465-9676487 ACCCCAGGCCAACTGGGGAAGGG - Intronic
901652980 1:10753654-10753676 TCCCCAGAAGGACCGGGGAAAGG + Intronic
902759234 1:18570212-18570234 GCACCAGGAAGACTGGGGAAAGG + Intergenic
903995563 1:27303475-27303497 TATCCTGGAAAACTGGGGAAAGG - Intronic
905092595 1:35441311-35441333 TCCTCAGCAATTCTGGAGAAGGG + Intronic
905413455 1:37788375-37788397 TCTCCAGCCATAGTGGGGAAAGG + Intergenic
905687346 1:39918027-39918049 TCTGCAGCCAACCTGGGGAAGGG + Intergenic
906190898 1:43898925-43898947 TCCCCAGGAAAACAGGGCCATGG - Intronic
906637288 1:47417610-47417632 TCACCAGGAAACCTGGGGTATGG - Exonic
906717280 1:47979587-47979609 GCCCCAGCAGAAGTGGGGGATGG - Intronic
906752916 1:48282503-48282525 ACCCCATCAAAAATGGGCAAAGG + Intergenic
906882015 1:49602016-49602038 ACCCCATCAAAAATGGGCAAAGG + Intronic
906883613 1:49620285-49620307 ACCCCATCAAAAATGGGCAAAGG + Intronic
907340391 1:53731277-53731299 CCCCCTGCAGAACTAGGGAAAGG - Intronic
907511514 1:54964765-54964787 ACCCCTGCAAACCTGGGGACAGG + Intergenic
908651050 1:66333662-66333684 ACCCCAGGAAAGCTGGAGAAGGG - Intronic
908887372 1:68804909-68804931 TCCATAGCAAACCAGGGGAACGG + Intergenic
909394652 1:75156105-75156127 TCCCCAGAAAAGGTGGGGAAGGG - Intronic
911170236 1:94763778-94763800 ACCCCATCAAAATTGGGCAAAGG + Intergenic
913193535 1:116433562-116433584 GCCCCAGGAGAACTGGGCAATGG - Intergenic
913280905 1:117184205-117184227 TGCACAGCAAAGCTGGGGCAGGG - Intronic
914922584 1:151857568-151857590 TCCAGAGGAAAACAGGGGAAGGG + Intergenic
916645352 1:166779387-166779409 ACCCCATCAAAAATGGGCAAAGG - Intergenic
917472366 1:175336736-175336758 ACCCCAGGAAGAATGGGGAAGGG + Intronic
919855098 1:201700254-201700276 ACCCCATCAAAAGTGGGCAAAGG + Intronic
920046541 1:203136407-203136429 TCCCCAGCAGAACTGCAGAGAGG + Intronic
920534995 1:206731561-206731583 TCCCCATGAAAACTGGGGAAAGG + Intronic
922042572 1:221911065-221911087 TCCACAGCAAACCTGGGACAAGG + Intergenic
922147554 1:222963093-222963115 ACCCCATCAAAATTGGGCAAAGG + Intronic
922772584 1:228195020-228195042 ACCCCAGCTAAGCTGGGAAAAGG - Intergenic
922971831 1:229748430-229748452 TTCCCAGCAACAGTGTGGAAGGG - Intergenic
1063372725 10:5532281-5532303 TCCTCAGCAGAACTGGGGTTGGG - Intergenic
1063790867 10:9445417-9445439 ACCCCAACAAAACTGGGCCATGG - Intergenic
1066599464 10:37089103-37089125 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1067375065 10:45720273-45720295 TCCCCAACCAATCTGGGGGAAGG + Intergenic
1067378664 10:45752248-45752270 TCCCCAACCAATCTGGGGGAAGG - Intronic
1067886361 10:50092928-50092950 TCCCCAACCAATCTGGGGGAAGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1070332950 10:75431201-75431223 TCCTCATCAAAGCTGGGGAGAGG - Intergenic
1070764535 10:79048746-79048768 TCAGCAGCAAAGCTGGGGAAAGG - Intergenic
1072387445 10:94945683-94945705 TCCCCATCAAAAATGGACAAAGG + Intronic
1072835314 10:98705073-98705095 ACCCCATAAAAACTGGGCAAAGG + Intronic
1073350430 10:102815779-102815801 TCCCCACTCTAACTGGGGAAAGG - Exonic
1074407965 10:113196523-113196545 TACCCAGCAAATCTGGGTAAAGG - Intergenic
1074493282 10:113957738-113957760 TGATCAGCAAAACTGGGAAAAGG + Intergenic
1074525545 10:114260272-114260294 TACCTTGCAAAACTGGAGAAAGG - Intronic
1074575850 10:114668385-114668407 TTCCCAGCCAAACTGAGGATGGG + Intronic
1075237670 10:120745754-120745776 TCCCCAGGAAAACTGAGGAGAGG - Intergenic
1075450304 10:122546637-122546659 TCCTAAGCAACACTGGGGAATGG + Intergenic
1075742602 10:124705061-124705083 TCCCCAGCACTACTGAGGCAGGG - Intronic
1079397993 11:20082557-20082579 ACGCAAGCAAAAATGGGGAAGGG - Intronic
1079685315 11:23352080-23352102 TGCCCAGCATAGCTGTGGAATGG + Intergenic
1079804837 11:24917156-24917178 ACCCCATCAAAATTGGGCAAAGG - Intronic
1079900245 11:26174093-26174115 ACCCCATCAAAAATGGGCAAAGG + Intergenic
1081592649 11:44435542-44435564 TCCCCAGCAGAAGTGGGAAGGGG - Intergenic
1082240964 11:49870212-49870234 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1082285411 11:50312499-50312521 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1082938969 11:58683887-58683909 ACCCCATCAAAATTGGGCAAAGG + Intronic
1083683035 11:64359958-64359980 TGCCCAGCAAAACCAGGGAAAGG - Intronic
1083900380 11:65640640-65640662 TGCCCAGCTAAGCTGGGGAGGGG + Intronic
1087102204 11:94376574-94376596 TGCACAGCTAAACTGGGAAAAGG - Intergenic
1087422700 11:97950236-97950258 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1087692984 11:101343460-101343482 TCCCCTTAAAAACTGGGTAAAGG - Intergenic
1088403336 11:109444829-109444851 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1089878004 11:121744604-121744626 TCACCAACCAAACTGGGGCAAGG + Intergenic
1091876055 12:3933871-3933893 AACCTAGCTAAACTGGGGAAAGG + Intergenic
1093717977 12:22405340-22405362 ACCCCATCAAAAGTGGGCAAAGG + Intronic
1095387201 12:41665018-41665040 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1095489716 12:42720679-42720701 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1097527924 12:60762284-60762306 ACCCCATCAAAAGTGGGTAAAGG - Intergenic
1097943532 12:65339883-65339905 TAGCCAGCTAGACTGGGGAAAGG - Intronic
1098803826 12:74996513-74996535 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1099416422 12:82392647-82392669 ACCACAGCAAAAATGGGCAATGG - Intronic
1100410817 12:94317241-94317263 ACCCCATCAAAAGTGGGCAAAGG - Intronic
1100663365 12:96724498-96724520 ACCCCATCAAAAATGGGCAAAGG - Intronic
1101204026 12:102467045-102467067 TTACCTGTAAAACTGGGGAAAGG - Intronic
1101403972 12:104412189-104412211 TCATGAGCAAAAGTGGGGAATGG + Intergenic
1102628278 12:114254074-114254096 TCCCCAGCAGAGTTTGGGAATGG - Intergenic
1102981975 12:117249019-117249041 ACCCCATCAAAATTGGGCAAAGG - Intronic
1105469039 13:20675061-20675083 GCCCCAGCAAAACTGTGGAAAGG - Intronic
1105708976 13:22986978-22987000 TCCCCAAGAAGACTGGGGATAGG - Intergenic
1105844290 13:24281317-24281339 TCCTGACCAAAACTGGGGATGGG + Intronic
1106487401 13:30184705-30184727 TTCCCAGCAAAAATAGGGCAGGG + Intergenic
1108264275 13:48689080-48689102 ACCCCATCAAAAGTGGGCAAAGG - Intronic
1108570365 13:51743758-51743780 TTTCCAGTAAAACTGGCGAACGG - Intronic
1109282728 13:60375768-60375790 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1110983105 13:81928102-81928124 CCCACAGCAATACTGGGAAATGG + Intergenic
1111089660 13:83427104-83427126 TGCCCAGCAAAAAGGGGGAAAGG + Intergenic
1111344531 13:86933319-86933341 TCCCCACTCTAACTGGGGAAAGG + Intergenic
1113009527 13:105748031-105748053 TCCCAAGCTTACCTGGGGAAGGG + Intergenic
1113342702 13:109442312-109442334 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1114580789 14:23757538-23757560 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1116661504 14:47716675-47716697 ACCCCATCAAAAATGGGGAAAGG - Intergenic
1117383661 14:55190489-55190511 TACCAAGCCAAACTGGAGAAAGG + Intronic
1118464359 14:66017241-66017263 TCCCAAGCCAAAGGGGGGAAAGG - Intergenic
1118972503 14:70648968-70648990 TCCCCAGCAAAAGTGTGAAGTGG + Intronic
1119436179 14:74599403-74599425 ACCCCACCCCAACTGGGGAAGGG - Intronic
1120298194 14:82671769-82671791 TTACCAACAAAACTGGGGAAGGG + Intergenic
1121448069 14:93990706-93990728 TCTCCAGCCAAGCTGGAGAAAGG - Intergenic
1121482706 14:94291083-94291105 TCCCCAGCCAAACAGGGCACTGG - Intronic
1122919723 14:104875024-104875046 TCCCCAGCACCCCTGGGCAAGGG - Intronic
1123154862 14:106214343-106214365 ACCCCATTAAAAATGGGGAAGGG + Intergenic
1123465534 15:20511988-20512010 TTCCCAGAAACTCTGGGGAAGGG - Intergenic
1123652582 15:22489049-22489071 TTCCCAGAAACTCTGGGGAAGGG + Intergenic
1123743006 15:23297908-23297930 TTCCCAGAAACTCTGGGGAAGGG + Intergenic
1124011030 15:25838764-25838786 TCCCCTGAGAAAATGGGGAAAGG + Intronic
1124276255 15:28327967-28327989 TTCCCAGAAACTCTGGGGAAGGG - Intergenic
1124306443 15:28583640-28583662 TTCCCAGAAACTCTGGGGAAGGG + Intergenic
1124561734 15:30780558-30780580 ACCCCATCAAAATTGGGCAAAGG + Intergenic
1125731822 15:41896698-41896720 TCCCTAGCACGACTGGAGAAAGG + Exonic
1125901169 15:43349093-43349115 TCCCCAGGCAACCTGGGGATTGG - Intronic
1127167308 15:56258652-56258674 TCCCCAACAAAATGGAGGAAAGG - Intronic
1128319115 15:66680265-66680287 TGCCCAGCAAGACTGGGGCAGGG + Intronic
1128678987 15:69633005-69633027 TCCCCACCCACACTGAGGAAAGG + Intergenic
1129271129 15:74419767-74419789 TCCCCAGCAACTCTGGGACAGGG + Intronic
1129877990 15:78989328-78989350 TCCCCAGGAAAGCTGGGGCTGGG + Intronic
1130746688 15:86661708-86661730 TCCCCAGATAAACTGGAGATAGG + Intronic
1131062723 15:89413950-89413972 CCCCCAGAAAAACTGGGGTCTGG - Intergenic
1132212486 15:100034696-100034718 TCCCAAACAGAACTGGAGAAAGG + Intronic
1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG + Intronic
1135429548 16:22371628-22371650 AACTTAGCAAAACTGGGGAAAGG + Intronic
1135530710 16:23250995-23251017 TCCAAAGGAAAAATGGGGAATGG - Intergenic
1136072297 16:27795062-27795084 TCCCCAATGAAACTGGGGATGGG + Intronic
1136222453 16:28836878-28836900 TCCCCAGCTCCCCTGGGGAACGG - Exonic
1137308037 16:47224422-47224444 GCCCCAGAAAGACTGGAGAAGGG + Intronic
1137561236 16:49503532-49503554 GCCCCAGGAAAACTGGGGTGTGG - Intronic
1138577109 16:57915150-57915172 CCCCCAGCAGCACTGGGGAGGGG - Intronic
1140811151 16:78579402-78579424 TCACCAGGCAAACTGAGGAAGGG + Intronic
1141833593 16:86523518-86523540 TCACTGGCAAAACTGGGGAGAGG + Intergenic
1141933866 16:87223252-87223274 TCTCCAGCAAACCTGGGGTGGGG - Intronic
1144040770 17:11409298-11409320 TCCCCCCCAAAATTGGGGTATGG + Intronic
1144543633 17:16171231-16171253 TCCACAATAAAACTGGGGGAGGG + Intronic
1144617074 17:16786601-16786623 ACCCCATCAAAAGTGGGCAAAGG - Intronic
1144895618 17:18529073-18529095 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1144967982 17:19089619-19089641 CCCCGCGCAAACCTGGGGAAAGG + Intergenic
1144979935 17:19162444-19162466 CCCCGCGCAAACCTGGGGAAAGG - Intergenic
1144988287 17:19215788-19215810 CCCCGCGCAAACCTGGGGAAAGG + Intronic
1145136598 17:20415158-20415180 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1145258417 17:21340378-21340400 TCCCCAGCACAAGAGTGGAAGGG + Intergenic
1145318210 17:21747628-21747650 TCCCCAGCACAAGAGTGGAAGGG - Intergenic
1147357741 17:39910926-39910948 TCCCCAGCAATACTGTGGTAGGG + Intronic
1147360713 17:39927865-39927887 TCATCTGCAAAACTGGGGCACGG - Intergenic
1147605921 17:41773636-41773658 TCCCCAGCAACAGAGGGGAATGG + Intronic
1148764868 17:50032006-50032028 TGCTCAGCTATACTGGGGAAAGG + Intergenic
1149131634 17:53309292-53309314 TCCCCATCAAAATTGGGCAAAGG + Intergenic
1149657720 17:58319103-58319125 CCCCCGGCAAGGCTGGGGAATGG + Exonic
1150500526 17:65646793-65646815 TCCCCAGCACAACAGGGGCCAGG + Intronic
1150945451 17:69741225-69741247 ACCCCATCAAAATTGGGCAAAGG - Intergenic
1151113452 17:71705711-71705733 TCCCCTGCAAATCAGGGGATGGG - Intergenic
1151349682 17:73524415-73524437 TCCCCAGCCCACCAGGGGAAGGG - Intronic
1151673246 17:75584584-75584606 GCCCCAGCACAACTGGCGATAGG + Intergenic
1153697390 18:7657893-7657915 ACCTCAGTAAAACTGGGGGAGGG - Intronic
1154012543 18:10588076-10588098 CCCCGAACAAAACTGTGGAAAGG - Intergenic
1154421811 18:14237064-14237086 TCCCCAGCAGCACTGGATAAGGG + Intergenic
1156730980 18:40193190-40193212 TCCTAAGCAAGACTGGGCAATGG + Intergenic
1157805484 18:50654786-50654808 ACATCAGCAAAGCTGGGGAAGGG - Intronic
1158425996 18:57340059-57340081 TCTCCAGCCCAACTGGGAAAGGG - Intergenic
1159543556 18:69812418-69812440 TGCCATGCAAAACTGAGGAATGG + Intronic
1160456489 18:79005983-79006005 TCCCCAGAAAGCCTGGGGAGGGG - Intergenic
1160621049 18:80170887-80170909 TCCCCAGCAAAACTGGGGAAAGG - Exonic
1160864998 19:1252522-1252544 TCCGCAGCAAAACCGGGAACCGG - Intronic
1161111976 19:2475727-2475749 CCCCCAGCAGAACTTGGGAAAGG + Intergenic
1162436359 19:10662039-10662061 TTCCCAGCAACTCTAGGGAATGG - Intronic
1163858555 19:19726793-19726815 TCGGCAGCAAGGCTGGGGAAGGG - Intronic
1165062074 19:33209668-33209690 TCCTCAGCAAAACTGGCCAACGG - Intronic
1165126805 19:33603850-33603872 TCCCCAGCTCAACTGAGGGAGGG - Intergenic
1166882299 19:45937037-45937059 TCCCAAGGTAAAATGGGGAAAGG + Exonic
1167568944 19:50275088-50275110 TCCCCAGCAACCCTGGTAAAGGG + Intronic
1168258431 19:55179680-55179702 CCTCCAGCAAAATTGGGGAGAGG - Intronic
925266829 2:2571622-2571644 TCTCCAGCATAGCAGGGGAACGG - Intergenic
926172024 2:10558559-10558581 TCCCCAGGAAAACCAGGCAACGG + Intergenic
926366178 2:12134918-12134940 ACCCCATCAAAAATGGGCAAAGG - Intergenic
926413093 2:12625412-12625434 TCCCCAGGGAGTCTGGGGAAGGG + Intergenic
927509535 2:23635801-23635823 TGGCCAGGAACACTGGGGAACGG + Intronic
928754734 2:34510561-34510583 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
931874300 2:66495636-66495658 TGCCATGCAAAACTGGGAAAGGG - Intronic
932437031 2:71707974-71707996 TCCCCAGCAAGACTTTGGGAGGG + Intergenic
932542304 2:72668032-72668054 ACCCCAGTAAAAGTGGGCAAAGG + Intronic
932662201 2:73665318-73665340 ACCCCATCAAAACTAGGCAATGG - Intergenic
934133431 2:88971126-88971148 GCACCAGCAGAACTGGGGCATGG - Intergenic
934514292 2:94975512-94975534 ACCCCATTAAAAATGGGGAAGGG + Intergenic
934991194 2:98922699-98922721 TCCCCTGCAAAACAGGGCCACGG + Intronic
935128013 2:100240935-100240957 TCCCCAGCAAAACACGGGTGTGG - Intergenic
935749559 2:106219367-106219389 TCCCCAGCCGTACTGGGGCAAGG + Intergenic
936073600 2:109387535-109387557 GCCCCATCACATCTGGGGAAGGG - Intronic
936121739 2:109751950-109751972 TCCCCAGCCGTACTGGGGCAAGG - Intergenic
936222956 2:110619522-110619544 TCCCCAGCCGTACTGGGGCAAGG + Intergenic
936728688 2:115355383-115355405 ACCCCATCAAAAATGGGCAAAGG - Intronic
938686954 2:133747765-133747787 ACCCCATCAAAAATGGGTAAAGG + Intergenic
938726508 2:134113416-134113438 TCTCCAGCAAGACTGAGGAGGGG - Intergenic
938997890 2:136700069-136700091 ACCCCAACAAAAATGGGCAAAGG + Intergenic
940313013 2:152298289-152298311 TTCACAGCAAAACTGAGCAAAGG + Intergenic
940965006 2:159827277-159827299 ACCCCATCAAAATTGGGCAAAGG + Intronic
941050150 2:160723480-160723502 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
941884838 2:170517146-170517168 TCTTCAGCAAAGCTGGGGGATGG + Intronic
943559498 2:189443698-189443720 TCACCAGTAATACTGGGGGATGG + Intronic
945008528 2:205436688-205436710 TACCCAGCAAATCTGGCAAAAGG - Intronic
945612243 2:212018350-212018372 CCCCCAGGAATACTGGGAAATGG - Intronic
946205415 2:218103405-218103427 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
947281555 2:228460885-228460907 CCCCCAACAATTCTGGGGAAAGG - Intergenic
947891223 2:233622553-233622575 ACCCCATCAAAAGTGGGCAAAGG - Intronic
1170617608 20:17967061-17967083 CCTCCAGCAAAATTGGAGAATGG - Intronic
1173394409 20:42665263-42665285 ACCCCATCAAAAGTGGGCAAAGG + Intronic
1173953870 20:47015711-47015733 ACCCTATCAAAAGTGGGGAAGGG - Intronic
1176075338 20:63245660-63245682 TCCCCAGCACAGCTGGGCAGAGG + Intronic
1176104758 20:63380757-63380779 GCCCCAGCAAACCTTGGCAAAGG + Intergenic
1176204836 20:63882614-63882636 GCCCGAGGAAAACTGAGGAAAGG - Intronic
950119171 3:10470515-10470537 TCCTCAGTAACACTGGGGCAGGG + Intronic
951361289 3:21727487-21727509 ACCCCATCAAAAATGGGCAAAGG + Intronic
951820012 3:26797910-26797932 TCCCCTGCTAGACTGAGGAAAGG + Intergenic
952060924 3:29509022-29509044 ACCCCATCAAAAGTGGGCAAAGG - Intronic
953136735 3:40188390-40188412 TCCACACACAAACTGGGGAATGG + Intronic
954127274 3:48538922-48538944 TCCTCAGATAAACTGGGGGAGGG + Intronic
954772250 3:52982067-52982089 TCAACACCAAAACTGGTGAAGGG + Intronic
954943860 3:54399857-54399879 TTCCCAGCAAGCCTGGGCAATGG + Intronic
955195313 3:56800704-56800726 TCACCACCACCACTGGGGAAAGG - Intronic
955929593 3:64043337-64043359 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
956685331 3:71821593-71821615 CCCCCCGCTAAACTCGGGAAAGG - Intergenic
956770516 3:72522121-72522143 TCCCCAGCATCACAGGGAAATGG + Intergenic
957403837 3:79751443-79751465 TCCTCATCAAAATTAGGGAAGGG + Intronic
959289560 3:104456601-104456623 TCGCCATCAAATCTGGGAAAGGG + Intergenic
960278069 3:115749699-115749721 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
962036993 3:131662631-131662653 ACCCCATCAAAACTGGGTGAAGG + Intronic
962655214 3:137536941-137536963 ACCCCATCAAAACTGGGCAAAGG - Intergenic
962687143 3:137858624-137858646 AACCCAGCATCACTGGGGAAGGG - Intergenic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
962818891 3:139027445-139027467 ACCCCATCAAAAGTGGGCAAAGG - Intronic
962915086 3:139894044-139894066 TCCCAAACAGAAGTGGGGAAGGG - Intergenic
965194608 3:165577509-165577531 ACCCCATCAAAAATGGGCAAAGG + Intergenic
965202049 3:165672184-165672206 TTCCCACCAAAACTGGACAAGGG + Intergenic
965213093 3:165821386-165821408 ACAACAGAAAAACTGGGGAAAGG - Intronic
966595298 3:181720105-181720127 TGCCCAGCAGAATTAGGGAAGGG + Intergenic
967284411 3:187854247-187854269 TCCCCAGCAAAAAAAGGGACAGG - Intergenic
967323840 3:188219594-188219616 TTCACAGCAAAACTGTGGCATGG - Intronic
967604706 3:191431874-191431896 TCCCCAGAGAAAGTGGAGAAGGG + Intergenic
968538484 4:1150112-1150134 GCCCAAGCAAAACTCGGGCAAGG - Intergenic
971791399 4:31174288-31174310 ACCCCATTAAAACTGGGCAAAGG - Intergenic
972881382 4:43427397-43427419 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
972885986 4:43488463-43488485 ACCCCATCAAAAGTGGGTAAAGG - Intergenic
973758289 4:54095761-54095783 CTCAGAGCAAAACTGGGGAATGG + Intronic
974075508 4:57164930-57164952 TCCTCAGCAGAAGAGGGGAATGG - Intergenic
975329866 4:73100369-73100391 TCCCCAACAGAACAGGGGGAGGG - Intronic
978728537 4:111998658-111998680 TCAGCAGCAAAACTGAGCAATGG + Intergenic
979196753 4:117928632-117928654 TCCCCACTAAAAGTGGGCAAAGG + Intergenic
979495337 4:121376959-121376981 TCCCCAGCAAGAAAGAGGAATGG + Intronic
981357167 4:143802738-143802760 GCCCCATCAAAAATGGGCAAAGG + Intergenic
982133157 4:152248042-152248064 TCCCCAGCATACCTGGGGCGGGG - Intergenic
983750304 4:171260083-171260105 ACCCCATCAAAATTGGGCAAAGG - Intergenic
983943134 4:173557354-173557376 GCCGCAGCATAACTGTGGAAAGG + Intergenic
984644350 4:182203609-182203631 GGCCCAGCAAAGCGGGGGAAAGG - Intronic
984711293 4:182887570-182887592 TCCCAAGAAAATCAGGGGAAGGG - Intergenic
985292084 4:188396520-188396542 TACACAGAGAAACTGGGGAAAGG - Intergenic
985881005 5:2639190-2639212 TACACAGCTCAACTGGGGAAGGG + Intergenic
988290286 5:29275589-29275611 ACCCCAACAAAAGTGGGCAAAGG + Intergenic
988508942 5:31849069-31849091 TTCCCAGCAAAACAGAGGAAAGG - Intronic
989672171 5:43931595-43931617 TCCCAAGAAAAAATGGGCAAAGG - Intergenic
991233746 5:64368628-64368650 ACCCCATCAAAAATGGGCAAAGG + Intronic
994139802 5:96329518-96329540 TCCCCAGGGAAACTGGGCAGTGG - Intergenic
996249700 5:121314544-121314566 TCCCTAGAGGAACTGGGGAAAGG - Intergenic
996966535 5:129312804-129312826 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
997263146 5:132478836-132478858 CAGCCAGCAGAACTGGGGAAAGG + Intergenic
998688416 5:144557213-144557235 ACCCCATCAAAAATGGGCAAAGG - Intergenic
999868425 5:155727155-155727177 TCATCAGCAAAAGCGGGGAAAGG - Intergenic
1000854481 5:166381187-166381209 ACCCCATCAAAAATGGGAAAAGG - Intergenic
1002093258 5:176817053-176817075 GCCCCAGAGTAACTGGGGAAGGG + Intronic
1003482420 6:6546035-6546057 TCCCAAGCAAAGCTGGGGGCTGG - Intergenic
1008311456 6:49980097-49980119 TTCCATGCAAAACTGGGGATTGG - Intergenic
1009647623 6:66426796-66426818 ACCCCATCAAAATTGGGCAAAGG + Intergenic
1009756594 6:67947977-67947999 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1010852577 6:80796044-80796066 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1010994490 6:82517583-82517605 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1012613154 6:101241358-101241380 ACCCCAGCAAAACAGGGGACAGG - Intergenic
1012882285 6:104805025-104805047 ACCCCATCAAAATTGGGCAAAGG + Intronic
1013189192 6:107787758-107787780 ACCCCCGCAAGACTGGTGAATGG - Intronic
1013603131 6:111723958-111723980 TGCCTAGAAAAACTGGTGAAGGG + Intronic
1014512484 6:122341303-122341325 TCCCCAGCAAAATTGTAGAATGG - Intergenic
1015080771 6:129223165-129223187 ACCCCATCAAAATTGGGCAAAGG - Intronic
1015464195 6:133529802-133529824 TCTCCAGTAAAACTGTAGAAGGG - Exonic
1015630094 6:135223382-135223404 TCCTCAGCAAAACTGCTTAAGGG + Intergenic
1018164253 6:161078646-161078668 ACCCCATCAAAAGTGGAGAAAGG + Intronic
1021100505 7:16583573-16583595 TCCCCAGCTCCCCTGGGGAAAGG + Intergenic
1028736536 7:94219514-94219536 ACCCCATCAAAATTGGGCAAAGG + Intergenic
1029111770 7:98216369-98216391 TCACCAGCGCATCTGGGGAAGGG + Exonic
1029808494 7:103021651-103021673 ACCCCATCAAAAATGGGCAAAGG + Intronic
1030267123 7:107632003-107632025 TCCCCACTCTAACTGGGGAAAGG - Intergenic
1030271297 7:107671032-107671054 TCCCCACCAAAAAAGGAGAAAGG + Intronic
1031508399 7:122617421-122617443 TTCCCAGCAAAACTTGCTAATGG + Intronic
1031853423 7:126892979-126893001 ACCCCATCAAAAGTGGGCAAAGG + Intronic
1032128390 7:129210898-129210920 TTCCCATCAAATCTTGGGAAGGG - Intronic
1033154473 7:138945080-138945102 TCCCCAGTTAAACTGGGATAAGG - Intronic
1033275628 7:139969705-139969727 ACCCCAGCAGACCTGGGCAAAGG - Intronic
1033825485 7:145185075-145185097 TCCCCAGCAGAAATGGGGAAAGG + Intergenic
1034755100 7:153609524-153609546 TCCAGAGAAAAACTGGGGGAAGG - Intergenic
1034890836 7:154837826-154837848 ACCTCACCAATACTGGGGAAAGG - Intronic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1038111565 8:24505554-24505576 TCCTCAGCAAACCTGGGGTTTGG + Intronic
1038389284 8:27180109-27180131 TTCCCAGCTACAGTGGGGAATGG - Intergenic
1038522432 8:28244693-28244715 CCTCCAGCAACACTGGGGCACGG + Intergenic
1039019565 8:33190163-33190185 ACCCCATCAAAAATGGGCAAAGG + Intergenic
1041616924 8:59917703-59917725 TCCCCAGCACAACAGGAGAGTGG - Intergenic
1041729386 8:61049383-61049405 TGGCCACCAAAACTGGAGAAAGG - Intergenic
1042505909 8:69560196-69560218 TGCCCAGCCAAAGTGGGGATTGG + Intronic
1042615690 8:70646367-70646389 ACCCCATCAAAAGTGGGCAAAGG + Intronic
1043329993 8:79103845-79103867 TTTCCAGAAAAACAGGGGAAAGG + Intergenic
1043534111 8:81181972-81181994 TCTCTTGCAAAACTGGTGAAAGG + Intergenic
1048858931 8:138708956-138708978 ACCCCATCAAAAATGGGCAAAGG + Intronic
1049272317 8:141702509-141702531 TGCCCAGGAAAACCAGGGAAGGG - Intergenic
1049873799 8:145002543-145002565 TCCCGAGCAACACTGAGGCAGGG - Intergenic
1050631465 9:7563011-7563033 GCCCCTGGGAAACTGGGGAAAGG + Intergenic
1050645793 9:7718216-7718238 ACCCCATCAAAAGTGGGCAAAGG + Intergenic
1051180780 9:14409641-14409663 TTTTCAGCAAAAGTGGGGAAAGG - Intergenic
1051363853 9:16306113-16306135 TGCCCTGCACAACTGGGGAGTGG - Intergenic
1052317208 9:27127799-27127821 ACCCCATCAAAATTGGGTAAAGG - Intronic
1052381803 9:27779678-27779700 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1055556473 9:77478850-77478872 ACCCCATCAAAAATGGGCAAAGG - Intronic
1057313022 9:93953363-93953385 TCCCTCCCAAATCTGGGGAACGG - Intronic
1059160367 9:112028916-112028938 GACCCAACAAAGCTGGGGAAAGG - Intergenic
1060034774 9:120245343-120245365 TTCCCATCAAAAGTGGGCAAGGG - Intergenic
1060281037 9:122215863-122215885 TCCCCAGAAAAACTGGGGGTTGG + Intronic
1062394515 9:136347394-136347416 TTCCCAGGAAGACTGGGTAAGGG + Intronic
1186369596 X:8932986-8933008 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1187577880 X:20577621-20577643 TGCCAAGCAAATGTGGGGAAAGG + Intergenic
1188101292 X:26091234-26091256 ACCTCAGTAAAACTGGGGAGGGG - Intergenic
1189536123 X:41937015-41937037 TGGAGAGCAAAACTGGGGAAGGG - Intergenic
1192232968 X:69278498-69278520 TCCCCAGCAAGAATGGGGGGAGG - Intergenic
1192633332 X:72793451-72793473 TCCCCAGCAATGCTGGGGTTCGG - Intronic
1192648377 X:72927350-72927372 TCCCCAGCAATGCTGGGGTTCGG + Intronic
1192765037 X:74131418-74131440 CCCCAAGCAAAACTGATGAAGGG - Intergenic
1193322811 X:80143662-80143684 TCCCCAACAATACTGGGACAAGG + Intergenic
1195163226 X:102191882-102191904 ACCCCATCAAAAATGGGCAAAGG - Intergenic
1196988279 X:121299008-121299030 TCCACAGCAAAACTGACAAATGG - Intergenic
1197110760 X:122771530-122771552 TCCCCAGCAGTAGTGGGGATGGG + Intergenic
1197430552 X:126358072-126358094 ACCCCATCAAAATTGGGCAAAGG + Intergenic
1198510323 X:137343978-137344000 TCACCAGGGAGACTGGGGAAAGG - Intergenic
1198668437 X:139050982-139051004 TGCCTGGCATAACTGGGGAATGG + Intronic
1200097441 X:153670820-153670842 TCCCCAGAGATCCTGGGGAAAGG + Exonic
1201339342 Y:12916393-12916415 TCCTGAGCGAAACTGGTGAAGGG - Exonic
1201459428 Y:14206005-14206027 ACCCCATCAAAAGTGGGCAAAGG - Intergenic
1202374475 Y:24221269-24221291 ACCCCATCAAAATTGGGCAAAGG + Intergenic
1202496305 Y:25448851-25448873 ACCCCATCAAAATTGGGCAAAGG - Intergenic