ID: 1160622213

View in Genome Browser
Species Human (GRCh38)
Location 18:80179432-80179454
Sequence GCCAGTGGCCCGCTGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160622213_1160622226 12 Left 1160622213 18:80179432-80179454 CCTGCCCTCAGCGGGCCACTGGC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1160622226 18:80179467-80179489 CACAGAAGGCCAACAGGACAGGG 0: 1
1: 0
2: 3
3: 25
4: 337
1160622213_1160622217 -2 Left 1160622213 18:80179432-80179454 CCTGCCCTCAGCGGGCCACTGGC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1160622217 18:80179453-80179475 GCCCCCAAATCCACCACAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 151
1160622213_1160622225 11 Left 1160622213 18:80179432-80179454 CCTGCCCTCAGCGGGCCACTGGC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1160622225 18:80179466-80179488 CCACAGAAGGCCAACAGGACAGG 0: 1
1: 0
2: 1
3: 25
4: 246
1160622213_1160622222 6 Left 1160622213 18:80179432-80179454 CCTGCCCTCAGCGGGCCACTGGC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1160622222 18:80179461-80179483 ATCCACCACAGAAGGCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 169
1160622213_1160622227 13 Left 1160622213 18:80179432-80179454 CCTGCCCTCAGCGGGCCACTGGC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 1160622227 18:80179468-80179490 ACAGAAGGCCAACAGGACAGGGG 0: 1
1: 0
2: 0
3: 19
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160622213 Original CRISPR GCCAGTGGCCCGCTGAGGGC AGG (reversed) Intronic
900429854 1:2596382-2596404 CCCAGTGGCCGGCTGGGGTCAGG + Intronic
900494836 1:2971723-2971745 GACACTGGCCCCCTGGGGGCTGG + Intergenic
900602705 1:3509839-3509861 GCCGGTGCTCCGCGGAGGGCGGG + Intronic
901859343 1:12064098-12064120 GCCAGTGGCCAGCTTAGGAAGGG - Intronic
902240079 1:15082561-15082583 GCCAATGGCACTCTGAGGTCAGG + Intronic
902773734 1:18661170-18661192 GCAAGGGGGCCTCTGAGGGCAGG - Intronic
903222289 1:21875628-21875650 CCCAGCAGCCCGCTGAGAGCAGG - Exonic
903300647 1:22376270-22376292 GCCAGTGGCCTGAAGTGGGCAGG - Intergenic
903776992 1:25799914-25799936 GCAAGTGGGCCGCAGAGGCCTGG + Intergenic
904565443 1:31425643-31425665 GCTAGGGGCTCCCTGAGGGCAGG + Intronic
907590255 1:55659882-55659904 GCCAGAGGCCTGATGAGAGCAGG - Intergenic
915456418 1:156043834-156043856 GATAGTGGCCGGGTGAGGGCTGG - Intronic
917291726 1:173477697-173477719 TCGAGTGGCCCGCGCAGGGCAGG - Intronic
919094142 1:193009784-193009806 TCCAGTGGCTCCCTGAGGGCTGG - Intergenic
919496493 1:198276865-198276887 ACCTGTGACCAGCTGAGGGCAGG - Intronic
920125967 1:203693970-203693992 TCCAGTGGCCCTCTGTGGGGTGG + Intronic
920495302 1:206450557-206450579 CCCAGCGGTCCCCTGAGGGCAGG + Intronic
920516970 1:206592427-206592449 GCCAGTGAGCCTCTGAGGTCAGG + Intronic
921891265 1:220356166-220356188 GTCTGTGGCCCGCTGGGAGCTGG - Intergenic
921939232 1:220823056-220823078 GGCTGTGGTCCCCTGAGGGCTGG - Intergenic
922602930 1:226870742-226870764 GCCAGAGGCGTGCGGAGGGCAGG - Intronic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
922809118 1:228406263-228406285 GCCAGTGGCTCGCGGTGCGCGGG + Exonic
922932768 1:229403215-229403237 CCCAGTGGCCAGCAGAGTGCTGG + Intergenic
1063259081 10:4363941-4363963 ACCAGTTGCCCGCAGAGGACTGG + Intergenic
1065712550 10:28532472-28532494 GCCCCTGCCCCGCGGAGGGCCGG + Intronic
1067237362 10:44462267-44462289 TCCAGTTCCCCGCTTAGGGCTGG - Intergenic
1067526062 10:47039366-47039388 GCCTGGGGGCTGCTGAGGGCAGG + Intergenic
1067553572 10:47252528-47252550 GTCAGTTCCCAGCTGAGGGCAGG + Intergenic
1072503653 10:96043628-96043650 GACAGTGGGCCGCTAAGCGCCGG - Exonic
1074421163 10:113309766-113309788 ACCAGTGGGCCCCTGGGGGCTGG + Intergenic
1075675299 10:124291866-124291888 ACCAGAGGCCTCCTGAGGGCAGG - Intergenic
1075717893 10:124567383-124567405 GCCAGGGGCGCGTGGAGGGCAGG - Intronic
1076106331 10:127826603-127826625 GCCAGTGGAAGGCTGAGGTCTGG - Intergenic
1076379611 10:130015907-130015929 ACCAGTGGCCAGCGGAGGGATGG - Intergenic
1077164996 11:1130923-1130945 GCCTGTGGCTCCCTGAGGGGTGG - Intergenic
1077174311 11:1181698-1181720 GCCCGGGGGCTGCTGAGGGCAGG - Intronic
1077442174 11:2573989-2574011 GCCAGTGTCCCTCTGGGAGCTGG + Intronic
1077464744 11:2728353-2728375 GGCTGTGGTCCCCTGAGGGCTGG - Intronic
1077472103 11:2768941-2768963 GCGAGGGGCAGGCTGAGGGCAGG - Intronic
1077537318 11:3130583-3130605 GCCAGGGGCCAGGTGAGGGAGGG - Intronic
1081636947 11:44727500-44727522 GCCCGGAGTCCGCTGAGGGCCGG + Intronic
1081964689 11:47162336-47162358 GCCAGTGGCCCACTCAGACCTGG + Intronic
1083439251 11:62665236-62665258 GCGATTGGCCCGCGGAAGGCCGG - Intronic
1084313381 11:68329752-68329774 GTCAGTGGGGCGCTGATGGCCGG - Intronic
1084572160 11:69966312-69966334 GCCAATAGACCCCTGAGGGCAGG - Intergenic
1084594110 11:70107000-70107022 GCCAGTGGCCAGCTGTGGGAGGG + Intronic
1084621085 11:70270733-70270755 GCCAGTGTCCGGCCGCGGGCCGG + Exonic
1084804889 11:71571891-71571913 GCCAGTGAGCAGCTGAGGGCTGG - Intergenic
1084956755 11:72695684-72695706 GCCAGTGGGCAGTGGAGGGCAGG - Intronic
1085391137 11:76182905-76182927 ACCAGTGGCTTGCTCAGGGCTGG + Intergenic
1085391302 11:76183665-76183687 GCCAGTAGCCCGCTGAGTCAGGG + Intergenic
1086500833 11:87451654-87451676 TGCAGTGGCCCGCTCAGGGCAGG + Intergenic
1088950065 11:114559728-114559750 GCCAGTGGTCAGTGGAGGGCAGG - Intronic
1089376779 11:118000164-118000186 CCCAGAGGCCCGATGAGGGGAGG - Exonic
1089562389 11:119350568-119350590 GCCAGGGGCCAGCTCAGGGTTGG + Intergenic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1091785628 12:3241934-3241956 GCGAGTGGCCCCCTGTGTGCTGG - Intronic
1095206320 12:39443460-39443482 GGCAGTGTCCCGACGAGGGCAGG - Intergenic
1103569925 12:121838306-121838328 GGCACTGCCCTGCTGAGGGCAGG + Intergenic
1104953303 12:132451941-132451963 GCCTGTGGCCCACAGAGGACGGG + Intergenic
1105210084 13:18252544-18252566 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1105447774 13:20472675-20472697 GCGCGTGGCCCTCTGAGGCCTGG + Intronic
1105557359 13:21459410-21459432 GCCCGCGGCCCGCGGCGGGCGGG - Intergenic
1105702983 13:22947800-22947822 GCCAGTGGTCAGCAGAGGGTGGG - Intergenic
1105805144 13:23948101-23948123 GCCAGTGGCAGGGTGGGGGCAGG - Intergenic
1106833543 13:33610798-33610820 CGCAGTGGCCCGCGGTGGGCTGG - Intergenic
1112478333 13:99752394-99752416 GCCACAGGCCCCCTGTGGGCAGG - Intronic
1113297844 13:108981625-108981647 GCAATTGGCCAGCTGAAGGCTGG - Intronic
1113639208 13:111945048-111945070 GAGAGGCGCCCGCTGAGGGCAGG - Intergenic
1121411084 14:93748667-93748689 GCAAGTGGCCCGCAGAGCACAGG - Intronic
1121605659 14:95238097-95238119 GGCAGGGGCCGTCTGAGGGCTGG - Intronic
1122142705 14:99672410-99672432 GCCAGTGGGACACTGAGGGTTGG + Intronic
1122844623 14:104486040-104486062 GCCAGTGGTCAGCAGAGGGTGGG - Intronic
1122982558 14:105198222-105198244 GCCAGTGGCTTGCTGAGGGAGGG - Intergenic
1123148050 14:106153527-106153549 GCTCGTGACCCACTGAGGGCGGG - Intergenic
1123158808 14:106257667-106257689 GCTAGGGACCCACTGAGGGCGGG - Intergenic
1124376932 15:29134375-29134397 GACAGTGGCCCCCTGAGCCCCGG - Intronic
1124453593 15:29821701-29821723 GGCTGCGGCTCGCTGAGGGCGGG - Intronic
1125520249 15:40344379-40344401 GACAGAGGCTCTCTGAGGGCAGG + Intergenic
1125530808 15:40412320-40412342 GCCAGGGGCCCTGTGAAGGCTGG + Intronic
1126411976 15:48381322-48381344 GCCAGGGGCAGGCAGAGGGCAGG + Intergenic
1126454242 15:48843806-48843828 GCAATTGGTCAGCTGAGGGCTGG - Intronic
1126728065 15:51653210-51653232 GCAAGTGGCCAGGGGAGGGCAGG + Intergenic
1128713096 15:69886615-69886637 ACCAGTGCCCAGCTGAGGGTAGG - Intergenic
1129612374 15:77070958-77070980 GCCGGTGGCCCGCGAAGGCCCGG + Exonic
1129722394 15:77884904-77884926 GACAGAGGCCAGCTGAGGGTAGG - Intergenic
1131024648 15:89129691-89129713 GCCACTGGCCAGCAGGGGGCAGG - Intronic
1132145420 15:99426350-99426372 GGCTGTGGCCCGTGGAGGGCAGG - Intergenic
1132270548 15:100520277-100520299 GACAGGGCCCAGCTGAGGGCTGG + Intronic
1132515330 16:363349-363371 GCCTGGGGCCAGCAGAGGGCTGG + Intergenic
1132897802 16:2237188-2237210 GACAGGGGCCCGCTCAGGGTCGG - Intronic
1132925375 16:2426539-2426561 GCCCGTAGGCCGCTGGGGGCTGG + Intergenic
1133235650 16:4386273-4386295 GCCAGTGGCACCGTGAGGTCTGG + Intronic
1134081143 16:11325954-11325976 GCCTGCGGCCAGCTGGGGGCCGG - Intronic
1135547254 16:23374677-23374699 GTCTGTGGCTCTCTGAGGGCAGG - Intronic
1139721678 16:68861198-68861220 GCCAGTGGTCCTCTCATGGCGGG - Intronic
1140406406 16:74714148-74714170 GCCAGGGCCGGGCTGAGGGCAGG + Exonic
1140457228 16:75112510-75112532 GCCAGTGCCCGCCTGGGGGCAGG + Exonic
1140767802 16:78176152-78176174 GCCAGTGGAACTCGGAGGGCAGG - Intronic
1141598756 16:85112777-85112799 GCCAGTGGCAGGCTCGGGGCAGG - Intergenic
1142490021 17:272884-272906 GCCACTGGCCCACTGAGGCTGGG - Intronic
1143318854 17:6054581-6054603 GCCAGTGGCCCCATGAGCTCAGG - Intronic
1144778477 17:17796427-17796449 GGCGGAGGCCCTCTGAGGGCCGG + Exonic
1147608089 17:41785555-41785577 GCCAGGGGCCGGCTGGGGGAAGG + Intronic
1147692200 17:42323199-42323221 GCCACTGGCTTGCTGAGAGCAGG + Intronic
1147918617 17:43902823-43902845 GCTAGAGGCCCTCTGAGGCCCGG - Intronic
1148048741 17:44759141-44759163 GCCAGCGGCGCGGGGAGGGCGGG - Exonic
1148125633 17:45235198-45235220 GACTGTGGGCCCCTGAGGGCAGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1149659239 17:58325734-58325756 GCCAATGGTCACCTGAGGGCTGG + Intronic
1150289768 17:63974378-63974400 GCCAGTGAGCAGCTGAGGGCAGG - Intergenic
1151305779 17:73261936-73261958 GCCAGTGGCCAGGTGACTGCAGG + Intronic
1152496598 17:80677035-80677057 GCCAGTGGACCTGGGAGGGCGGG + Intronic
1152710700 17:81869459-81869481 GCCAGGGGGCCGCGCAGGGCTGG - Intronic
1152718779 17:81912354-81912376 GCCAGTGTCACGGTGAAGGCTGG - Exonic
1153238847 18:3013107-3013129 GCCAGCGGGCGGCTGAGGGCAGG + Intronic
1153699548 18:7678519-7678541 CCCAGTGGTCCTCTGAAGGCCGG - Intronic
1157325693 18:46667428-46667450 GACAGAGGGCCCCTGAGGGCCGG - Intergenic
1160622213 18:80179432-80179454 GCCAGTGGCCCGCTGAGGGCAGG - Intronic
1160769984 19:826481-826503 GCCAGGGGCCGGGGGAGGGCAGG - Intronic
1160885229 19:1343316-1343338 GCCAGGGGCCGGCAGAGGGAGGG + Intergenic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
1162450021 19:10748957-10748979 GCCAGTGCCATGCTGAAGGCTGG + Intronic
1163366040 19:16876682-16876704 GCCTGTGGCCTGCAGAGGGAGGG - Intronic
1164721806 19:30438067-30438089 GCCAGGGGCCAGCAGAGGGCAGG - Intronic
1165434161 19:35787560-35787582 GTCAGTGCCCAGCTCAGGGCAGG + Exonic
1165922033 19:39305278-39305300 GCCAGGGGCCCCCTGAGGCCAGG - Intergenic
1165941957 19:39419021-39419043 GCCGGGGGCCCTCTGAGTGCTGG + Intronic
1166141671 19:40808520-40808542 GCCAGTGGCCTGCTGAGGTCAGG - Intronic
1166203516 19:41253796-41253818 GCTAGACACCCGCTGAGGGCAGG + Intronic
925012511 2:496355-496377 GCCAGTCCTCCGCTGAGAGCGGG - Intergenic
926035280 2:9631082-9631104 GCCAGCGGCGCGCTGGGGGCGGG - Intergenic
928220948 2:29402232-29402254 GCCAGGGGCTGGCTAAGGGCTGG + Intronic
928410818 2:31052593-31052615 GTCAGTGGTGAGCTGAGGGCAGG - Intronic
928638895 2:33277091-33277113 GCCAGGGGACAGCTGAGGGCTGG - Intronic
929455076 2:42059690-42059712 GCCTGTGGGGCTCTGAGGGCCGG + Intergenic
931721181 2:65068908-65068930 TCCAGTGCCCAGCTGAGGCCTGG + Intronic
932599316 2:73112929-73112951 GCCAGCGGCCCGGTGAGGCGGGG - Exonic
934654876 2:96112275-96112297 GCCAGTGGCCAGCCCAGGGAGGG - Intergenic
935820447 2:106887499-106887521 GCCAGTGGGCGGCTGCGAGCTGG + Intergenic
938120491 2:128629524-128629546 GCCAGTGGCCCCCTGGAGACAGG - Intergenic
940166568 2:150780206-150780228 GCAAGTAGCCCTCTGAGAGCTGG + Intergenic
940238842 2:151541366-151541388 GCCACTGGCCAGGTGAGGCCAGG + Intronic
940984309 2:160037467-160037489 GCCAGTGACATGCTGAGGGCTGG + Intronic
942732444 2:179075062-179075084 GCCCGTGACCAGGTGAGGGCAGG - Intergenic
945268076 2:207910978-207911000 GCCATTGGCCAACTGAGGGCAGG + Intronic
947187367 2:227467206-227467228 GCCAGGGGGCGGCGGAGGGCAGG + Intergenic
948178338 2:235961232-235961254 GCCAGTGGCCAGCTTGGGGAAGG + Intronic
948301462 2:236910123-236910145 GCCAGAGGCCAGGAGAGGGCAGG - Intergenic
948385274 2:237576912-237576934 CCCAGTGGCCGGCAGAGGGAAGG - Intronic
948853113 2:240717988-240718010 GCCAGGAGCCGGTTGAGGGCAGG + Intronic
1171175536 20:23048969-23048991 GCCAGTGGCCTGCAGGTGGCTGG + Exonic
1171291230 20:23984234-23984256 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1172447093 20:34998965-34998987 GCCTGAGCCCCGCTGAGGGTGGG + Intronic
1173843649 20:46174796-46174818 GCGAGTGGCGCTCGGAGGGCAGG + Exonic
1175258689 20:57661991-57662013 GACAGTGGCACGCTGAGCCCTGG - Intronic
1175952033 20:62588688-62588710 GCCGGGGGCCATCTGAGGGCAGG + Intergenic
1176861448 21:14013465-14013487 CACAGTGGCCAGGTGAGGGCAGG - Intergenic
1178544276 21:33480029-33480051 GCAAGTGGCCGGCCGGGGGCGGG + Intergenic
1178544308 21:33480133-33480155 GCAAGTGGCCGGCCGGGGGCAGG + Intergenic
1179875906 21:44267319-44267341 GCCGATGGCCCGCTGGGGGCTGG + Intergenic
1180766173 22:18346860-18346882 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1180780140 22:18515518-18515540 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1180812856 22:18772839-18772861 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1181199014 22:21207087-21207109 GCCAGGGGCCAGGTGAGGCCAGG - Intergenic
1181400730 22:22648701-22648723 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1181702710 22:24629799-24629821 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
1181934380 22:26428651-26428673 GACGGTGGCTCACTGAGGGCAGG + Intergenic
1184096462 22:42318876-42318898 CCCTGTGGCCAGCTGAGGCCTGG + Intronic
1184405971 22:44301036-44301058 GCCCGTCCCCCGCTGTGGGCAGG - Intronic
1184691549 22:46119542-46119564 GCCAGGGGCAGGCTGAGTGCGGG + Intergenic
1203227791 22_KI270731v1_random:87751-87773 GCCAGGGGCCAGGTGAGGCCAGG + Intergenic
949329276 3:2903528-2903550 ACCAGTGGCCTGCAGAGGACGGG - Intronic
949505040 3:4719603-4719625 CCCAGTGGCCCACTGAGGAAGGG + Intronic
949582409 3:5401776-5401798 CCCAGTGGTGCGCTGAGGGGAGG + Intergenic
950217877 3:11172344-11172366 AGCAGGGGCCCTCTGAGGGCTGG - Intronic
950505765 3:13393562-13393584 GCCAGTGGCCAGCAGCTGGCAGG - Intronic
951146527 3:19234262-19234284 GCCAGTCCCGCGCTGTGGGCCGG + Intronic
953928187 3:46992935-46992957 CCCAGTGACCCGCTGAGGGTGGG - Intronic
953929771 3:47000095-47000117 GGCAGGGGGCCTCTGAGGGCAGG - Exonic
953989783 3:47475534-47475556 ACCAGGGGCCCGCGGAGGTCTGG + Intronic
956975291 3:74571993-74572015 GCCAGTGGCAGGTGGAGGGCAGG - Intergenic
960383254 3:116990182-116990204 ACCAGTGGCTCACTGAGGTCAGG - Intronic
961673206 3:128549546-128549568 GCCAGTGGACCTCTCGGGGCAGG + Intergenic
968420402 4:479360-479382 GGCAGTGGCTGGCTGAGGGCTGG - Intronic
969330176 4:6470357-6470379 TCCTGTGCCCTGCTGAGGGCTGG + Intronic
969459107 4:7318405-7318427 GTCTGTGGGCCCCTGAGGGCAGG - Intronic
969562368 4:7957582-7957604 GGCAGTGGCCAGATGATGGCCGG + Intergenic
970403798 4:15742918-15742940 GCCAGTTGCCATCTCAGGGCAGG - Intergenic
971451803 4:26807592-26807614 GCAAGTGGCACACTGAGGGGTGG - Intergenic
972960687 4:44448589-44448611 GCCAGGAGCACGCGGAGGGCTGG - Exonic
977323600 4:95548815-95548837 GACAGCGGCCCGCTGCGGACTGG - Exonic
984845385 4:184103856-184103878 GCCAGGGGCTCGCTGGGGTCAGG - Intronic
985904546 5:2823208-2823230 GCCAGGGGCCTGCTGGGGGCAGG + Intergenic
987179159 5:15348262-15348284 GCCAGTGGGCCACTGAAGGCGGG - Intergenic
988977554 5:36529903-36529925 GACAGTGGCCTCCTGAGGACAGG + Intergenic
990042425 5:51390110-51390132 GCCGGCCGCCAGCTGAGGGCGGG + Intronic
990910185 5:60844362-60844384 GCCAGGTGCCCGCCGAGGGCCGG + Exonic
991936787 5:71810154-71810176 GGCAGTGTCCGGCTGAGGGAGGG - Intergenic
994497801 5:100535600-100535622 GCCAGGGGCCCGCTTAGTTCAGG - Exonic
998002365 5:138635205-138635227 GCCAGAGGGCTGCAGAGGGCTGG + Intronic
1001674060 5:173497897-173497919 GCAAGTGGCCGGCTGTGGGATGG + Intergenic
1002044845 5:176536190-176536212 GCCTGGAGGCCGCTGAGGGCCGG + Intronic
1002139669 5:177131588-177131610 GCCAGTCGCTGGCTGAAGGCAGG + Intergenic
1002212656 5:177608010-177608032 GCCAGTGACTGGCTGAGGGGTGG - Intronic
1003049250 6:2765422-2765444 GCCAGCGGCCGGCCGAGGGCGGG + Exonic
1003216064 6:4113683-4113705 CCCTGTGGACCTCTGAGGGCAGG - Intronic
1003482183 6:6544553-6544575 GCCAGTGGGCAGCTGGGTGCAGG + Intergenic
1004073170 6:12320865-12320887 AGCAGTGGCCTGCTGAAGGCTGG - Intergenic
1007097349 6:39221706-39221728 GTTAGGGGCCCCCTGAGGGCAGG + Intronic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1007392602 6:41558721-41558743 GCCAGTGGGCCTCTGGGGCCAGG + Intronic
1007415339 6:41688217-41688239 GCCAGGGGCTCCTTGAGGGCAGG - Intronic
1009387734 6:63106738-63106760 GCCAGTTGGCCGGTGAGGGAAGG - Intergenic
1013367582 6:109447311-109447333 GGCAGAGGCCCGGGGAGGGCAGG - Intronic
1015919820 6:138255599-138255621 GCCACAGGTCCGCTCAGGGCCGG - Exonic
1018620736 6:165727146-165727168 GCCATGGGCCCGCTGAGGGCTGG + Intronic
1018852736 6:167652966-167652988 GCCATTGGCCAGGGGAGGGCAGG + Intergenic
1018913387 6:168117322-168117344 TCCAGTGGCCTGTTTAGGGCTGG + Intergenic
1019448900 7:1086099-1086121 GCCACTCGCCCGCCCAGGGCAGG + Intronic
1019481441 7:1268682-1268704 CCCAGTGGCCCTCTTTGGGCTGG + Intergenic
1019774278 7:2903186-2903208 GGCAGTGGCTGGCTGGGGGCTGG - Intergenic
1020099576 7:5387716-5387738 GGCAGTGGCCGGCTGGGGCCTGG - Exonic
1024942183 7:54774924-54774946 GGCAGGGGCCGGCCGAGGGCGGG + Intergenic
1026838318 7:73652909-73652931 ACCAGAGGTCCTCTGAGGGCAGG - Intergenic
1026867912 7:73834710-73834732 GTCAGGGGCCAGCTGGGGGCTGG + Exonic
1026867940 7:73834851-73834873 GCCTGTGGACCGCTGGGAGCTGG - Exonic
1032456224 7:132075368-132075390 GACAGTGGCCCGGTCAGGGAAGG - Intergenic
1034285834 7:149882434-149882456 GCCTCTGGACTGCTGAGGGCTGG + Intergenic
1034349847 7:150408507-150408529 GCCAGAGCCCCTCTCAGGGCTGG + Intronic
1035205828 7:157293212-157293234 GCTCATGGCCCCCTGAGGGCAGG + Intergenic
1035406768 7:158604008-158604030 GGCAGTGGGCCCCTGAGGGTGGG - Intergenic
1037891270 8:22624920-22624942 GCCAGTGGCACTGTGAGGGCTGG - Intronic
1038552026 8:28478593-28478615 GCCAGTGGATCACTGAGGTCAGG + Intronic
1041821103 8:62033677-62033699 GACAGTGTCCTGCTCAGGGCTGG + Intergenic
1044609865 8:94080712-94080734 GCCAGTGGCAGGCAGAGGGGCGG - Intergenic
1045888574 8:107127617-107127639 GCCTCTGGCCCTCTGAGGGGAGG + Intergenic
1046758294 8:117993897-117993919 GCCATTGGCCAACTAAGGGCTGG - Intronic
1048152149 8:131904323-131904345 GTGAGTGGCCGGCCGAGGGCCGG + Intronic
1048354348 8:133641237-133641259 GACAGTGGTCCCTTGAGGGCAGG + Intergenic
1048970706 8:139643594-139643616 ACCTGTGCCCTGCTGAGGGCCGG - Intronic
1049237079 8:141517826-141517848 GACAGTGGCCAGCTTGGGGCAGG - Intronic
1049311316 8:141935333-141935355 GGCAGTGTCCCTCAGAGGGCTGG - Intergenic
1049614606 8:143570665-143570687 GCAAGTGGCCCACTCAGGCCTGG + Intronic
1050513042 9:6413971-6413993 GCCTGGGGCCCCCAGAGGGCGGG + Intronic
1056062311 9:82896491-82896513 GCCTGTTGCTCCCTGAGGGCAGG - Intergenic
1056815064 9:89795149-89795171 GGCAGTGGCACGCTAAGGGCAGG + Intergenic
1057146959 9:92764887-92764909 GCGCGGGGCCCGCTGGGGGCTGG + Intergenic
1059365958 9:113786610-113786632 ATCAGAGGCCAGCTGAGGGCTGG + Intergenic
1060516260 9:124267663-124267685 CCCAGTGGCCAGCTCAGGGGCGG - Intronic
1060528366 9:124333142-124333164 TCCAGTGGCCCGCTGCAAGCTGG + Intronic
1060557159 9:124513845-124513867 GCCAGCAGCCCTCTGAGGTCTGG - Intergenic
1060892696 9:127198744-127198766 CCCACTGGCCCGCTGGGGTCTGG - Intronic
1061498519 9:130989525-130989547 CCCAGTGGCACGCAGAGGGCAGG - Intergenic
1061780239 9:132991563-132991585 CCCAGAGGCCAGCTGAGTGCTGG - Exonic
1061903342 9:133684156-133684178 GCCAAGGGTCCGCTGGGGGCAGG - Intronic
1061919806 9:133776524-133776546 GCCTGTGGCCCAGTGAGGCCAGG - Intronic
1062035360 9:134380367-134380389 GCCAGGGGCCAGATCAGGGCTGG + Intronic
1062118714 9:134822619-134822641 GCCCCTGGCACGCTGAGGGCTGG + Intronic
1062471427 9:136707244-136707266 GCCACTGGCCACCTGTGGGCAGG + Intergenic
1062666141 9:137673663-137673685 GCCAGAGCCTCCCTGAGGGCAGG - Intronic
1189757308 X:44284178-44284200 GCCACTGGCCTGATTAGGGCCGG + Intronic
1195356030 X:104040497-104040519 GCCAGTGGCCCGCCAAGGGGGGG + Intronic
1196060649 X:111404450-111404472 TGCAGAGGCCCGCTGAGAGCAGG + Intronic
1197720555 X:129742130-129742152 GCCAGTGGACCTTGGAGGGCAGG + Exonic
1199681079 X:150225109-150225131 GCCTGTGGAGCCCTGAGGGCAGG - Intergenic