ID: 1160624452

View in Genome Browser
Species Human (GRCh38)
Location 18:80193256-80193278
Sequence TCGGCCTCACGCATGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160624437_1160624452 30 Left 1160624437 18:80193203-80193225 CCTGGGGTGTGGTCAGTACACAG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1160624452 18:80193256-80193278 TCGGCCTCACGCATGGCCTGGGG 0: 1
1: 0
2: 3
3: 4
4: 99
1160624448_1160624452 -9 Left 1160624448 18:80193242-80193264 CCAGGGGAGGAGGGTCGGCCTCA 0: 1
1: 0
2: 0
3: 21
4: 221
Right 1160624452 18:80193256-80193278 TCGGCCTCACGCATGGCCTGGGG 0: 1
1: 0
2: 3
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160624452 Original CRISPR TCGGCCTCACGCATGGCCTG GGG Intronic
900651640 1:3732733-3732755 CCGGCCTCTCGCAGGACCTGGGG + Exonic
902870309 1:19310288-19310310 TGTGCCTCAGGCCTGGCCTGAGG + Intronic
905265668 1:36753003-36753025 TTGGGCTGACGCTTGGCCTGGGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
916284772 1:163094062-163094084 TCGCCCTGTCGCATGCCCTGTGG + Intergenic
916519005 1:165546505-165546527 TCATCCTCATGCATGACCTGTGG + Intronic
918783446 1:188732368-188732390 TCGGGCTCAGGCAGGTCCTGAGG - Intergenic
1067809669 10:49417390-49417412 CTGGCCTCAAGCCTGGCCTGGGG - Intergenic
1076714720 10:132357938-132357960 GCTGCCTCACCCAGGGCCTGTGG - Intronic
1084795419 11:71501835-71501857 TCGGCCTTACTCCTGTCCTGTGG + Intronic
1092748242 12:11693581-11693603 TCGGACTCAGGAACGGCCTGTGG + Intronic
1094855655 12:34401732-34401754 TGGGCCCCACGCATGGGCGGTGG - Intergenic
1094872123 12:34604438-34604460 TGGGCCCCACGCATGTGCTGTGG - Intergenic
1097189074 12:57210900-57210922 TCACCCTCCCGCATGCCCTGGGG - Intronic
1102266713 12:111492076-111492098 TTGGTCTCACCCAAGGCCTGTGG - Intronic
1102606239 12:114069670-114069692 ACGGCATCACATATGGCCTGGGG - Intergenic
1104837177 12:131799235-131799257 TCGGCCTCACCCAGAGCCTGTGG - Intronic
1107664378 13:42673900-42673922 TCATTCTCAAGCATGGCCTGTGG + Intergenic
1107987345 13:45786806-45786828 CCAGCCTCACACTTGGCCTGGGG + Intronic
1111979702 13:95003141-95003163 TCGGCCTCCCGCCCGGCCCGGGG + Intergenic
1112940414 13:104854797-104854819 TGAGCCTCACCCAAGGCCTGCGG - Intergenic
1114614587 14:24061539-24061561 TCGGCCACCCGCATGGCCACAGG - Exonic
1116275605 14:42827660-42827682 TGGGTCTCACCCAAGGCCTGTGG + Intergenic
1116531432 14:45978039-45978061 TTGGGCTCAAGCAGGGCCTGAGG - Intergenic
1116869957 14:50061296-50061318 CAGGCCTCACTCATGGCCTTTGG + Intergenic
1116974598 14:51101581-51101603 TGGGCCTCAAGGATGGCCAGGGG + Intergenic
1117438063 14:55736303-55736325 TGGGCCCCACCCATGGCATGTGG - Intergenic
1117521222 14:56553040-56553062 TCGGTCTGAGGTATGGCCTGGGG + Intronic
1119878265 14:78078602-78078624 TGGCCCTCAAGCCTGGCCTGTGG - Intergenic
1120468066 14:84886163-84886185 TAGGTCTCACCCAAGGCCTGTGG - Intergenic
1121271534 14:92641266-92641288 CTGGCCTCAAGGATGGCCTGGGG - Exonic
1125690184 15:41589763-41589785 ACTGCATCACACATGGCCTGAGG - Intergenic
1128345704 15:66851214-66851236 TCAGCCTCCCGCATGGCCCCAGG - Intergenic
1136059098 16:27712487-27712509 TCAGCCATGCGCATGGCCTGGGG - Intronic
1141147653 16:81542996-81543018 GCGGCCTCTCGCTAGGCCTGGGG - Intronic
1141344599 16:83233258-83233280 TCGGCTTCACGCATAGCCTGTGG - Intronic
1141990263 16:87605187-87605209 CCGGGCTCACGCAGGGCATGGGG + Intronic
1142154459 16:88526868-88526890 TCGGCCTCAGTCAGGGCCTGGGG - Exonic
1144109786 17:12020813-12020835 TCGGCCTCTCGCACGGCCGAGGG - Exonic
1145144412 17:20468494-20468516 GCAGACTCACGTATGGCCTGGGG - Intergenic
1145175858 17:20699897-20699919 GCAGACTCACGTATGGCCTGGGG - Intergenic
1147895140 17:43745637-43745659 TCGTCCTCACGTATGCGCTGGGG - Intergenic
1149560669 17:57605840-57605862 TAGGCCCCACGCAGGGCCTCTGG + Intronic
1150871000 17:68910953-68910975 TGGGCCTCACCCAAGGCCTGTGG - Intronic
1151922914 17:77171195-77171217 GCGGCATCACACATAGCCTGGGG + Intronic
1157521867 18:48351156-48351178 TCGCACTCACACATGGCTTGGGG - Intronic
1160624452 18:80193256-80193278 TCGGCCTCACGCATGGCCTGGGG + Intronic
1161983577 19:7642700-7642722 GTGGGCTCACCCATGGCCTGTGG + Intronic
1162267952 19:9591440-9591462 ACTGCATCACACATGGCCTGGGG + Intergenic
1164740317 19:30571009-30571031 TGGGCCTCACGCAGGGCCTGTGG + Intronic
1166567510 19:43774227-43774249 TCGGCCTCACGCTTGGCCTCTGG - Exonic
1166757559 19:45202778-45202800 TGGGTCTCACCCAAGGCCTGCGG + Intronic
929281631 2:40086890-40086912 TGGGTCTCACCCAAGGCCTGTGG + Intergenic
929700310 2:44156916-44156938 TCTGCCTCACGCATAGACGGAGG - Intergenic
932708746 2:74047120-74047142 CCGGGCTCCCTCATGGCCTGTGG + Exonic
933389607 2:81653345-81653367 ACTGCATCACACATGGCCTGGGG + Intergenic
935478513 2:103556462-103556484 TGGGTCTCACTCAAGGCCTGTGG + Intergenic
943302714 2:186223658-186223680 TAGGTCTCACCCAGGGCCTGTGG - Intergenic
1168824048 20:797073-797095 ACTGCGTCACACATGGCCTGGGG - Intergenic
1171942890 20:31348600-31348622 TGGGTCTCATGCAAGGCCTGCGG - Intergenic
1171943022 20:31349262-31349284 TGGGTCTCACTCAAGGCCTGTGG - Intergenic
1172386162 20:34535547-34535569 TCGCTCTCACTCATGGACTGGGG + Intronic
1174188850 20:48725615-48725637 CTGTCCTCACTCATGGCCTGTGG + Intronic
1175834234 20:61983030-61983052 TCCGCCTCACTCAGAGCCTGAGG - Intronic
1182896066 22:33860553-33860575 TCAGCAGCAAGCATGGCCTGAGG + Intronic
1184466908 22:44673854-44673876 TCAGCCTCAGGTTTGGCCTGTGG - Intronic
1185216058 22:49600608-49600630 GCGGCCTCACACAGGCCCTGGGG + Intronic
1185274168 22:49943261-49943283 TCGGCCTCGCCCATGCCCAGCGG + Intergenic
949728476 3:7078299-7078321 TAGGCCTTAGGCAGGGCCTGTGG - Intronic
950117054 3:10457919-10457941 TCACCCTCACGCCTGGCCTGAGG + Intronic
950846285 3:16019024-16019046 ACTGCGTCACACATGGCCTGGGG + Intergenic
952210566 3:31225508-31225530 TGGGCCCCAAGAATGGCCTGGGG - Intergenic
954005861 3:47590029-47590051 TCGGCTTCAGCCTTGGCCTGAGG - Intronic
954807022 3:53226582-53226604 AAGGCCTCAGGCTTGGCCTGGGG - Intronic
954930209 3:54274752-54274774 CCAGGCTCACGCATGGTCTGAGG + Intronic
960659477 3:120042366-120042388 ACTGCATCACACATGGCCTGGGG - Intronic
974479020 4:62420650-62420672 TTGGCCTCAAGCAGGTCCTGAGG - Intergenic
975369422 4:73567842-73567864 CTGGACTCACCCATGGCCTGGGG - Intergenic
980106218 4:128591224-128591246 TCCACCTCACGCATGGACTTAGG - Intergenic
986756414 5:10840394-10840416 TGGGTCTCACCCAAGGCCTGTGG - Intergenic
988722442 5:33892151-33892173 TCCGCCTCCCGCATGCCCCGCGG + Exonic
992312265 5:75512146-75512168 TCCGCCTCAACCATGGGCTGGGG + Intronic
996320760 5:122212421-122212443 TTGGCCTCACTCTTGACCTGTGG - Intergenic
996832424 5:127754651-127754673 TTTGCCTAACTCATGGCCTGTGG - Intergenic
997696566 5:135865746-135865768 ACAGCCTCAGGCATGGGCTGTGG + Intronic
1002452386 5:179326293-179326315 TTGGCCTCAGCCATGTCCTGAGG + Intronic
1010596521 6:77769864-77769886 TGGGTCTCACCCAAGGCCTGTGG - Intronic
1011753107 6:90473017-90473039 TCAGAATCACCCATGGCCTGAGG - Intergenic
1012644749 6:101664975-101664997 TGGGCCCCTCGCATGGCATGTGG + Intronic
1016284889 6:142462310-142462332 TTGGCCTCACATAGGGCCTGTGG - Intergenic
1017491505 6:154949813-154949835 TGGGTCTCACCCAAGGCCTGTGG + Intronic
1023208871 7:37781868-37781890 ACGGTCTCACCCAAGGCCTGTGG + Intronic
1024281721 7:47724317-47724339 TCCTCCTCATGCATGGCCAGTGG - Intronic
1027051670 7:75025006-75025028 CCGGCCTCACCCACGGCCAGGGG + Intergenic
1027252616 7:76408598-76408620 TCTCCCTCACGCCTGGGCTGAGG - Intronic
1028181476 7:87730095-87730117 TGGGTCTCACTCAAGGCCTGTGG - Intronic
1031260064 7:119507141-119507163 TGGGTCTCACTCAAGGCCTGTGG - Intergenic
1031546078 7:123052972-123052994 TGGGTCTCACTCAAGGCCTGCGG + Intergenic
1036104557 8:5825896-5825918 ACTGCATCACACATGGCCTGGGG + Intergenic
1042980353 8:74519357-74519379 TGGGCCTCACCTAAGGCCTGTGG - Intergenic
1057788692 9:98108268-98108290 TTGGCCTGAGGGATGGCCTGGGG - Intronic
1058676631 9:107405698-107405720 TCGGCTTCACGCCTGGAATGAGG + Intergenic
1061154225 9:128847388-128847410 TCTGCCACCTGCATGGCCTGGGG - Intronic
1061750992 9:132776882-132776904 TTGGCCCCAAGTATGGCCTGTGG - Intronic
1190457252 X:50638268-50638290 TAGGCCGCACTCATGGCATGTGG - Exonic
1190507833 X:51145258-51145280 TGGGTCTCACTCAAGGCCTGTGG + Intergenic
1191834084 X:65445617-65445639 TGGGTCTCACCCATGGTCTGTGG + Intronic