ID: 1160625105

View in Genome Browser
Species Human (GRCh38)
Location 18:80198735-80198757
Sequence AAGTATTCACATATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160625105 Original CRISPR AAGTATTCACATATGGAGAA TGG Intronic
900615471 1:3563765-3563787 CAGTGTTCACATCTGTAGAATGG - Intronic
900775233 1:4578781-4578803 AAGTATTCAAATAGGAAGAGAGG - Intergenic
902756768 1:18553981-18554003 CAGTATTCCCATCTGCAGAATGG - Intergenic
904461287 1:30681645-30681667 AGGGATTCAAATATGGAGGAGGG + Intergenic
904896839 1:33824062-33824084 CAGTTTTCACATCTGTAGAATGG - Intronic
906095904 1:43223791-43223813 CAGTCCTCTCATATGGAGAATGG + Intronic
906446039 1:45898925-45898947 AAGAATGCCCATATGGAGCATGG - Intronic
907205727 1:52768903-52768925 AAGAATTCAAAGATAGAGAAAGG - Intronic
908723654 1:67152418-67152440 AAGTATTCAAATAGGAAGAGAGG - Intronic
909438060 1:75667108-75667130 AAGTATTCAAATAGGAAGAGAGG + Intergenic
909485818 1:76172514-76172536 AGGTATTCAAATAGGAAGAAAGG + Intronic
911505059 1:98738641-98738663 AACTCTTCATAAATGGAGAAGGG - Intronic
911561577 1:99412505-99412527 AAGTATTCAGATAGGAAGAGGGG - Intergenic
913167179 1:116199215-116199237 CAATATTCGCTTATGGAGAAAGG - Intergenic
916275879 1:162992587-162992609 AAGGACTCTCACATGGAGAATGG - Intergenic
917019774 1:170573397-170573419 GAGTATTCAGATAGGAAGAAAGG + Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
918037707 1:180891930-180891952 GATTATTCACATAGGTAGAATGG - Intergenic
918651627 1:186971428-186971450 AAGTATATAAATTTGGAGAAAGG - Intronic
919164736 1:193877741-193877763 GAGTATTCAAATATGAAGAGAGG - Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919381227 1:196863870-196863892 ACGTATTCAAATAGGAAGAAAGG - Intronic
920799110 1:209170767-209170789 CAGTATTCTCATCTGTAGAATGG - Intergenic
920873533 1:209813872-209813894 AAGTCTTCACAAAAGGAGAGGGG + Intergenic
922216533 1:223524570-223524592 AAGTTTTCTCATATGAAGATGGG - Intergenic
922949348 1:229545210-229545232 AACTATTCATATTTGGAAAACGG + Intronic
923943042 1:238850705-238850727 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1063033501 10:2260559-2260581 AAGTCATCACATAAGGATAAAGG + Intergenic
1063259148 10:4365242-4365264 AAATATTTACAAATTGAGAATGG + Intergenic
1063918139 10:10905090-10905112 AAGTTTCCACATCTGAAGAATGG + Intergenic
1064927608 10:20586601-20586623 AATTATTCACATATCTATAAAGG - Intergenic
1066014830 10:31230639-31230661 AAGTATTCAAATAGGAAGACAGG - Intergenic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1067995180 10:51264510-51264532 TAGTATTCACATATGTATCACGG + Intronic
1068516634 10:58033309-58033331 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1068708348 10:60102813-60102835 TAGAATTCATCTATGGAGAAGGG + Intronic
1069120408 10:64563111-64563133 ATGTATTCAGATAGGAAGAAAGG - Intergenic
1069165994 10:65159711-65159733 AGGCATTCATATATGGTGAAGGG - Intergenic
1069699524 10:70411822-70411844 AAGTATATACATTGGGAGAAGGG - Intronic
1071340904 10:84647610-84647632 GAGTATTCAAATAGGAAGAAAGG - Intergenic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1072343501 10:94479354-94479376 AAGTATTAACATAATGAAAAGGG + Intronic
1073199795 10:101726125-101726147 AAACATTAACATATGGACAAAGG - Intergenic
1073314566 10:102569983-102570005 AGGTCTTCCCATATGGAAAAGGG + Intronic
1074307719 10:112294324-112294346 CAGTATTCACATCTGTAAAATGG - Intronic
1074329950 10:112496266-112496288 AAGTATTTACATATGAAGGTTGG + Intronic
1077396040 11:2322017-2322039 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1077558350 11:3239050-3239072 AAGAATTCAGATAGAGAGAAAGG + Intergenic
1078492168 11:11779521-11779543 AATTATTCAGATAAGGGGAAGGG + Intergenic
1078545358 11:12243001-12243023 AAGTAAACACAGATCGAGAAAGG + Intronic
1078763401 11:14270668-14270690 AAGTATTCACAGAAGGGAAAAGG + Intergenic
1080698858 11:34626894-34626916 AAGTTTTCTCATCTGGAAAATGG + Intronic
1081009015 11:37784306-37784328 GAGTATTCACATAGGAAGAGAGG + Intergenic
1081124800 11:39309649-39309671 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1081820138 11:45984998-45985020 AACTTTTCACAAATGCAGAAAGG + Intronic
1083020059 11:59497521-59497543 AAGTGTTGAGATCTGGAGAAGGG + Intergenic
1084077244 11:66789436-66789458 AATTATTCAAACATGGAGAAAGG - Intronic
1084840970 11:71847296-71847318 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1085875478 11:80402243-80402265 GATTACCCACATATGGAGAACGG - Intergenic
1086542212 11:87926555-87926577 AAGAATTTACCTATTGAGAATGG + Intergenic
1086820407 11:91429573-91429595 AGGTATTCACATAGGGAGAGAGG - Intergenic
1086912855 11:92493161-92493183 AAATATTCATTTCTGGAGAATGG - Intronic
1087232520 11:95682267-95682289 CAGTTTTCTCATTTGGAGAATGG - Intergenic
1087294075 11:96349404-96349426 GAGTATTCAAATAGGAAGAAAGG - Intergenic
1087306140 11:96491131-96491153 AGGTATTCAAATAGGAAGAAAGG + Intronic
1087436030 11:98118782-98118804 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1087846382 11:102978265-102978287 AAGTATTCAGATAGGAAGAGAGG - Intergenic
1087910303 11:103744819-103744841 AAGTAATCAAAAATGGACAAAGG - Intergenic
1088074799 11:105834225-105834247 AAGGATTGAGATATGGAGTAGGG - Intronic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088383976 11:109231259-109231281 TAGTATTCACATATGGATAGGGG + Intergenic
1088472740 11:110203578-110203600 TAATAATCACATATGGAAAATGG - Intronic
1088698765 11:112392850-112392872 AAGTCTTCACATTTGGAGGAGGG + Intergenic
1089706151 11:120279455-120279477 AAGTAACCACACAGGGAGAAGGG - Intronic
1090712788 11:129402964-129402986 AGGTATTCAGATGAGGAGAATGG + Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091081707 11:132675793-132675815 AAGTATTAATAAATGGAAAATGG + Intronic
1092394024 12:8109262-8109284 AAGTATTAAAGTATGAAGAAGGG - Intergenic
1092514197 12:9191318-9191340 AGGTAGTTAGATATGGAGAATGG - Intronic
1092952467 12:13519842-13519864 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1093550727 12:20407223-20407245 AAGTAATAACATTTGGAGATAGG - Intronic
1094002391 12:25708775-25708797 TAGTATTCAGATATTGAGAAAGG - Intergenic
1095231124 12:39741481-39741503 AAGGCTTCAGATATGAAGAAGGG + Intronic
1095557415 12:43523670-43523692 AAGTATTCACCCAGGGAGTAGGG - Intronic
1097317357 12:58186273-58186295 AAGATTTCACATATGCAGAGAGG - Intergenic
1097410498 12:59246691-59246713 AAGTATTCAAATAGGAAGACAGG + Intergenic
1097487322 12:60221518-60221540 AATTATTAACTTATGGAGGATGG - Intergenic
1098688987 12:73463456-73463478 ATGTATTCAAATAGGGAGAGAGG - Intergenic
1098813796 12:75130747-75130769 AAGTTTTCACATATTGTGAAAGG + Intronic
1099606063 12:84802498-84802520 AAATGTTCTCATATGGAGATAGG - Intergenic
1099874369 12:88386418-88386440 TTGTCTTCAAATATGGAGAAAGG - Intergenic
1100004255 12:89874877-89874899 TAGTTTTCTCATCTGGAGAATGG + Intergenic
1100164095 12:91896428-91896450 GAGCATTCACATAAGCAGAATGG + Intergenic
1101861244 12:108484088-108484110 CACTTTTCCCATATGGAGAAAGG - Intergenic
1102933167 12:116877759-116877781 AAGTTTTCCCATATGTAAAATGG - Intronic
1103079361 12:118011095-118011117 CAGTATTCACATCTGTAAAATGG - Intergenic
1105320093 13:19311284-19311306 AGGTATTTACATATGAAGAGAGG - Intergenic
1105644266 13:22300186-22300208 TAGTAGACACATATGGATAATGG + Intergenic
1106202923 13:27557707-27557729 TAGATTTCACATCTGGAGAAGGG - Intronic
1107241083 13:38234909-38234931 AGGTATTCAAATATGAAGAGAGG + Intergenic
1108480071 13:50860089-50860111 GCGTATTCAAATATGGAGAAAGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108675932 13:52738241-52738263 AAGTGTTCACCTATGTAAAAGGG - Intronic
1108905327 13:55463610-55463632 AAGTCTGCACATACAGAGAAAGG + Intergenic
1109294004 13:60507800-60507822 GAGTATTCACATAGGAAGAGAGG + Intronic
1109862592 13:68219907-68219929 AAGTAATCACAGATTTAGAAGGG + Intergenic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111470062 13:88669548-88669570 ATGTATTCAAATATTCAGAAGGG + Intergenic
1112175703 13:97021538-97021560 AATTATTCACATATATACAATGG + Intergenic
1113474527 13:110571001-110571023 AAGTATTAAACTATGGGGAAGGG + Intergenic
1113563502 13:111302913-111302935 AAGGATACACATTTGGGGAAAGG + Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1115284441 14:31701924-31701946 AACTATTCACATATTGCAAAGGG - Intronic
1115359608 14:32486780-32486802 GAGTATTCACATAGGAAGAGAGG - Intronic
1115529398 14:34313142-34313164 AAGTGTCCACACATAGAGAATGG + Intronic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1116845163 14:49858592-49858614 GACTATTCACAGATAGAGAAGGG - Intergenic
1117502725 14:56369978-56370000 GAGTATTCAAATAGGAAGAAAGG - Intergenic
1117600476 14:57368766-57368788 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1117852422 14:59989280-59989302 AAGATTTCACATATGGATAATGG - Intronic
1118966169 14:70587886-70587908 AAGAATTAAAATATGGAAAAAGG + Intronic
1119353151 14:73982962-73982984 AAGTATTCATATAGGGAAAAGGG + Intronic
1119729385 14:76941492-76941514 AAGTTTTCATATCTGGAAAATGG - Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121514747 14:94542183-94542205 CAGTTTTCACATCTGGAAAATGG - Intergenic
1121938194 14:98040405-98040427 AATTTTTTACATAAGGAGAAAGG + Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1125490678 15:40146482-40146504 ATGTATACACATATAGAGAGAGG + Intergenic
1125783154 15:42289696-42289718 ATGTATTTACCTATAGAGAATGG + Intronic
1125861324 15:43003721-43003743 AATTATTCAAATAAGAAGAAAGG + Intronic
1126206410 15:46049946-46049968 TAATTTTCGCATATGGAGAAAGG + Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1127488628 15:59441466-59441488 AAGTAGTCACATAGGGCCAATGG + Intronic
1129094961 15:73196788-73196810 AAATATTGACATACAGAGAAGGG - Intronic
1130157246 15:81362195-81362217 AAGTATTTACACCTGGAGAGTGG - Intronic
1130763314 15:86843360-86843382 AATAATTCACAAATGGTGAAAGG + Intronic
1131540992 15:93275224-93275246 CAGTTTTCACATGTGTAGAATGG - Intergenic
1131725795 15:95223147-95223169 AACTTTTCAAACATGGAGAAAGG - Intergenic
1135196447 16:20398926-20398948 GAGTATTCTCATCTGGAGATTGG + Intronic
1135918026 16:26623638-26623660 CAGTTTTCCCATCTGGAGAATGG - Intergenic
1136645756 16:31613080-31613102 GGGTATTCACATAGGAAGAAAGG + Intergenic
1136855469 16:33652870-33652892 ACGTATTCAAATAGGAAGAAAGG + Intergenic
1138851753 16:60637547-60637569 AAGTAGTCACATATGGCAAATGG + Intergenic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1140843784 16:78867062-78867084 AAGTATTCACAATTGGAGAAGGG + Intronic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1203117055 16_KI270728v1_random:1501351-1501373 ACGTATTCAAATAGGAAGAAAGG + Intergenic
1152580461 17:81163465-81163487 AAGATTTCACATGTGCAGAACGG + Intronic
1152902805 17:82954171-82954193 GAGTATTCAGATATGAAGAGAGG + Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1155557931 18:27042398-27042420 GAGTATTTACACATGGAGATTGG - Intronic
1155808170 18:30198405-30198427 GAGTATTCAAATAGGAAGAAAGG + Intergenic
1155852967 18:30795515-30795537 AAGTAATAAAATATGCAGAAAGG + Intergenic
1156172681 18:34505360-34505382 AACTCTTCAGATAAGGAGAATGG - Intronic
1156563839 18:38160831-38160853 AATAATTCACATATGAAGATTGG + Intergenic
1157212229 18:45753455-45753477 AACTAGTTACATAAGGAGAAAGG - Intergenic
1158308402 18:56132012-56132034 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1168081299 19:54012342-54012364 ACGTATTTACAGAGGGAGAAAGG - Exonic
925742011 2:7014002-7014024 CAGTTTTCACATATGAAAAATGG + Intronic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927052301 2:19342408-19342430 AAATTTTCAAATATGGAAAAAGG + Intergenic
927440262 2:23110941-23110963 GGGTATTCAAATATGAAGAAAGG - Intergenic
929361193 2:41093182-41093204 AGGTATTCAAATAGGAAGAAAGG + Intergenic
929891465 2:45922039-45922061 AAGAATTCCCCTATGCAGAAAGG - Intronic
929905988 2:46047023-46047045 AAGAATTCACTTCAGGAGAAGGG - Intronic
931190741 2:59997794-59997816 TAGAAGTCACACATGGAGAAAGG + Intergenic
931816890 2:65913097-65913119 AAGTATTGACATATAGAGCATGG - Intergenic
931999577 2:67872276-67872298 AACTGTTGACAGATGGAGAATGG + Intergenic
932783566 2:74579560-74579582 CAGTTTTCTCATATGGAAAATGG + Intronic
933639738 2:84746835-84746857 AAGCTTTTACATATGGTGAAAGG + Intronic
935266588 2:101400332-101400354 AACTGATCACATATGGAGATGGG - Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936854705 2:116942829-116942851 AAGTTTTCACAAATAGAGAGTGG + Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940778748 2:157911007-157911029 AAGTTTTCACACAGGAAGAAAGG - Intronic
941376188 2:164733903-164733925 AAGTAGACACATTTGGTGAATGG + Intronic
942313576 2:174678968-174678990 TGGTATTTACCTATGGAGAAAGG + Intronic
942407660 2:175672817-175672839 GAGTATTCAAATATGAAGAGAGG + Intergenic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
943199925 2:184809285-184809307 AAGTATACACATAAGTGGAAGGG + Intronic
943352855 2:186816001-186816023 AGGTATTCACATAGGAAGAGAGG + Intergenic
944907173 2:204273955-204273977 AAGTAGACACATGTGGCGAATGG + Intergenic
945755120 2:213836583-213836605 AAGTATTAAGATTTGGAAAAAGG - Intronic
946294910 2:218776389-218776411 ATGTATTCATATAAGGAGCAAGG + Intergenic
946838003 2:223791709-223791731 AAGTATTCAGATAGGAAGAGAGG + Intronic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
947093409 2:226539332-226539354 AAGTATTCTGATATGAAGTACGG - Intergenic
948429093 2:237907920-237907942 TAGTATTTACATATGGAAATGGG + Intronic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1173400297 20:42720299-42720321 CAGTATTCACATATGTAAAATGG - Intronic
1173669469 20:44788210-44788232 AAGTGTTCACATGTGGCTAATGG - Intronic
1173950387 20:46988354-46988376 AAGTTTTCTCATCTGGAAAATGG - Intronic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1177092275 21:16783958-16783980 GAGTATTCAGATAGGAAGAAAGG + Intergenic
1177133539 21:17285893-17285915 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1182262318 22:29082928-29082950 AAGTTTTCACATAAGGATACAGG - Intronic
1182720698 22:32396542-32396564 ATGCATTCACATATTGAGAAAGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1185068322 22:48642991-48643013 AAGTGTTCTCATTTGGGGAATGG + Intronic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
949250454 3:1977474-1977496 AGGTATTCACATAGGAAGAGAGG + Intergenic
949369794 3:3322314-3322336 AAATATTAACATATGCAGAAAGG + Intergenic
949955446 3:9264398-9264420 AAGTATTCAAATAGGAAGAGAGG + Intronic
951015144 3:17723225-17723247 AAATAATCACACATAGAGAATGG - Intronic
951993003 3:28696856-28696878 AAGATTTCACAGATTGAGAAAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953368649 3:42368518-42368540 AAGTATTCTCAGATTGTGAAAGG - Intergenic
953816156 3:46159071-46159093 GAGTATTCAGATAGGAAGAAAGG - Intergenic
954565507 3:51596655-51596677 AAATATTCACATACGAAAAAGGG - Intronic
955677175 3:61460962-61460984 AAGTAATCACAACTGGAGAAAGG - Intergenic
956109472 3:65856159-65856181 AAATAGTCACATATGGCTAATGG + Intronic
956397717 3:68843481-68843503 GGGTATTCAAATAGGGAGAAAGG - Intronic
956993872 3:74800940-74800962 CTGTATTTACATTTGGAGAAAGG - Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957700347 3:83702201-83702223 CAGTATTCAAATATGAAGAGAGG - Intergenic
957755423 3:84478665-84478687 AATTTTCCAAATATGGAGAAAGG + Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
958759201 3:98287620-98287642 AAGTATTCAAATAGGAAGAGAGG - Intergenic
959416620 3:106083879-106083901 AATCATTCACATATGGGAAAGGG - Intergenic
959801370 3:110499205-110499227 GAGTATTCAAATAGGAAGAAAGG + Intergenic
959912548 3:111779842-111779864 AAGTATTTCCATATAGAGGATGG - Intronic
960449690 3:117791151-117791173 AAATATTCCCATATGGAAATGGG - Intergenic
960855660 3:122099708-122099730 AAGTAGTCACATATGGCTAGTGG - Intronic
962180693 3:133203256-133203278 GAGTATTCAAATAGGAAGAAAGG - Intronic
962653891 3:137523042-137523064 AAGTATTTAAATATGGACAATGG - Intergenic
963006420 3:140730048-140730070 AAGTATAAATATATGGAAAAAGG + Intergenic
963118203 3:141751796-141751818 CAGTAGTCACATATGGATAGTGG + Intergenic
963677618 3:148332671-148332693 AAATATTTACATATGGTCAATGG + Intergenic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
963973683 3:151457456-151457478 AAGTGTTCACAAATAGAAAAAGG - Intronic
965313315 3:167159039-167159061 ATGTATGCAGATATGGAGATGGG - Intergenic
965849245 3:173002757-173002779 ACATATTCATATATGGAAAATGG + Intronic
966240031 3:177745583-177745605 AAGTATTTGCATTTAGAGAATGG - Intergenic
966628361 3:182044509-182044531 AAGTATTCAAATAGGAAGAGAGG - Intergenic
969520136 4:7673165-7673187 ATGTATTCCAATATTGAGAATGG - Intronic
969696382 4:8737483-8737505 ATGTGATCACATTTGGAGAAAGG + Intergenic
969782068 4:9413322-9413344 AAGTATTCAAATAGGAAGAGAGG - Intergenic
971917071 4:32885029-32885051 AGCTATTATCATATGGAGAAAGG - Intergenic
974104752 4:57457043-57457065 GAGTATTCACATAGGAACAATGG + Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974271848 4:59660119-59660141 AAGTATTCAAATAGGAAGAGAGG + Intergenic
974754504 4:66186131-66186153 AAGTATTAACACATTTAGAAAGG - Intergenic
974912867 4:68144866-68144888 AGTTATTCACATAGGGAGAGAGG - Intergenic
975297947 4:72755556-72755578 GAGTATTCAAATAGGGAGACAGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
976183714 4:82423847-82423869 AAATATTTACATATTCAGAAAGG - Exonic
976652310 4:87449130-87449152 TACTATTCACAGATGGAAAAGGG + Exonic
976688680 4:87844749-87844771 TACTATTCAAATATGCAGAAGGG - Intronic
977543893 4:98351983-98352005 AAGTATATACATATGTATAAAGG - Intronic
977573742 4:98656519-98656541 ACATTTTCACAAATGGAGAAGGG + Intronic
977631100 4:99244184-99244206 ATGTATTCAAATAGGAAGAAAGG - Intergenic
978576106 4:110191526-110191548 AATTTTTCACATATGGACACAGG - Intronic
978906237 4:114009118-114009140 GGGTATTCACATAGGAAGAAAGG - Intergenic
979138563 4:117143923-117143945 CAGTTCTCAAATATGGAGAAGGG - Intergenic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
980233779 4:130077811-130077833 AAGTATTAATATATGGGAAATGG + Intergenic
980944676 4:139307650-139307672 AAATAGTCACATGTGGTGAATGG + Intronic
983095901 4:163561933-163561955 AAGGGTTGACATTTGGAGAAAGG - Intronic
983169265 4:164517554-164517576 AGGTATTCAAATAGGAAGAAAGG - Intergenic
984033972 4:174642622-174642644 AATTATTCACATCTTGCGAATGG + Exonic
984602598 4:181745606-181745628 AAGTAAGCACAAATGCAGAAAGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985249159 4:188005854-188005876 AAGTAGTTACATACGGATAAAGG + Intergenic
985893434 5:2734254-2734276 AAGTGTTCACAGATAGAAAAGGG - Intergenic
987956892 5:24751766-24751788 GAGTATTCACATAGGAAGAGAGG - Intergenic
987982796 5:25109328-25109350 ATGTACTCACATATAGAAAAAGG + Intergenic
987995244 5:25268636-25268658 AGGCATTCACATATGTACAAAGG - Intergenic
988294361 5:29335765-29335787 AGGTATTCAAATAGGAAGAAAGG + Intergenic
988402484 5:30779595-30779617 AAGTATTCAAATAGGAAGAGAGG + Intergenic
990805189 5:59652723-59652745 AAGTATTGAGATTTGAAGAATGG - Intronic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991137446 5:63198704-63198726 AAGTATGTAAATATGAAGAATGG + Intergenic
992010380 5:72519687-72519709 AATTATTCAAATTTAGAGAAAGG - Intergenic
993559674 5:89390343-89390365 AAATCTTCACATATTGACAATGG + Intergenic
993604360 5:89970085-89970107 AAGGAATCAAAGATGGAGAATGG + Intergenic
994128758 5:96199804-96199826 AATTATTGACATATGTTGAAAGG - Intergenic
994512010 5:100716186-100716208 AGGTATTCACATAGGAAGAGAGG - Intergenic
995196705 5:109378442-109378464 AAGTGTTCAAAGATGGAGAGAGG - Exonic
995294103 5:110498663-110498685 AAGTCTTCCCATATGCAGAATGG + Intronic
995503860 5:112838057-112838079 TAGTATTCAAATATGGTGAAAGG - Exonic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
996280318 5:121722337-121722359 ATGTATTCAGATATGAAGAGAGG - Intergenic
997054087 5:130419796-130419818 AGGTATTCAGATAGGAAGAAAGG + Intergenic
997704343 5:135932635-135932657 CAGTATTCTCACATGAAGAATGG + Intronic
998028832 5:138845862-138845884 AAATATTCACATATAGATATAGG + Intronic
998959686 5:147471558-147471580 ATCTAATCACTTATGGAGAAGGG + Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000306987 5:160003659-160003681 CAGTAATCACATGTGGAGAATGG - Intergenic
1000750112 5:165084793-165084815 AAGTATCCTCATATGGGGGAAGG + Intergenic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1001605056 5:172953704-172953726 AAGTTTTCACAAATGGTGATTGG + Intergenic
1003750991 6:9055754-9055776 AATTAATCCCATCTGGAGAAGGG + Intergenic
1004636034 6:17468714-17468736 AAGGATTCTCACATGGAAAATGG + Intronic
1009663441 6:66645874-66645896 AAGTTTCCAAATTTGGAGAAAGG - Intergenic
1009944970 6:70332591-70332613 AGGTATTCAAATAGGGAGAGAGG - Intergenic
1009950459 6:70389581-70389603 AAGTATTATCATATGGTGGAAGG + Intergenic
1010084114 6:71896241-71896263 AAGTCTTCTTATATTGAGAATGG + Intronic
1010301749 6:74268494-74268516 AAGTATATATAGATGGAGAAAGG + Intergenic
1010377221 6:75185150-75185172 AAGCATCCAAATATGAAGAAAGG + Intronic
1011140322 6:84147698-84147720 AAGTCTACACATTTGGAAAAAGG + Intronic
1011377279 6:86703053-86703075 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1011477512 6:87762541-87762563 AAGTGTTCACTTACAGAGAAAGG + Intergenic
1012784225 6:103602931-103602953 AAGTATTCAAATAGGAAGAGAGG - Intergenic
1012862150 6:104572800-104572822 AAATATGAACATATTGAGAAAGG + Intergenic
1013708621 6:112870981-112871003 GGGTATTCACATAGGAAGAAAGG + Intergenic
1014192818 6:118517701-118517723 AAGTATTCAGATAGGAAGAGAGG - Intronic
1015121900 6:129709317-129709339 AAGTACACAGATAGGGAGAAAGG + Intronic
1015386333 6:132628405-132628427 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1017837570 6:158192943-158192965 AAGTATTCTCATAGGGAATAAGG - Exonic
1018104938 6:160476600-160476622 AAGTATTCATATATGGTCTAGGG - Intergenic
1018538265 6:164847607-164847629 AAGTATTCACAGTTGAAGTAAGG - Intergenic
1018679043 6:166248541-166248563 AAATATTCACAAAAGGACAATGG - Intergenic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020847036 7:13298910-13298932 AAGTATGTACCTATAGAGAAGGG - Intergenic
1020971371 7:14945090-14945112 AAATATTCACATCAGAAGAACGG + Intronic
1021077702 7:16325198-16325220 AAGAATTCACAAGTTGAGAAAGG + Intronic
1021557183 7:21931837-21931859 AAGTATTCAAATAGGAAGAGAGG + Intronic
1021748964 7:23775793-23775815 AGGTATTCACATAAGAAGACAGG - Intronic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1023295934 7:38715201-38715223 AAGTAATCACATGGGGAGAGAGG + Intergenic
1023296322 7:38718453-38718475 AAGTGTTCTCAGATGCAGAATGG + Intergenic
1023616791 7:42028433-42028455 AAGCATTCACAGACGGATAAGGG + Intronic
1023918126 7:44606003-44606025 AAGTATTAAAATTTGGGGAAAGG - Intergenic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024031176 7:45461046-45461068 TGGTATTCCCATCTGGAGAAAGG + Intergenic
1025152003 7:56563130-56563152 AATTATTCATATATGAAGATTGG - Intergenic
1027733056 7:81900672-81900694 AAGGACTCACATAAGGTGAAGGG - Intergenic
1027735089 7:81921583-81921605 AAGTCTTAACATATGGGAAATGG - Intergenic
1028066150 7:86387475-86387497 AAATATTCAGATATGGAATATGG - Intergenic
1028835777 7:95373507-95373529 AAGTCAGCACATCTGGAGAAGGG + Intronic
1028859963 7:95638066-95638088 AAGTCTTCATCAATGGAGAATGG - Intergenic
1029039865 7:97561693-97561715 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029583482 7:101453991-101454013 ATGTATAGACATATGTAGAAAGG - Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1031533373 7:122903685-122903707 AAGTTCTCACTTAGGGAGAAAGG - Intergenic
1032568374 7:132972066-132972088 AAATATATACATATGGGGAAGGG + Intronic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033113264 7:138602221-138602243 AAATACTCACATGTGGACAAAGG + Intronic
1033861923 7:145639174-145639196 ACGTGTTCACATATGGTGAGAGG + Intergenic
1034375183 7:150636621-150636643 TGGTATTCACATAGGGAGAGAGG - Intergenic
1034643257 7:152621728-152621750 AATTATTCATTTTTGGAGAAAGG + Intergenic
1035829097 8:2675549-2675571 AATTACTCAGATACGGAGAAAGG + Intergenic
1036086280 8:5616606-5616628 TGGTATTCCCACATGGAGAAGGG - Intergenic
1036094506 8:5709079-5709101 AAGTATTAACGTATGGAAAGAGG - Intergenic
1036837068 8:12081113-12081135 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1036858862 8:12327358-12327380 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1037289930 8:17339643-17339665 AAATGTTCATAAATGGAGAATGG - Intronic
1037380189 8:18276930-18276952 AAGCATTCACACCTGTAGAAGGG + Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1040728756 8:50416738-50416760 AAGTCTTCATTTATGGAAAAAGG - Intronic
1041845546 8:62323651-62323673 AAGCATTGACAAATGGAGAGAGG - Intronic
1042011520 8:64250894-64250916 AAATATTTACATATTGAGAGTGG + Intergenic
1042111322 8:65384122-65384144 AGGTATTCAAATAGGGAGAGAGG + Intergenic
1042982168 8:74541591-74541613 AAGTTTTTACATATATAGAATGG + Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044332371 8:90936253-90936275 AAGCATTCACTAATGGAAAAGGG - Intronic
1045378882 8:101603096-101603118 ATGTATTCACATTTGGATCAAGG - Intronic
1045596784 8:103665720-103665742 AAGTATTCTCATTTGGAATAAGG - Intronic
1046047579 8:108982578-108982600 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1046093644 8:109532981-109533003 AAGTTTCCTCATTTGGAGAAGGG - Intergenic
1046288040 8:112120877-112120899 AAATATTAATATATGAAGAAGGG - Intergenic
1047471796 8:125181494-125181516 AAATTTTCAAATATGCAGAAAGG - Intronic
1051046941 9:12886962-12886984 CTGTTTTGACATATGGAGAAAGG - Intergenic
1051474306 9:17487187-17487209 AAGTATTCCAATAGGTAGAAAGG + Intronic
1052187354 9:25615033-25615055 GAGTATTAACATATGTTGAATGG - Intergenic
1052386896 9:27833388-27833410 AGGTATTCAAATAGGAAGAAAGG - Intergenic
1052470229 9:28884570-28884592 AATTATTTACAGATGGACAAAGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1053047139 9:34929128-34929150 AAATATTCAGATAGGGAGAAGGG - Intergenic
1053253305 9:36593417-36593439 ATGTATTCTCATATGGTGGAAGG - Intronic
1054838686 9:69710165-69710187 CAGTAGTCACATATGGCTAAGGG - Intronic
1054998116 9:71416061-71416083 AAATATTCATTTATTGAGAAGGG - Intronic
1055193867 9:73562740-73562762 GAGTATTCAAATAGGAAGAAAGG + Intergenic
1055302413 9:74896113-74896135 AAAAATTTACATATGTAGAATGG + Intergenic
1056578780 9:87875215-87875237 AAGCATTAACATAGTGAGAATGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059798294 9:117723922-117723944 AAGCATTCACATATGGTAAGAGG - Intergenic
1060131882 9:121108886-121108908 AAGTATTAATATCTGGGGAATGG - Intronic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1060900056 9:127249263-127249285 AAGTATTCTCATGTGCAAAATGG + Intronic
1061104822 9:128521875-128521897 GAGTACTCACATATGGTTAAAGG - Intronic
1062033722 9:134373450-134373472 CAGTATTCTCATCTGGAAAATGG - Intronic
1062298108 9:135845544-135845566 GAGTATTCAAATAGGAAGAAAGG + Intronic
1186688747 X:11952550-11952572 AAGCTTTCACATCTGGAAAAGGG - Intergenic
1187347128 X:18476015-18476037 AAGCATTCACATTTGAACAAAGG + Intronic
1188319342 X:28716358-28716380 GAGTATTCAAATAGGGAGAGAGG + Intronic
1188466240 X:30484831-30484853 AAGTTTTCTCATCTGCAGAATGG - Intergenic
1188466560 X:30488143-30488165 AAGTTTTCTCATCTGCAGAATGG - Intergenic
1189039376 X:37526417-37526439 AAGTATTCAAATAGGAAGAGAGG - Intronic
1189060676 X:37749710-37749732 TATTATTTACATGTGGAGAAGGG - Intronic
1189510376 X:41655963-41655985 AGGGATGCCCATATGGAGAATGG + Intronic
1189516148 X:41715247-41715269 AGGGATGCCCATATGGAGAATGG + Intronic
1189938154 X:46091293-46091315 AAGTATTCAAATAGGAAGAGAGG + Intergenic
1190876041 X:54460971-54460993 AAGTTTTCTCACATGTAGAATGG - Intronic
1192119696 X:68443640-68443662 CAGTTTTCTCATCTGGAGAATGG - Intergenic
1193010886 X:76673924-76673946 GAGTATTCACATAGGAAGAGAGG + Intergenic
1193752734 X:85366196-85366218 AGGTATTCTCTTATGGAGAGGGG + Intronic
1193795052 X:85863988-85864010 AATTATTTACATATTGGGAAAGG - Exonic
1193835273 X:86335712-86335734 AAGTATTCAAATAGGAAGAGAGG - Intronic
1194190906 X:90836216-90836238 AAATATTCACATTTGGGGAGTGG + Intergenic
1195882535 X:109607569-109607591 AGGTATTCAAATAGGAAGAAAGG + Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196284098 X:113859718-113859740 AGGTATTCACATAGGAAGAGAGG - Intergenic
1196553005 X:117052620-117052642 AAGTGTTGACACATGGAAAAGGG - Intergenic
1196993783 X:121358329-121358351 AAGTCACCACATATGGGGAAAGG - Intergenic
1198361480 X:135899957-135899979 GAGTATTCAAAAAGGGAGAAAGG - Intronic
1198579040 X:138043125-138043147 AGGTATTCAAATATGAAGAGAGG + Intergenic
1198692060 X:139295166-139295188 ATGAATTCACCTAGGGAGAATGG + Intergenic
1199954123 X:152728758-152728780 AAGAATGGACATATTGAGAAAGG - Intronic
1200537567 Y:4418633-4418655 AAATATTCACATTTGGGGAGTGG + Intergenic
1200666453 Y:6031790-6031812 GAGTATTCAAATAGGAAGAAAGG + Intergenic