ID: 1160627716

View in Genome Browser
Species Human (GRCh38)
Location 18:80223988-80224010
Sequence GGCTGGGTAAGGAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 553}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160627707_1160627716 3 Left 1160627707 18:80223962-80223984 CCAGTTAAAATGGACCCAACAGT 0: 1
1: 0
2: 0
3: 10
4: 355
Right 1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG 0: 1
1: 0
2: 5
3: 49
4: 553
1160627705_1160627716 25 Left 1160627705 18:80223940-80223962 CCAGCTGGCAGGGCTGGCTTTTC 0: 1
1: 0
2: 1
3: 17
4: 290
Right 1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG 0: 1
1: 0
2: 5
3: 49
4: 553
1160627704_1160627716 26 Left 1160627704 18:80223939-80223961 CCCAGCTGGCAGGGCTGGCTTTT 0: 1
1: 1
2: 0
3: 31
4: 257
Right 1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG 0: 1
1: 0
2: 5
3: 49
4: 553
1160627703_1160627716 30 Left 1160627703 18:80223935-80223957 CCAACCCAGCTGGCAGGGCTGGC 0: 1
1: 0
2: 2
3: 41
4: 486
Right 1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG 0: 1
1: 0
2: 5
3: 49
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160627716 Original CRISPR GGCTGGGTAAGGAGGACAGA GGG Intronic
900185099 1:1329182-1329204 GGCTGGGTTGGGAGGACGGTTGG + Intergenic
900690783 1:3978994-3979016 GGGTGGGTAATGGGGTCAGAAGG + Intergenic
900895037 1:5477547-5477569 GACTGAGTCAGGAGGACAGTGGG - Intergenic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901599902 1:10415241-10415263 GGCAGAGTAAGGAGGAAAGTCGG + Intronic
902249346 1:15143489-15143511 GGCTGGGTAATGGGGAGTGAAGG + Intergenic
902603831 1:17557789-17557811 GGCTTGGTAAAGGAGACAGACGG + Intronic
902660128 1:17895185-17895207 GACTGGAAAAGGGGGACAGAGGG + Intergenic
903078013 1:20787029-20787051 GGCCGGGTAAGGCAGACAAAAGG + Intronic
904081293 1:27873906-27873928 GGGTGAGTGCGGAGGACAGATGG + Intronic
905002446 1:34683624-34683646 AGCTGGAGAAGCAGGACAGAGGG - Intergenic
905322327 1:37126938-37126960 GGCTGGGGAAGGAGGACATGAGG - Intergenic
905345922 1:37311247-37311269 AGCTCCGTAAGGAAGACAGATGG - Intergenic
905380340 1:37557275-37557297 GGATGGGGAAGGAGGTCACAGGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906514634 1:46431716-46431738 GACTGGGTAGGGAGGAGAGGTGG + Intergenic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
908172645 1:61522583-61522605 GCCTGCATATGGAGGACAGAAGG + Intergenic
909797535 1:79760769-79760791 GACTTGGTCAAGAGGACAGATGG - Intergenic
910526708 1:88187140-88187162 GGCTGAAGAAGGAGGTCAGAAGG - Intergenic
911102376 1:94104819-94104841 GGCTGGGTTTGGAAGACAGCCGG - Intronic
912369754 1:109164780-109164802 GGCTGGGCAGGGAGGATGGAGGG + Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912552704 1:110494408-110494430 GGCTGTGGCAGAAGGACAGACGG - Intergenic
912620621 1:111153119-111153141 GGATGGGTAAGGAGGAGGGGAGG - Intronic
912861468 1:113217626-113217648 GTCTGGGTCAGGAGCACAGGAGG + Intergenic
912882261 1:113427319-113427341 GACTGGGTTAGGGGGCCAGATGG - Intronic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
913006373 1:114636424-114636446 GGGAGGCCAAGGAGGACAGATGG + Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
914374757 1:147062927-147062949 GGAAGGGAAAGGAGGAGAGAAGG - Intergenic
914387251 1:147181825-147181847 GGCTGGGAAATGAAGACAGCAGG + Intronic
914938872 1:152004397-152004419 GGCAGTGAAAGGAGGCCAGAAGG + Intergenic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915235533 1:154477950-154477972 GGCTGGGGAAGGAGGAAATGGGG - Intronic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915493941 1:156267719-156267741 GGCTGGGGAAGGAGAAGAGCAGG + Intronic
915589597 1:156862935-156862957 GGCTGGGAAGGGAGGAAAGGAGG + Intronic
915916413 1:159943458-159943480 GGCTGGGTGAGCAGGCCAGCTGG - Exonic
916080576 1:161229482-161229504 GGCTGGGAAAGTAGGGCTGAAGG + Exonic
917502675 1:175599672-175599694 GGTGGGGAGAGGAGGACAGAGGG + Intronic
917692061 1:177479783-177479805 GGCTGGGAAAGGAGCAGAAAGGG - Intergenic
917788994 1:178487465-178487487 GGCTGGGTGAGGACTGCAGATGG - Intergenic
918151691 1:181802475-181802497 GGCTGGGATGGGAGAACAGAGGG - Intronic
919183445 1:194114865-194114887 GGGGCGGTAAGGAAGACAGATGG + Intergenic
919803796 1:201368929-201368951 ACCTGGGAAGGGAGGACAGAGGG - Intronic
919850947 1:201672006-201672028 GGCAGGCTAAAGAGGAGAGACGG - Intronic
919987920 1:202688855-202688877 GGCTGGGTGAGGAGGCCACCCGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920958233 1:210639207-210639229 GGATGAGTTGGGAGGACAGAAGG - Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921195278 1:212750500-212750522 GACTGGAATAGGAGGACAGAAGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922228447 1:223665654-223665676 GGCTCTGTAGGGTGGACAGAAGG + Exonic
922447344 1:225708536-225708558 AGCTGAGAAAGAAGGACAGATGG + Intergenic
922606565 1:226893315-226893337 GGTGGGGGAAGGAGGACAGCTGG + Intronic
922665739 1:227466894-227466916 GGCTGGATCAGGGGGACAGCGGG + Intergenic
922909685 1:229205109-229205131 GACTGGGTAAGGGGCTCAGAGGG - Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
924548927 1:245056002-245056024 GGCTGGGGCAGGAGGACGGCTGG - Intronic
924799271 1:247315638-247315660 GAGTGGGTAAGGAAGAGAGAGGG + Intronic
1062989462 10:1802598-1802620 GGTTAGATAAGGAGGCCAGAAGG + Intergenic
1063179801 10:3587913-3587935 GGCTGGGTGAGGACCATAGAGGG + Intergenic
1063299646 10:4840180-4840202 GCCTGGGTAAAGATGACAGCAGG - Intronic
1064143232 10:12807522-12807544 GGCAGGGTGAGGAGGAGAGAGGG - Intronic
1064144805 10:12819173-12819195 GGCTGGGAGAGGGGCACAGAGGG + Intronic
1064680772 10:17809130-17809152 GGCGGGGTGGGGAGGAGAGAGGG - Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1066996048 10:42563933-42563955 GGCTGTGGAAGAAGGAAAGAAGG - Intergenic
1067323858 10:45247872-45247894 GGGTGGGAGAGGAGGAGAGAAGG - Intergenic
1067517812 10:46968553-46968575 AACTGAGTGAGGAGGACAGAAGG - Intronic
1067644438 10:48083276-48083298 AACTGAGTGAGGAGGACAGAAGG + Intergenic
1067709344 10:48635844-48635866 GGCTGGGGAAGCAGGATGGAAGG + Intronic
1069817564 10:71208273-71208295 GACTGGGTAAGAAGGATGGAAGG + Intergenic
1069855838 10:71440598-71440620 GGCCAGGAAAGGAGGGCAGAGGG - Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070916734 10:80159893-80159915 GGCAGGCTGAGGAAGACAGATGG - Intronic
1071069409 10:81673946-81673968 GGCTGGAGCAGGAGGAAAGAGGG + Intergenic
1071096180 10:81978171-81978193 GGAGGGGTAAGGGGAACAGAGGG - Intronic
1071184194 10:83021662-83021684 GGCTGAGTAAGGAAGAAATATGG - Intergenic
1071346777 10:84701008-84701030 GGGTGGGAAGGGAGAACAGAGGG + Intergenic
1072149390 10:92673557-92673579 GGGTGGGAAAGGATGAGAGAAGG + Intergenic
1072347817 10:94526085-94526107 GGCTGGGAAGGGTGGAGAGAAGG - Intronic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072416651 10:95252166-95252188 AGCTGGGTAAGGATGAAATATGG - Intronic
1073050651 10:100664951-100664973 AGCAGGGTAAGGAGGACAGGCGG - Intergenic
1073185334 10:101612307-101612329 TGCTGGGCAGGGAGGACAGGTGG - Intronic
1073562483 10:104508815-104508837 GGCTGGGGAAGGGGGAAAGGGGG - Intergenic
1073803545 10:107069972-107069994 GGCTGGGGAATTAGGACAGTGGG - Intronic
1074290321 10:112133352-112133374 GGCTGGGGGAGGTGGAGAGAAGG + Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077308866 11:1879744-1879766 GGCTGGGAGAGGGGGACAGAGGG + Intronic
1077320331 11:1938181-1938203 GGCAAAGAAAGGAGGACAGAGGG + Intronic
1077351070 11:2093395-2093417 GGCTGGGTGATGAGGAAAGGGGG + Intergenic
1077488428 11:2849728-2849750 GGCTCTGGAAAGAGGACAGAAGG - Intergenic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1079329264 11:19520592-19520614 GGATGGGAAAGGAGGAAGGAGGG - Intronic
1080057304 11:27919679-27919701 GGCTGGGTTTGGGGGAGAGATGG - Intergenic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080708139 11:34718808-34718830 GACAGGGTAAGGAGGAATGAAGG + Intergenic
1081857055 11:46310603-46310625 GGCTGGGCAAGCAGGAGCGATGG - Intronic
1083856720 11:65396658-65396680 GGCTGGGTAAGGAGCCCACAAGG - Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1085131804 11:74046227-74046249 GGGTGGATAAGGAGGAAAGGAGG - Intronic
1085331611 11:75656653-75656675 GGGTGGGTAGGGAAGAGAGAGGG - Intronic
1085592371 11:77775697-77775719 GGCTGAGGAAGGAGGATAGCTGG + Intronic
1086236315 11:84635285-84635307 GGGTGGGTAAGGAATATAGAAGG - Intronic
1087012985 11:93530773-93530795 GGCTGGAGAAGGGGGAGAGAGGG - Intronic
1088432135 11:109770161-109770183 GGCATGGTCAGGAGGAGAGAGGG - Intergenic
1088914395 11:114216463-114216485 GGCTGGGTGACAAGGACAGGGGG + Intronic
1089306922 11:117532322-117532344 GGCTGGGAAGGGAGGACACCAGG - Intronic
1089720593 11:120416581-120416603 GGATGGGTAAGGAAGACAGAAGG - Intronic
1090238224 11:125164915-125164937 GACAGGGCAAGGAGGAGAGAGGG + Intronic
1090432944 11:126661990-126662012 GTTTGGGTAAAGAGGAAAGAAGG + Intronic
1090444425 11:126751374-126751396 TGCTGGCTAAGGAGAACAGCTGG + Intronic
1090873234 11:130766443-130766465 TGCTGGGCCAGGAGGACACAGGG + Intergenic
1091840629 12:3617908-3617930 GGCTGGGTGAAAAGGGCAGAGGG - Intronic
1091842292 12:3629817-3629839 GGCTGGGTGTGAAGGACACAAGG + Intronic
1092016234 12:5161169-5161191 GGCTGGGGAAGGACTCCAGATGG - Intergenic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1093592630 12:20922416-20922438 GGAAGGGTAAGGAGAAGAGAAGG - Intergenic
1094031177 12:26012779-26012801 GGCTGAGACAGGAGGACTGATGG - Intronic
1094731819 12:33185389-33185411 GGCTGGGTCAGGACTTCAGATGG + Intergenic
1095672419 12:44876381-44876403 GGCGGGGTAAGGAGGAGGGAGGG + Intronic
1095730861 12:45505461-45505483 GGCTGGGTAATTACAACAGAAGG + Intergenic
1096329328 12:50696193-50696215 GGCTGGGGCAGGAGGAAAAATGG - Intronic
1096882235 12:54682604-54682626 GGGTGGGTCAGGAGGACGGGAGG - Intergenic
1098003202 12:65967779-65967801 GGCTGAGGATGGAGGAGAGAGGG - Intergenic
1098110219 12:67113672-67113694 GGCAGGGTTAGGAAGAAAGAAGG + Intergenic
1098230034 12:68363858-68363880 GGCTGGGTAATGGTGAGAGAAGG - Intergenic
1099270430 12:80502174-80502196 AGCTTGGAAAGGAGGAAAGAGGG + Intronic
1101493932 12:105236035-105236057 GGCTGGGTTGGAAGGACAGAGGG + Exonic
1101522464 12:105496642-105496664 GGCAGGGAAAAGAGGAGAGAAGG - Intergenic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102425071 12:112837830-112837852 GCCTGGGGATGAAGGACAGAGGG - Intronic
1102625246 12:114229815-114229837 GGATAGGGAAGGAGGACAGAAGG + Intergenic
1102738455 12:115184299-115184321 GGTGGGGTCAGGAGGAAAGAGGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103740636 12:123088930-123088952 GGTTTAGTAAGGGGGACAGAGGG - Intronic
1103982610 12:124746297-124746319 GGCTGGGGAACGAGGCCAGGAGG - Intergenic
1104363077 12:128152240-128152262 AGCAGGGAAAGGAGGAGAGATGG + Intergenic
1104744222 12:131201014-131201036 GGCTGGGTATTGGGGACATAGGG + Intergenic
1104790157 12:131476209-131476231 GGCTGGGTATTGGGGACATAGGG - Intergenic
1105005979 12:132720847-132720869 GCCTGTGCAGGGAGGACAGAGGG - Exonic
1106471617 13:30060968-30060990 GGCTGGGGACAGAGGACAGAGGG + Intergenic
1106606567 13:31234527-31234549 TTCAGGGTAAGGAGGACAGCAGG + Intronic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1108427240 13:50315097-50315119 GGCTGGGTGAGCAGTACAGAGGG - Intronic
1110514359 13:76392272-76392294 GGCTGGGAGAGCAGGAAAGAGGG + Intergenic
1113959548 13:114119055-114119077 GGGTGGGTCAGGAGGAAAGCGGG - Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114513872 14:23285405-23285427 GGCTGGGTACGGGAGTCAGAGGG + Intronic
1115675422 14:35668143-35668165 AGCAGGGAAAGGAGGAAAGAAGG + Intronic
1117217144 14:53562335-53562357 GGCTGGGTGAGTAGGAGAAATGG + Intergenic
1118424137 14:65639723-65639745 AGCTGGGTGATGAGGACAAAAGG - Intronic
1118809453 14:69262209-69262231 GGCTGGGCAGGGAGGAGAGGAGG + Intronic
1119779048 14:77266102-77266124 GACTGGGCAGGCAGGACAGAAGG + Exonic
1121209772 14:92199550-92199572 AACAGGCTAAGGAGGACAGAGGG - Intergenic
1121335629 14:93076117-93076139 GGAGGGGAAAGGTGGACAGATGG - Intronic
1121565135 14:94903674-94903696 GACTGGGAAGGGAGGACAGGTGG + Intergenic
1121786348 14:96663931-96663953 GGTTGAGTAAGAAAGACAGAAGG + Intergenic
1121800156 14:96768512-96768534 GGCTGGGAAGGAAGGAAAGAAGG - Intergenic
1121843919 14:97156684-97156706 GGCTGGAGCAGGAGGAAAGAAGG + Intergenic
1121967852 14:98326881-98326903 AACTGGGTAAGGGGGACACAGGG + Intergenic
1122006298 14:98706633-98706655 GCCTGGGGAAGGGGGACAGTGGG - Intergenic
1122318748 14:100840834-100840856 AGTTGGGGAAGGAGGACAGTCGG + Intergenic
1122397497 14:101443772-101443794 TGCTGGGTGAGCGGGACAGAAGG + Intergenic
1122762611 14:104040686-104040708 TACTGGGAAAGGAGGACACAAGG + Intronic
1122959673 14:105088589-105088611 GCCTGGGTCCGGAGCACAGAGGG - Intergenic
1124862660 15:33458190-33458212 GGCTGGGTAGGGTAGACAGTGGG + Intronic
1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG + Intergenic
1126599997 15:50418717-50418739 GCCTGGGCAAGGACGACAGCTGG - Intergenic
1126643982 15:50856662-50856684 GGTCGGGAAAGGAGGATAGAGGG - Intergenic
1127264436 15:57350107-57350129 AGTTGAGTAAGAAGGACAGAGGG - Intergenic
1128237558 15:66078441-66078463 GGCTGCGTCAGGAGGAAAGGAGG + Intronic
1128347039 15:66860870-66860892 GCCTGGGGAAGGAGGGCAAAGGG + Intergenic
1128544042 15:68555485-68555507 GGCTGGGCAGGGGGGAGAGAAGG + Intergenic
1129077334 15:73008251-73008273 GGGTGGGGAAGGAGGAGAGGAGG + Intergenic
1129256913 15:74338943-74338965 TGGTGGGTAAGGATTACAGAGGG - Intronic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129518314 15:76170468-76170490 GGCTGGGGCAGGCGGACGGAAGG + Intronic
1129880970 15:79005797-79005819 AGGAGGGGAAGGAGGACAGAAGG - Intronic
1130350538 15:83087837-83087859 GGCTGGGAAATGAGTAAAGATGG - Intergenic
1131024389 15:89127801-89127823 GGCTGAGTATGGTGTACAGACGG - Intronic
1131056631 15:89378871-89378893 GGTTGGGTAGGCAGGAGAGAAGG + Intergenic
1131132796 15:89910878-89910900 GGCTGGGTAAATAGGAGACACGG - Intronic
1131585093 15:93684435-93684457 GCCTGGGTATGGAGCAGAGAGGG - Intergenic
1132059905 15:98683750-98683772 AGTTGGGAAAGGAAGACAGATGG + Intronic
1132859834 16:2064715-2064737 GGCTGGGCAGGGAGGACGGCAGG - Intronic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133405940 16:5524639-5524661 GGCTGAGGCAGGAGGACTGACGG - Intergenic
1133440087 16:5814201-5814223 GGCTGGGAAAGGAGGGCATACGG - Intergenic
1134011229 16:10854637-10854659 GGCTGGGTGAGGATGAAGGATGG + Intergenic
1134095677 16:11416870-11416892 GGCTGGGAGATGAGGTCAGATGG + Intronic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134440721 16:14298377-14298399 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
1135181761 16:20281058-20281080 GGAAGGGAAAGGAGGAGAGAAGG - Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135875132 16:26191790-26191812 GGGAGGGCAAGGTGGACAGATGG + Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136172122 16:28495770-28495792 GGCTGGGAAAGGAGAAGAGGTGG + Exonic
1136234703 16:28906225-28906247 GGCTGGGGCAGGAGGGCAGGAGG + Intronic
1136238962 16:28932629-28932651 GGCAGGGGCAGGAGGAGAGAAGG + Intronic
1136416528 16:30107560-30107582 GGCTGGGGAAAGATGAGAGATGG - Intronic
1136987731 16:35126524-35126546 GGTTGGAGATGGAGGACAGATGG + Intergenic
1137821170 16:51447508-51447530 GGGAGGCCAAGGAGGACAGATGG + Intergenic
1138090454 16:54169600-54169622 GGCTGGGGCAGGAGGGGAGAGGG - Intergenic
1138092882 16:54191001-54191023 GGCTGAGGAAGGTGGAAAGAGGG + Intergenic
1139134845 16:64189936-64189958 GACAGGGAAAGGAGAACAGAGGG + Intergenic
1139215838 16:65123332-65123354 GGCTGGGAAAGGAGAAGAGATGG + Intronic
1139332421 16:66203731-66203753 GACAGGGTAGGGAGGAGAGAGGG + Intergenic
1139958096 16:70702759-70702781 AGCTGGGGAGGGAGGAAAGAGGG + Intronic
1140421383 16:74822091-74822113 GGCAGTGAAAGGAGGAGAGATGG - Intergenic
1140957422 16:79878155-79878177 GGCAGGGTCAGAAGGACAGAAGG + Intergenic
1141456444 16:84145328-84145350 GGCTGGCGAAGAAGGAAAGAGGG + Exonic
1141675687 16:85516037-85516059 GGCTGGGAAAGGAGGCCTGGGGG + Intergenic
1143084543 17:4405947-4405969 CGCTGGGCAGGGAGTACAGAAGG - Intergenic
1143183582 17:4998162-4998184 GGCTGGGGAAGGGGGAGGGAAGG + Intronic
1143457695 17:7078372-7078394 GGCAGGGGCAGGAGGACACAGGG + Intronic
1143515327 17:7416888-7416910 GGCAGGGAAAGGAGGAGTGAGGG - Intronic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1143852327 17:9822153-9822175 GGCTGTGTGAGGATGCCAGATGG - Intergenic
1144274236 17:13649825-13649847 GGGTGGATAAGGAACACAGATGG - Intergenic
1144495210 17:15741477-15741499 GGCTGGCTTCGGACGACAGAGGG - Intronic
1144872068 17:18377828-18377850 GGCTGGTGAAGGAGGGCAGGAGG - Exonic
1144889622 17:18487087-18487109 GGGAGGGTGAGGAGGACAGATGG + Intronic
1145142589 17:20457209-20457231 GGGAGGGTGAGGAGGACAGATGG - Intronic
1147120737 17:38333821-38333843 GCCAGGGTGAGGACGACAGAAGG - Intronic
1147318333 17:39631699-39631721 GGCTGGGAAGGGAGGAGAGAAGG + Intronic
1147387037 17:40088958-40088980 GGCAATGCAAGGAGGACAGAGGG - Intronic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147780586 17:42938369-42938391 GGCTGAGGCAGGAGGATAGATGG + Intergenic
1148000294 17:44383816-44383838 GGCTAGGAAAGGGAGACAGAGGG + Intronic
1148178136 17:45585045-45585067 GGCCGGGTGGGGAGGCCAGAGGG + Intergenic
1148200632 17:45747908-45747930 GGCTGGGTATTGAGGACACTGGG + Intergenic
1148860046 17:50600011-50600033 GGCTTGGCAAGGCGGGCAGAGGG - Intronic
1149518825 17:57302950-57302972 GGCCGAGTGAGGAGGAGAGAGGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1150065647 17:62106800-62106822 GTCTGGGTAAAGAGGACTCATGG - Intergenic
1150408033 17:64919335-64919357 GGCCGGGTGGGGAGGCCAGAGGG + Intronic
1150832697 17:68538340-68538362 GGCAGGGAAGGGAGGCCAGAGGG + Intronic
1150920155 17:69474543-69474565 CGCAGGGTAAGAAGGAGAGAGGG - Intronic
1151386541 17:73758542-73758564 GCCTGGGGAAGGAGGAGGGAGGG + Intergenic
1151418318 17:73981239-73981261 AGCTGGGTAAGAAACACAGAAGG + Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151713085 17:75817823-75817845 GCCTGGGGAAGCAGGACACAGGG + Intronic
1151887941 17:76934100-76934122 GACTGAGGAAGGAGGAGAGAAGG + Intronic
1152524311 17:80878954-80878976 GCCTGGGGAAGGAGGAGGGACGG - Intronic
1152569752 17:81116466-81116488 GGTTGGGTAAGGAGGAGGGCTGG - Exonic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1153679148 18:7483969-7483991 GGCTGGGTAAGCAGCCCTGAAGG + Intergenic
1154079549 18:11242885-11242907 AGCAGAGTAAGGAGCACAGAGGG + Intergenic
1155305335 18:24472805-24472827 GGGTGGGGAAGGAGAACAGCAGG + Intronic
1156084250 18:33379950-33379972 GGCTGGGTGTGGAGCAGAGAGGG + Intronic
1156084395 18:33381254-33381276 AGCTGGGTATGGAGCAGAGAGGG + Intronic
1156553787 18:38044969-38044991 GGAGGGGTAAGGAGGAAAGCTGG + Intergenic
1157116100 18:44864092-44864114 TCCTGGGGCAGGAGGACAGAGGG + Intronic
1157331594 18:46708130-46708152 GGCGGGACAAAGAGGACAGAGGG - Intronic
1158172657 18:54616877-54616899 GGCTGGGTAGGGAGGATGAAAGG + Intergenic
1158676220 18:59521040-59521062 GGCTGAGGGATGAGGACAGATGG - Intronic
1158944471 18:62436700-62436722 GGCTTGGCTAGGAGGTCAGATGG + Intergenic
1159436079 18:68419074-68419096 GCCTGAGTCAGGAGGAGAGAGGG - Intergenic
1159936742 18:74374606-74374628 GGCTGTGACAGCAGGACAGAGGG + Intergenic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160461471 18:79042010-79042032 GGCGGGGTCAGTTGGACAGAGGG + Intergenic
1160517894 18:79488576-79488598 GGGTGGACAAGGAGGACAGCAGG - Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160684236 19:426215-426237 TGCTGGGTGACGAGGGCAGAGGG + Intronic
1161313482 19:3607333-3607355 GGGTGGGGTGGGAGGACAGAGGG + Intergenic
1161496842 19:4591195-4591217 GGCTGGGGACGGACTACAGAGGG - Intergenic
1161875545 19:6905892-6905914 GGCTGTCTAAGGAGGATACAAGG - Intronic
1164583147 19:29447580-29447602 GGCTGGGAAAGGCAGCCAGAGGG - Intergenic
1164684674 19:30158941-30158963 GGAGGGGAGAGGAGGACAGAAGG - Intergenic
1165006680 19:32813073-32813095 GGCTGAGTAAGGAGGATCGCTGG + Intronic
1165221072 19:34317169-34317191 TGCTGGGAAAGGAACACAGACGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166338370 19:42122450-42122472 GGCAGGGGAAGTGGGACAGATGG - Intronic
1166878059 19:45910070-45910092 GACTGGATAAGGAGGAGGGAAGG + Intergenic
1167491035 19:49792734-49792756 AGCTGGGTAAGGAGCAGTGAAGG - Intronic
925055800 2:856496-856518 GGCTGGGCAGGGAGGAGAGCAGG - Intergenic
925146754 2:1587490-1587512 GGATAGGGCAGGAGGACAGAGGG - Intergenic
925458956 2:4043498-4043520 GGCCAGGTCAGCAGGACAGAGGG - Intergenic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
927095662 2:19746036-19746058 AGCTGGGAGAGGAGGACAGAGGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927589332 2:24339566-24339588 GGTGGGGTAGGGAGGAAAGAGGG + Intronic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
928112789 2:28524121-28524143 GGCTGGGTGGTCAGGACAGATGG + Intronic
928432840 2:31234632-31234654 GGCTGGGTACGGACGACCGCCGG + Exonic
928871021 2:35979683-35979705 GGCTGTGTGAGGATGAGAGATGG - Intergenic
932273501 2:70433011-70433033 AGCTGGGGGAGAAGGACAGAGGG - Intergenic
932463859 2:71900765-71900787 GGCAGAGTGAGGAGGAGAGATGG + Intergenic
932545645 2:72706322-72706344 GGCTGGGACAAGAGGACATAAGG + Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
935374559 2:102381259-102381281 GGCCAGCTGAGGAGGACAGATGG + Intronic
936020080 2:108988221-108988243 GGCTGGGCAGGGAGGTCAGCAGG - Intronic
936285656 2:111179161-111179183 GTCTGGGGAGGGAGGACAGCCGG + Intergenic
937042983 2:118835580-118835602 GGCTGGGCGACGAGGAGAGAGGG + Intergenic
938132868 2:128732289-128732311 GGCTTGGAAAGGAGGTGAGAGGG + Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938716619 2:134027691-134027713 AGCTGGGGGCGGAGGACAGAGGG + Intergenic
939529289 2:143337057-143337079 ATCTGGTCAAGGAGGACAGAGGG + Intronic
940833399 2:158493527-158493549 GCCTGGAAAAGGAGGACAGGTGG - Intronic
941407239 2:165105622-165105644 GGGTGGGTAAGGTGTACAGCAGG + Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
941764759 2:169284743-169284765 GGCTGAGTTAAGGGGACAGAAGG - Intronic
946596960 2:221316471-221316493 GGCTGGGGAGGGAGAAGAGATGG - Intergenic
947637882 2:231689219-231689241 GGTGGGGGAAGGAGGACAAAGGG - Intergenic
947960277 2:234230436-234230458 GGCTGGGAAAGGAGGTCTGTCGG + Intergenic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948485548 2:238278733-238278755 TGCCGGGTAAAGAGGGCAGAGGG + Intronic
948918344 2:241049796-241049818 GGCTGGGGGCGGGGGACAGAGGG - Exonic
949009798 2:241671972-241671994 GGCAGGGTGAGGAGGGCAGGGGG - Intronic
1169217888 20:3803966-3803988 GGCAGGGGTGGGAGGACAGATGG - Intronic
1169257957 20:4112987-4113009 GGCTGAGTTATGAGCACAGATGG - Intergenic
1169262495 20:4148894-4148916 GGCTGGCGGAGGAGGAGAGACGG + Exonic
1169465633 20:5835644-5835666 GGCTGGTGGAGGAGCACAGATGG + Intronic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171113440 20:22504165-22504187 GGCCAGGTAAGGAAGAGAGACGG - Intergenic
1171264908 20:23763356-23763378 ACCTGGGTATGGAGTACAGAGGG - Intergenic
1171274554 20:23845047-23845069 ACCTGGGTATGGAGTACAGAAGG - Intergenic
1171769598 20:29312215-29312237 GGCTGAGGAGGGAGGAAAGAAGG + Intergenic
1172080492 20:32336972-32336994 AGCTGGGCAAGGAGGAGGGAAGG + Intergenic
1172204638 20:33154262-33154284 GGCTGGACAAGGAAGAGAGATGG + Intergenic
1172598996 20:36170704-36170726 GGCTGGGGAGGGAGGAGAGTGGG + Intronic
1172614180 20:36272781-36272803 TGCTGGGAACGGAGGAGAGATGG + Intergenic
1173595938 20:44258394-44258416 GGCTGGGCAGGGAAGCCAGAGGG - Intronic
1173980086 20:47217125-47217147 AGCTGGGTAAGGAGGTAGGAAGG + Intronic
1174095941 20:48089510-48089532 GGCTGGGGTAGGAGGCCAAAGGG - Intergenic
1174488333 20:50874965-50874987 GCATGGTCAAGGAGGACAGAGGG - Intronic
1175066851 20:56296453-56296475 GGGTGGGTAAGCTGGAAAGATGG - Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175287898 20:57850017-57850039 GTCTGGGTTAGGAAGCCAGAAGG + Intergenic
1176148826 20:63578650-63578672 CGCTGGGTGAGGAGGACCTAGGG - Intergenic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178376372 21:32070873-32070895 GGCAGAGCAAGGAGGACAGCGGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178899753 21:36589474-36589496 GGCTGGGGAGGGAGGAGGGAGGG - Intergenic
1179654805 21:42838235-42838257 GGCTGTGGAAGGAGGCCAGAAGG - Intergenic
1179942829 21:44650776-44650798 GGCTGGGAAAGGAGTTCTGAGGG + Intronic
1181063720 22:20295199-20295221 GGCTGGGAAGGGTGGAAAGAAGG - Intergenic
1181115729 22:20631689-20631711 TGCTGGGTCATGAGGACACAGGG + Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1182098171 22:27639599-27639621 GGCTGGGTAAGGAGTTCTCAGGG + Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182325859 22:29512135-29512157 GGCTGGGAAGAGAGGAGAGAGGG + Exonic
1182878349 22:33711745-33711767 GGCTGAGGAAGGAGGACTGCTGG - Intronic
1183061307 22:35337952-35337974 AGCTGGCTAAGGAGGAGAGGCGG - Intronic
1183353820 22:37348216-37348238 TGCTGGGGAAGGAGGAGAGCAGG + Intergenic
1183661436 22:39223903-39223925 GGCTGGGAATGGGGGAGAGAAGG - Exonic
1183702734 22:39458869-39458891 GGCTGGGCAGGGAGGCCAGGTGG + Intronic
1183733776 22:39632345-39632367 GGCTGGGCAAGGAGGTCTGCTGG - Intronic
1183984394 22:41561623-41561645 GGCTGGGAAAGGCAGACAGTTGG + Intronic
1184571224 22:45326153-45326175 GGCGGGTTCAGGAGGACACAGGG - Intronic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1184987908 22:48147885-48147907 GCCTGGGAAAAGCGGACAGAAGG + Intergenic
949505092 3:4719905-4719927 GGCTGGGGCAGGGGGACAGATGG + Intronic
949700914 3:6756828-6756850 GGCTGGGGAAGGGAGAGAGAAGG + Intergenic
950634902 3:14307794-14307816 TGCTGGAGAAGGAGGAGAGAGGG - Intergenic
951575103 3:24105368-24105390 GCCTGGGTAAAGAGTACACAGGG + Intergenic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
952486093 3:33811453-33811475 GGCAGGGAAAGGAGGAGAAAAGG - Intronic
952650200 3:35717079-35717101 TGCTAGGTAAGGAGAAAAGAAGG - Intronic
953127029 3:40101017-40101039 TGGTGTGTAAGGAGCACAGATGG - Intronic
953545625 3:43861984-43862006 GGCAGGGTTAAGGGGACAGATGG - Intergenic
953980097 3:47409321-47409343 GGCTGGGTGAGCAGGGTAGAGGG + Intronic
955064156 3:55520211-55520233 GGGAGGGCAAGGGGGACAGATGG + Intronic
956470930 3:69566200-69566222 GGCAAGGTGAGGAGGGCAGAAGG - Intergenic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
956746020 3:72311484-72311506 GGGTGGGGAAGGAAGAGAGATGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956780426 3:72599071-72599093 GGGTGGGTAAGGAGACCAGGGGG + Intergenic
957684529 3:83484054-83484076 AGCAGGGTAAGGAGGAGAGGGGG - Intergenic
959754087 3:109875639-109875661 GCCTGGGCATGGAGCACAGAGGG - Intergenic
960023629 3:112984177-112984199 GGATGGGTAAGGAGGTTGGAGGG + Intergenic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961720528 3:128892117-128892139 GCCTGGGGATGGTGGACAGATGG + Intronic
961798074 3:129424147-129424169 GGCTGGGCACCGAGGACACAGGG - Intronic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
962740091 3:138357154-138357176 GGGTGGGTAAATAGGAAAGACGG + Intronic
963772662 3:149404652-149404674 GGATGTGTAAGGAGGAAGGAAGG + Intergenic
963819873 3:149878294-149878316 GTCTAGGTAAGGAGGAAAGATGG + Intronic
963881459 3:150533325-150533347 AGCTGGGAAAGGAGGAGAAATGG - Intergenic
964491615 3:157242092-157242114 GGCAGGGGAAGAAGGACAGTGGG - Intergenic
966477386 3:180366194-180366216 GGGTGGTTAAGGGGGACTGAGGG - Intergenic
966737953 3:183204972-183204994 GGCTGGGTAAAGGTGAGAGATGG + Intronic
966752406 3:183334863-183334885 GGGAGGCTAAGGCGGACAGATGG + Intronic
966946503 3:184780672-184780694 GGTTGGAGAAGGAGGATAGATGG - Intergenic
967109619 3:186282119-186282141 GGCCAGGTATGGGGGACAGAAGG + Intronic
967666035 3:192173124-192173146 GGTTGGGGAAGGAGGTGAGAGGG + Intronic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
968929808 4:3572896-3572918 GGCTGGAGAAGCAGGGCAGAGGG - Intergenic
968968581 4:3781804-3781826 GGCTGGGGAAGGAGCACTAAGGG + Intergenic
970067527 4:12116073-12116095 GGCTGGGTGTGGAGCAGAGAGGG + Intergenic
970396917 4:15677673-15677695 GGGAAGGTATGGAGGACAGAGGG - Intronic
970449886 4:16156219-16156241 GGCTGGGAAATGAGGACATGGGG - Intergenic
971030603 4:22633744-22633766 GGCTGGGTTAGGGGGGCTGAAGG - Intergenic
971147414 4:23994172-23994194 GGCTTGTTAAGCAGGACAGAGGG - Intergenic
971341985 4:25779155-25779177 GGCTGCGCAAGGTGGACACATGG - Exonic
972381656 4:38525307-38525329 GGCTGGGGAAGGAGGCCCGGTGG - Intergenic
972642725 4:40940309-40940331 CGCTGAGTAAGTAGGACAGCAGG - Intronic
973801465 4:54482826-54482848 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
975229558 4:71915997-71916019 GCCTGGGAAAGGAAGACATAAGG + Intergenic
976409110 4:84692293-84692315 GTCTGTGTAATGAGGACAAATGG + Intronic
977591046 4:98827595-98827617 TGCTGGGCAAGGACAACAGAGGG - Intergenic
980423290 4:132592659-132592681 TGTTAGGTTAGGAGGACAGATGG - Intergenic
980440371 4:132835915-132835937 GGTAGGCTGAGGAGGACAGAAGG - Intergenic
981365920 4:143903027-143903049 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981386550 4:144138199-144138221 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981808083 4:148740315-148740337 GGCTGGGTAAGGAGGCAGGTGGG + Intergenic
982587044 4:157255074-157255096 GACTGGGTAAGAGGGAGAGAAGG - Intronic
983672490 4:170254412-170254434 GAGGGAGTAAGGAGGACAGAAGG - Intergenic
984581142 4:181511422-181511444 GCCTGGAGGAGGAGGACAGAAGG + Intergenic
984626945 4:182018256-182018278 GGATGGCTATAGAGGACAGAAGG - Intergenic
984810672 4:183793782-183793804 GGTTAGGTAAGTGGGACAGATGG + Intergenic
986402086 5:7392584-7392606 TGCTGGGTTATGAGGATAGAGGG + Intergenic
986501820 5:8409038-8409060 GGCTGGGGAGTGAGGAGAGATGG - Intergenic
986897447 5:12387301-12387323 AAATGGGTTAGGAGGACAGAGGG - Intergenic
987062694 5:14257565-14257587 GGGTGGGGAAGGGGGACAGACGG + Intronic
987069168 5:14319801-14319823 GAATGGGGAAGGATGACAGAGGG + Intronic
987255739 5:16149145-16149167 CACTGGGTAAGGAGGACACTGGG - Intronic
990029326 5:51237440-51237462 AACAGGGTAAGGAAGACAGAGGG - Intergenic
991085825 5:62647657-62647679 GGCTGCCTTAGCAGGACAGAGGG - Intergenic
991308996 5:65214077-65214099 GGCTGGGAGAGCAGGACAGTTGG - Intronic
992144346 5:73830325-73830347 GGCTGGATCACGAGGTCAGAAGG + Intronic
993736071 5:91477695-91477717 GGCTGGGTAAAGGGGATAGTGGG + Intergenic
996131615 5:119788485-119788507 GGATGGGTAAGGATATCAGAGGG + Intergenic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996445784 5:123548660-123548682 GGCTGAGTTAGGAAGACAGGAGG + Intronic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997680780 5:135749344-135749366 GGCTGGGGGAGGGGGACAGTGGG - Intergenic
998262401 5:140641631-140641653 GGCAGGGAAAGGAGAACACACGG - Intronic
998352014 5:141508102-141508124 GGGTAGGTTAAGAGGACAGAGGG + Intronic
998418642 5:141963956-141963978 GGCTCTGTAAGGAGGAAAGAGGG - Intronic
998811823 5:145974198-145974220 GGCTGTGTTAGGAGGTCATATGG - Intronic
998860724 5:146441060-146441082 GGCTGGGTATGGAAAACAGATGG + Intergenic
999817015 5:155187249-155187271 GGAAGGGTAAGGAGGGCAGGTGG - Intergenic
999824640 5:155262430-155262452 GGCTGTGTAAGGTGCACAGGTGG + Intergenic
999943471 5:156569743-156569765 AGGTGGATATGGAGGACAGAGGG + Intronic
1000075338 5:157779319-157779341 GGCGGGGAATGGAGGAGAGAGGG + Intergenic
1000095465 5:157967441-157967463 GGCTGGATCAGGAGCACAGAAGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1000820648 5:165979047-165979069 GGGTTGGGAGGGAGGACAGAAGG - Intergenic
1001049945 5:168406068-168406090 GGAAGGGTTAGCAGGACAGAGGG + Intronic
1001122606 5:168992676-168992698 GACTGGGGCAGGGGGACAGATGG - Intronic
1001302569 5:170546340-170546362 GGCTGGGAAATGAGGATGGAAGG - Intronic
1001434241 5:171686947-171686969 GACTGGATCAGGAGGACAGGTGG + Intergenic
1001964931 5:175903387-175903409 GTCTGGTCAAGGAGGTCAGAAGG + Intergenic
1002095408 5:176828061-176828083 GGAGGGGGAAGGAGGACAAAAGG - Intronic
1002105958 5:176879549-176879571 GGGTGGGTGAGGTGGACAGGAGG + Intronic
1002252024 5:177935801-177935823 GTCTGGTCAAGGAGGTCAGAAGG - Intergenic
1002419586 5:179138672-179138694 GCCTGGGGCAGGAGGACAGCAGG + Intronic
1003147571 6:3521585-3521607 GGCTGTGTAAGGATAACACAAGG - Intergenic
1003180257 6:3784878-3784900 AGCTTTGAAAGGAGGACAGAAGG - Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004955590 6:20724475-20724497 GGGAGGCCAAGGAGGACAGATGG + Intronic
1006026924 6:31152884-31152906 GGCGGGGACAGGAGGCCAGAAGG - Intronic
1006386289 6:33732879-33732901 GGTAGGGGAAGGAGGACAGGTGG - Intronic
1007077017 6:39074525-39074547 GGCAGATTAGGGAGGACAGAGGG - Intronic
1008087198 6:47257636-47257658 GGAGGGGGAAGGAGCACAGAAGG + Intronic
1009414017 6:63396165-63396187 GGCTGGGTAGGGTGGAGAGACGG + Intergenic
1010086015 6:71918907-71918929 GGCTGGGCAAGAAAGAGAGAAGG + Intronic
1010784903 6:79989810-79989832 GGTAGGGTAAGGAGAACAGAAGG - Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1012095434 6:94951952-94951974 TGCTTGGTAATAAGGACAGAGGG + Intergenic
1012228496 6:96732538-96732560 GGCTGAGTAACAAAGACAGAGGG - Intergenic
1012935767 6:105365622-105365644 GGTTGGGAAAGGAGGAAGGAAGG + Intronic
1014093608 6:117434656-117434678 GGAAGGGTACGGAGAACAGAGGG - Intronic
1014164295 6:118205974-118205996 GACTGGGGAAGGGGGACATAGGG + Intronic
1015301788 6:131660881-131660903 GGCTGGGTAAGGGGGAAATGTGG - Intronic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1015937768 6:138420069-138420091 AACTGGGCAAGGAGTACAGAGGG - Exonic
1016547057 6:145236058-145236080 TGCTGGCAAAGGAGCACAGAAGG - Intergenic
1016798434 6:148143120-148143142 GGCTGGGGAAGGAGGATGGAGGG + Intergenic
1016885062 6:148951295-148951317 GGCTGGATAAAGAGTAAAGATGG + Intronic
1018413359 6:163579165-163579187 GGCTGGGTAATGATGAAAAAAGG + Intergenic
1018929623 6:168232339-168232361 GCCTGGGAAAGGAGGAGACAAGG - Intergenic
1018957422 6:168419576-168419598 GGCTGGGGAAGGGGGAGAGAGGG + Intergenic
1019315131 7:380661-380683 GGAGGGGGCAGGAGGACAGAGGG + Intergenic
1019457862 7:1140175-1140197 GGCTGAGTCAGGAGGATGGATGG + Intergenic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1021747091 7:23752578-23752600 GGGAGGCCAAGGAGGACAGATGG - Intronic
1022098512 7:27155672-27155694 GGCGAGGGAATGAGGACAGAGGG - Intronic
1022486662 7:30784366-30784388 GGCAGAGAAAGGAGGAAAGAAGG - Intronic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022728854 7:33004385-33004407 GGCCGGGTAAAGTGGGCAGAGGG - Intronic
1022816980 7:33923329-33923351 GGCTGGGTGAGTATTACAGACGG - Intronic
1024258447 7:47556949-47556971 GGCAGGGACTGGAGGACAGAGGG - Intronic
1024298155 7:47862791-47862813 AGCCAGGAAAGGAGGACAGAAGG + Intronic
1024729505 7:52238812-52238834 GGAAGGGTGGGGAGGACAGAGGG - Intergenic
1025029719 7:55547219-55547241 GGCTGGGGACGGGGGACAAAGGG + Intronic
1025044792 7:55683605-55683627 GGCCGGGTAAAGTGGGCAGAGGG + Intergenic
1026178274 7:68016576-68016598 AGCAGGGAAAGAAGGACAGAAGG - Intergenic
1026277752 7:68895041-68895063 GGGTAGGGAAGGAGGAGAGAGGG - Intergenic
1028525663 7:91783162-91783184 GGCAGGGTAAATAGGACAGGTGG - Intronic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1031538841 7:122968044-122968066 GGCTGGGAAAGGTAGAGAGAGGG + Intergenic
1031734450 7:125340232-125340254 GGCTGAGGCAGGAGAACAGAGGG + Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032374278 7:131394363-131394385 GGCAGGGTATGGTGGAGAGATGG + Intronic
1033390353 7:140922158-140922180 ACCTGGGTAAAGAGGACAGTAGG + Intronic
1033519347 7:142145348-142145370 GGGAGGGTAAGGAGGAAAGAAGG - Intronic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034431821 7:151044960-151044982 GGCTCTGTAAGGGGGACAGAGGG + Intronic
1034451341 7:151138725-151138747 GGCTGAGTAGGGAGGTCGGACGG + Intronic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1035918170 8:3648051-3648073 GGTTGGAGATGGAGGACAGATGG + Intronic
1036222157 8:6929869-6929891 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036229040 8:6983886-6983908 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036231493 8:7002991-7003013 GGCTGGGAAAGGCAGACAAAGGG - Intronic
1036233954 8:7022085-7022107 GGCTGGGAAAGGCAGACAAAGGG - Intergenic
1036579495 8:10060464-10060486 GGCTGTGTAATGAGGATGGATGG + Intronic
1036773880 8:11596844-11596866 GGCAGGGTGGGGAGTACAGATGG - Intergenic
1037455863 8:19063489-19063511 GGTTGTGTAAGGAAAACAGAGGG - Intronic
1039601488 8:38842088-38842110 GGCAGGGTAAGGAGGAATGGGGG - Intronic
1039672728 8:39620860-39620882 GGATGGGTGAGGAGGTGAGAGGG + Intronic
1039752271 8:40489525-40489547 GGATGGGGTAGGAGGAGAGAAGG - Intergenic
1039981146 8:42410893-42410915 GGCTGGGAAGGGAGCTCAGAAGG + Intergenic
1040848143 8:51867804-51867826 GGCTGGGGCAGGAGGGTAGATGG + Intronic
1041023187 8:53658553-53658575 GGCTGGGCTAGGGAGACAGAGGG - Intergenic
1042309448 8:67365836-67365858 AGCAGGGTAAGGAGGATGGAGGG - Intergenic
1042757191 8:72228018-72228040 GGCTGGGAAAGGAGCAAGGAAGG + Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043171536 8:76972587-76972609 GCCTGGGTAGGGAGCAGAGAGGG - Intergenic
1043673096 8:82913663-82913685 TGCTGGGTAGTGAGGACAAATGG - Intergenic
1044415802 8:91938048-91938070 GAATGGGAAAGGAGAACAGATGG - Intergenic
1044505337 8:93010120-93010142 GGATGGGGAATGAGGAGAGACGG + Intronic
1044750492 8:95411167-95411189 GGCAGGGGAAGGAGGACAGAAGG - Intergenic
1046034822 8:108827926-108827948 GGAGGGGAAAGGAGGATAGACGG + Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048367543 8:133751630-133751652 GGTTGGGCAAGGAGGAAACAGGG - Intergenic
1049493008 8:142914974-142914996 GGATGGGGATGGAGGACTGAAGG - Intronic
1051214101 9:14778369-14778391 GGCTGGCCAAGGCGGGCAGATGG + Intronic
1051371968 9:16366416-16366438 GGCTGGGGAAGGGGGACACCAGG - Intergenic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1053170113 9:35872199-35872221 GGCTGGGTATGGAAGAGTGAGGG - Intergenic
1053385352 9:37682810-37682832 GTCAAGGAAAGGAGGACAGAAGG + Intronic
1054460471 9:65459576-65459598 GGCTGGAGAAGCAGGGCAGAGGG + Intergenic
1054700196 9:68405558-68405580 GGATGAGAAAGAAGGACAGATGG - Intronic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055576148 9:77661824-77661846 GGTTGGGTGAAGAGGGCAGAGGG - Intergenic
1055753245 9:79530157-79530179 GGAAGGGTAAGAAGGAAAGAAGG - Intergenic
1056296091 9:85194430-85194452 GGCTGGGTAATGAGGAAGGCTGG - Intergenic
1056381703 9:86062449-86062471 GGGAGAGAAAGGAGGACAGAGGG + Intronic
1057037450 9:91821608-91821630 GGCTGGAGAACGAGGACAGGGGG - Intronic
1057755223 9:97829411-97829433 GGCTGGGTAATGAGTACAAAGGG + Intergenic
1057855137 9:98595872-98595894 GGCTGGGGAAAGAGGACTTATGG - Intronic
1058594159 9:106597271-106597293 GGCTGGCTGAGAATGACAGAAGG + Intergenic
1059326657 9:113507797-113507819 TTCTTGGTAGGGAGGACAGATGG + Intronic
1059438672 9:114290640-114290662 GGCTGGACCAGGAGGACAGGAGG - Intronic
1059957600 9:119534478-119534500 GGCTCTGTAAGGAGGACAGTGGG - Intergenic
1060734641 9:126059228-126059250 GGCTGGGTAGGAGGGACAGAGGG - Intergenic
1060799587 9:126535162-126535184 GGCTGGTGAAGGAGCCCAGATGG + Intergenic
1061515528 9:131087812-131087834 GGCTGGGTAAGGAGGCCCTAAGG + Exonic
1061681078 9:132242660-132242682 GTCTGGGGGAGGAGGAGAGAAGG + Exonic
1061970230 9:134040978-134041000 GTCTGTGCAAGGAAGACAGAGGG + Intronic
1062523752 9:136970074-136970096 GGATGGGGAAGGAGGAAGGAGGG + Intronic
1062610288 9:137370422-137370444 GGCTGGGCCATGAGGACAGATGG + Intronic
1185778973 X:2829349-2829371 GCCGGAGTACGGAGGACAGACGG + Intronic
1185896063 X:3860047-3860069 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185901182 X:3898473-3898495 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185906296 X:3936911-3936933 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1188225477 X:27592243-27592265 GGCTGTGTGAGGATGCCAGATGG - Intronic
1189795866 X:44645439-44645461 GGCTGAGAAAGAAGGAAAGAAGG + Intergenic
1190085708 X:47393664-47393686 GGCTGAGACAGGAGGACAGCTGG - Intronic
1190480263 X:50870325-50870347 GGCTGACCAAGGAGGACAGGTGG + Intergenic
1191178581 X:57534812-57534834 GGCTGGGAGAGGTGGACAGATGG - Intergenic
1192180711 X:68914068-68914090 GGGTGGGTAGGGAGGTCAGTAGG - Intergenic
1192440079 X:71167795-71167817 GACTGGGTAAGGAGAAAATAGGG + Exonic
1192732899 X:73819017-73819039 GGCTGGATGTGTAGGACAGAGGG - Intergenic
1194079166 X:89436484-89436506 GGGTGGATAAGGAGGTCAGGAGG + Intergenic
1195904579 X:109830782-109830804 GGCTGGGAAAGAACCACAGAAGG + Intergenic
1196034794 X:111132445-111132467 GGCAGGGTGAGGGGGACAAAGGG + Intronic
1196425088 X:115561657-115561679 AGCTGGAGAAGGACGACAGAGGG - Intronic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198510827 X:137349828-137349850 GGCTCTGAAAGGTGGACAGAAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198736560 X:139792101-139792123 ACCTGGGGAAGGAGGAAAGAGGG + Intronic
1199489144 X:148379543-148379565 GGCAAGACAAGGAGGACAGAGGG + Intergenic
1199673770 X:150167289-150167311 GGCTGGCTAATGTGAACAGAGGG - Intergenic
1200068712 X:153517587-153517609 AGCTGGGTGAGGAGGAGGGAGGG - Intergenic
1200072882 X:153537709-153537731 GGCTGGGCAAGGAGGAGGGAAGG - Intronic
1200088538 X:153623683-153623705 GGCTGGGCCAGGAGGAGGGAGGG + Intergenic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200431787 Y:3091800-3091822 GGGTGGATAAGGAGGTCAGGAGG + Intergenic
1201291061 Y:12421151-12421173 GCCTCAGTATGGAGGACAGACGG - Intergenic
1201327787 Y:12783395-12783417 GGCCTGAGAAGGAGGACAGATGG + Intronic