ID: 1160628764

View in Genome Browser
Species Human (GRCh38)
Location 18:80231006-80231028
Sequence GACCTAAAGAGCTACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160628761_1160628764 11 Left 1160628761 18:80230972-80230994 CCTGAGGCTGAATTCAAAAAGGG 0: 1
1: 0
2: 3
3: 11
4: 160
Right 1160628764 18:80231006-80231028 GACCTAAAGAGCTACAGTGATGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160628764 Original CRISPR GACCTAAAGAGCTACAGTGA TGG Intronic
903446938 1:23428520-23428542 GATCTAAAGAGCAACAGGGAGGG - Intergenic
908238865 1:62172368-62172390 GACCTAAAGAGCTACCTGGAAGG + Intergenic
908403144 1:63789569-63789591 GACCTAAAGAAATAGAGTGGAGG + Intronic
910207848 1:84765500-84765522 GAGCTCCAGAGCCACAGTGAGGG + Intergenic
922224038 1:223629784-223629806 GAGCTAGAGATCTACAATGAAGG - Intronic
1064381697 10:14847972-14847994 GAGATAAAGAGCTTCAGAGAGGG - Intronic
1064432716 10:15285121-15285143 TAACTACACAGCTACAGTGAAGG + Intronic
1068973535 10:62983726-62983748 AACATAATGAGCTACAGTGGTGG - Intergenic
1073179761 10:101576644-101576666 GTTCTTAAGAGCTACAGTCAGGG - Intronic
1074215386 10:111379057-111379079 GACCTAAAGATCTAGAGGAAAGG - Intergenic
1083703392 11:64496173-64496195 GACCCAAAGGGCTACACGGAAGG + Intergenic
1085127433 11:74011287-74011309 GACCTAAAGAGGGGCAGTCAGGG - Intergenic
1089114774 11:116085914-116085936 GACCAAAAGAGCTGCTGTAACGG + Intergenic
1089799069 11:121008956-121008978 GATATAAAGATCTCCAGTGAAGG + Intergenic
1092629233 12:10360827-10360849 GCCCTAAAGAGCCCCAGTGTGGG + Intergenic
1092964304 12:13626835-13626857 GAGATAAAGAGCTATGGTGAGGG - Intronic
1093213840 12:16339723-16339745 AACTTAAAGAGCTACAGTTTTGG + Intergenic
1095733711 12:45534017-45534039 GATTTTAAGAGCTCCAGTGATGG - Intergenic
1096213323 12:49783590-49783612 GACCTTAACAGGAACAGTGATGG - Intergenic
1098079290 12:66766706-66766728 GACTTAAAGATCAACAGTCAGGG + Intronic
1099451880 12:82817608-82817630 GACCTAATGAATAACAGTGAAGG - Intronic
1102363459 12:112310151-112310173 TACCTCAAGGGTTACAGTGATGG + Intronic
1105994316 13:25655457-25655479 GACATTAAGAGCTCCACTGATGG - Intronic
1106546672 13:30736987-30737009 AAACAAAACAGCTACAGTGATGG + Intronic
1106546997 13:30739329-30739351 GAACAAAATAGGTACAGTGAAGG - Intronic
1106730267 13:32533915-32533937 GACCTAAAGAGGTACAGACCAGG + Intronic
1108661721 13:52594131-52594153 GACCTAGAGAGCTAGTATGAAGG - Intergenic
1111275977 13:85947456-85947478 GAACTAAAAAGATACAGAGATGG - Intergenic
1115333685 14:32223986-32224008 GACTCATAGAGCTTCAGTGATGG + Intergenic
1116996309 14:51328782-51328804 GAAATAGAGAACTACAGTGAAGG + Intergenic
1120085912 14:80272581-80272603 GACTTGAAGAGCAACAGAGAGGG + Intronic
1120626965 14:86839845-86839867 GACATAAAGAGATAGACTGATGG - Intergenic
1121739015 14:96238507-96238529 GTCTTAAGGAACTACAGTGATGG - Intronic
1127428690 15:58881221-58881243 GAGATAAAAATCTACAGTGAAGG + Intronic
1128381528 15:67116684-67116706 GACCTAAATGGGCACAGTGAAGG + Intronic
1129454451 15:75669319-75669341 GACCTAAAGAGCTGCTGGGCAGG - Intergenic
1130072753 15:80662599-80662621 GACATAATCAGCTCCAGTGAAGG + Intergenic
1131147574 15:90024218-90024240 GGCCAAAAGAACTGCAGTGATGG - Intronic
1132135763 15:99337122-99337144 GGGCTAAGGAGCTATAGTGAGGG - Intronic
1133169792 16:3975090-3975112 GAGCTGGAGAGCCACAGTGATGG - Intronic
1135302414 16:21342330-21342352 AAAATAAAGAGCTCCAGTGAAGG - Intergenic
1135491906 16:22916604-22916626 GATCTGAAGTGCTACACTGAAGG + Intergenic
1135627886 16:24011971-24011993 GACCTAAAGACCAACACTGAAGG - Intronic
1135876676 16:26207027-26207049 GACCTTACCAGCTACAGTCATGG + Intergenic
1138247376 16:55477893-55477915 GACCTGAAGAGCTAAAGAGGTGG - Intronic
1140195019 16:72848552-72848574 AACCAAATGAGCCACAGTGAAGG - Intronic
1142556692 17:782986-783008 GAAATAAAGAGCTACGGAGAGGG - Intronic
1159246212 18:65808623-65808645 GTCCTCAACAGCTACAGGGAAGG + Intronic
1159275917 18:66221450-66221472 GACCTAAGCAGCTAATGTGATGG + Intergenic
1160541402 18:79625763-79625785 GACGGAAAGAGCCACAGTGGAGG + Intergenic
1160628764 18:80231006-80231028 GACCTAAAGAGCTACAGTGATGG + Intronic
1168261391 19:55196990-55197012 GACTTCATGAGCTGCAGTGATGG - Intronic
926072511 2:9909643-9909665 GGCCTAAGGAGCAACAGTGACGG + Intronic
928218660 2:29383731-29383753 GCCCTGAAGAACTGCAGTGAAGG - Exonic
928239106 2:29571212-29571234 CACCTAGAGACCTACAGAGAGGG + Intronic
934066261 2:88344907-88344929 GTCCCAAAGAGCTCCAGAGAGGG + Intergenic
936371250 2:111904045-111904067 AACCTAAAGAGCTGCAGCAAAGG - Intronic
941907230 2:170728651-170728673 TACATAAAAGGCTACAGTGAAGG + Intergenic
942109402 2:172665347-172665369 AACCTAGAGAGCTGCAGGGAAGG - Intergenic
944091384 2:195915938-195915960 CACCTAAAGAGCTAAAGTAATGG - Intronic
946258621 2:218466544-218466566 GAACAAATGATCTACAGTGATGG + Intronic
1169187839 20:3633655-3633677 GATTTGAAAAGCTACAGTGATGG - Intronic
1169525139 20:6416338-6416360 GACCTAAAGGGGTAAAGGGATGG + Intergenic
1176027899 20:62995402-62995424 GACTTTCAGAGCTTCAGTGAGGG + Intergenic
1178330050 21:31681612-31681634 CACCCAAATAGCTACAGTGGTGG - Intronic
1182528434 22:30936861-30936883 GACCTCAAGAAACACAGTGAGGG + Intronic
1184060938 22:42080949-42080971 GACAGAAAGATGTACAGTGAAGG - Intronic
1185371020 22:50461003-50461025 CAACTCAAGAGCCACAGTGAGGG + Intronic
951678310 3:25267057-25267079 TGCCTAAAGAGCTTCAGGGAAGG - Intronic
953386085 3:42506326-42506348 GGCCAAAGGAGCCACAGTGAAGG - Intronic
953457260 3:43053242-43053264 GAGCTAAAGAGCAACAGTGTAGG + Intronic
956321855 3:68006821-68006843 GACATAAAGTGCTATAGTGTGGG + Intronic
957499847 3:81040684-81040706 GAGCTAAACAGATACAGAGAAGG - Intergenic
957783790 3:84853333-84853355 CAACTTAAGAGCTTCAGTGATGG - Intergenic
960050731 3:113237121-113237143 GACCTAAAGCCCTTAAGTGATGG + Intronic
961854163 3:129852591-129852613 GACAAAAAGAGCTATAGAGATGG + Intronic
967495163 3:190135185-190135207 GAACTAAATAGGTAGAGTGATGG + Intergenic
968533658 4:1110755-1110777 CAGCTACAGAGCTACAGTCAAGG + Intronic
974746856 4:66088472-66088494 TCCCTAAAGAGCAGCAGTGAAGG - Intergenic
978638330 4:110838400-110838422 ATCCCAAAGAGCAACAGTGAGGG - Intergenic
978851476 4:113342347-113342369 CACCCAAAGACCTACACTGATGG - Intronic
982519119 4:156390894-156390916 GACCTAGATAAATACAGTGATGG + Intergenic
985161493 4:187048961-187048983 GACCCAAAGAACCACAGAGAGGG - Intergenic
985219157 4:187684270-187684292 GATCTTAAGAACTACAGTTAAGG + Intergenic
991532927 5:67635808-67635830 CACTTTAAGAGCTGCAGTGAGGG + Intergenic
992017932 5:72594687-72594709 GATCTCAAGAATTACAGTGAGGG - Intergenic
993587535 5:89748969-89748991 TATCTCAAGAGATACAGTGAAGG - Intergenic
996639013 5:125730316-125730338 GTCTTAAATAGCCACAGTGATGG - Intergenic
996764855 5:127025869-127025891 GACCCAAAAAGCTAAAGTGAAGG + Intronic
999305465 5:150516601-150516623 GACCTAAAGTCCTAGATTGATGG - Intronic
999717813 5:154376063-154376085 GGCTTAAAGAGGTCCAGTGAAGG - Intronic
1000292024 5:159879412-159879434 TTCCTAAAGAGTTTCAGTGATGG - Intergenic
1001318321 5:170660531-170660553 CAGCTAAAGAGCTAGGGTGAGGG + Intronic
1005669362 6:28089649-28089671 AACCAAAAGAGCTACATTTAGGG + Intergenic
1006448770 6:34093907-34093929 GACTACAAGAGCTGCAGTGAGGG - Intronic
1010091094 6:71982835-71982857 GACCTAAAGGCCTTCAGAGAGGG - Intronic
1011184721 6:84661627-84661649 GATCTAGAGTGCTGCAGTGATGG - Intergenic
1012311005 6:97723946-97723968 GGCCTTAAGAACAACAGTGAAGG - Intergenic
1012946299 6:105469490-105469512 GTCCTAAAGAGGCACAGTGCTGG + Intergenic
1022956490 7:35386156-35386178 GGCCTATAGAGGGACAGTGAGGG + Intergenic
1028136093 7:87224432-87224454 GAGCAGAAGAGCTACAGTGAAGG - Intergenic
1031698852 7:124898202-124898224 GATTTAATGAGCTAAAGTGATGG - Intronic
1032975867 7:137221659-137221681 GAACTTAAGAGATACAGTTATGG + Intergenic
1034055663 7:148032441-148032463 GACCGAAGGAGCTACCGTGCTGG + Intronic
1039889324 8:41673557-41673579 GATCTAAAGTGCTACAGGGGAGG + Intronic
1040606376 8:48936194-48936216 GACCTGCAGATCTTCAGTGATGG - Intergenic
1042862067 8:73325000-73325022 GACCTAAAGAAGTACTCTGAAGG + Exonic
1045259481 8:100559629-100559651 GACCTCCAGTGCTACAGGGACGG + Intronic
1045371791 8:101531718-101531740 AAACTAAAGAGCTACAGGAAAGG - Intronic
1046216336 8:111152498-111152520 CACCAAAAGCGCTTCAGTGAGGG + Intergenic
1049724976 8:144141667-144141689 GGCCTAGAGAGCAACAGTGAGGG - Intergenic
1057161039 9:92888423-92888445 GACAGAAAGAGGGACAGTGAAGG - Intergenic
1060430590 9:123548144-123548166 GAGCCACAGAGCTATAGTGATGG + Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1062253546 9:135609963-135609985 GACCTAGAGAGACACAGAGAAGG + Intergenic
1187004027 X:15214026-15214048 GAGCTAGAGAGCTTCTGTGAGGG - Intergenic
1193005880 X:76617758-76617780 GACCTAAAAAGCAAAAATGATGG - Intergenic
1197116511 X:122840010-122840032 AACCTTAAGATCTTCAGTGATGG + Intergenic
1198448595 X:136743311-136743333 GACATAAAGGGATACAGTTAGGG + Intronic